GIF89a@      " #####$#$#$#$#$#*#D#F#G$G$H$H%H0HCHGHHHHHHHIHSHZGWCQ9O-M'J%M&R,^<uT(g=kAkHkPvkTlkTlkTlkUlkUllUmmYrr_~~]XVSE{9v5p;lIkRkTkTjQbFOu@InGHlTHlTHlTHkUHkUHkUKhUdQVkHUkHUlHUlHUtGUGUGUFU|:Uw/Um,U[4UQ@TIITHHTHGUHGTGGTGGTDDKCCHCCGC:IE,OG%TG$TG$TG$TF$S@)J;-E/7A)>F(AJ$GT$GT$GT$GT$GT$GT$GT$GT$GT$GT$GT$GT$GT$GTAT0T&T"T#T#T#TTT T T##T##T##T##T##T##T##T##T##U'']<](,&rQO [/r6E,6rQbdOK⍠3(VQYd2L-hDpDN0XENܑYsS|vbGщeY_բCh TSKdY_`U)GJ'eTn$ޕ㑥'F_jDX١t(%%6Q''uaGx1(rmTfzF[2EbPbaOUYNEu䨆~upe([MDu$X`%IY\D 0D:-ETd>,PΖ.I+pvcDa%pw]kשޕnKȞ2L?5J,q'R\h"X_z#8|I]geҒYJ.3꒦\:keE쉹)^'fY@s#WvcD3#J[47ηSWeR\Oɲ;J;_T1-e%~bjTx{V`DNO?gѱCKd…m9z6Nqr6[j%YY^e[A mJ7ijAպᆵ[\p; aєMxgY)MR8XI_{mkqelWkOŶo7j{D{3я7'$k^Y@}"EY-`YX•OF+ <@(lPT#U 9 Y0lwYĢ6OCCZІfA0Vj3+*rnu9I;Q@sSkX3 |4bT[Y+2z V:ADҐJ$CL;uXCJJ H vň$eVc@8̝!A))B\"3eNj٢3K.ζ*$SmkCIΈu- 1 ۗTȿݯ rϦKYS Q?FFzW^[U;Dkpb=HFHgɜ27 ?pDhvvs e _Xg<.ߪI~Cg hslWv,rYa߆z_PXiѢyBgc]ea*XႡB.uv|5h5PV]a%U-!$DNZu[^e e17Ii~IPm&bp>E%1}tvtkt(+1)dIkA~p t7 'Hׁf^bIsW"mW],aG?Usr# |  G:``1["1OEi<3Z2g-'Wp˰ ԀqQX X e~귅bhhep^7 3X{FA7!%s1@2ue#EY?O e#hK 8񃁐>\/pc]Nb,;l ;V =bUQhHxDfWJ7]r9\Уh‚5b>P ~!HWipѸ~8GWEޡ_iv^!/JW?J?jy!AOgygs.1f`T71U@"P)O^L>GU {7sHE&o>p$Q6AJ ]Pi P= Z$v"d21(☎Ev6ORRc5K^b~aHYxa~S%qb"IO T&bC"UTrs1@ˑOM! HkUZ:ƒ_fUN4K(R1+EX.ZJ&r( DJv(mgg"kuvk/JVv:Q=E[$^1Id~f~Y(AXp _#W=%ru87>pǑjN Ps)p4aUY@:4FgWT181EP 'YS CkIeX6 -{k!D3BXoţrFiә=AO~~Per1EG̒Hr~id/'u@*s2#Qjp|dUMPrʧ4;Y,mV7I(yuYMc4Z\Q@)vU pS~5XPH1j5lky$GvDuff~%RgGWQԲ fxyLńi0 ']$y8ylMnɖA=!'eUzQU U)0jNO F3a*#N"QDE.';#| VLYP f騞"GlsaI:e&Fzo)`dzG~9P~;$~"T Dp > >`""12!FUuku80)'F jjIZĭS \ rtyfICHך颲ro&*uaq>T g9'-̅>f6#IoEiPYipF;~+Bu ǻƷH>y ٶ ĸ w@ I`(#D[ e/(Z)`opqKiց0Uv䭆:Uc02ːː1 g6lcƻՒm5g_IP PL@\tB{ W,EGfmkrv~2KCw[7vԐ#8f[ A˒L)G]q|;A5 tG@ şp]]ƓyVjL8#'@zu:g+H$Lq9dYNr I@ +z*X=VTLû$5QJ a@{wEm{*G}dh&~LQ*\mWhaXF:i&5A} ?c@ =:uQ/p+ ~Guxe_y IHspVf Nu,z TV*-=?qu10*ҖVW-<ۙ:(flΉcvp>ga# r <]lAfwi&01>b.1Bgn  [ N|1fHfIFjg[zUIgLx#-f9E}yٌScHg}ae\ƚ]pۦ۾!ĝ2KŴʮ=oԝQk^ɉGݍUnP3TPQG^{V̯[NBF*>~KRx%*2cxjGsdͻZRTX _@g|NF(u&a7ee9.5aZ͇$L>#+sjI׹vY! < 6ǞˑxO8Чv$Ģ0[I48 vU1ʫŭ Q 1Oy_5L,BXZX&#HmLtRm8jH-"mٲ&niӥЛ?]!%zĤyZFPH Uz8cjW1S˖T:)J Q)SdWϺsK"0Y=5M 0ק f -ce+1$JGz cC$`#]t[l?:O4";&dJ; t.7_2I)Ǫj4B:bb)F#UXOWU*X:jC1N!ab0u$(pX$:O3<G3'mE \;q o4A;p18,%*&* 2@ bHC:X4S.D)M5ؒ\&EL1F6s23P@E?sP4DKTf(%Ձ\):T][&b'fb&,dR5'HL (6fUe<c|hq#4uV TLXKRF9Rk2 θDm߬8TNO:i"OuQ 8xr9MQ/OmL.~ fHi*P!@*D^3Ir nuD$i1cJA<9Mph#ZEH %& R5/ "À!ACv! q"䂈EUh ']ֳlY9U/*Ȋ<¯H)V6F,2i2&/.2Q1cJG#$| yU>bz^$=&a\@T`7%5 GQ(_'AtEmƌPbu=X .$s0\f2u$kHE$AV(sr|Dfm:(]t5H\ː`CP;Dvti`lwKrYb('\!dKJҙ=gYAAwф[Ml7+=.x%M=E]#2HoEj|6)?7^J7.yA^&Ix+"Sd)y(jW"npj梵Bwa"  @;HϟAɩ|g5[N~ rդ\$հ<ȓTcv9O[A_S%],*J}lV"\5琤@0_FUUOIZ,X12N5jQOvd~b3Հb[]p% RhWVTR=ޝ(d.; )Zb+bZC2r$hU2$Y615vD ӡQdtREo)г+ :г;#kω'r, p<:,`Țը. ;z T7` *< OܺükD;.Q 9X-* ⠃#@E#!<:0~ $:6ФU@(@f{mREz0k̛. @rK QL;2a@ѩkUi³Ty< p] բys\%3KyNl h;Λx: zͷS3MM ̫k J2 x#ЭJg#x!|#DGoL/Udp:!4|-") $q龝q(6.  ~lRkꜘ6nBbI(ȼl *Psŋ䥿 bA+ΛXQ E9 {/QPX"Kٰ b*Iՠ$++~86~`\J!L~؍"JMR;.l2E:7lajPɡK+"(i$lLgW*3 UKRO:dL8T];MG?DРõ<;jLQl *OƑ4᪲[㨀:)?LV$S rN.i7Dkz7Q1Zjw8Z!rD;˩r"82[逾2PR 1kQUPsPX6(ڥD?I< nKT5.qة0Ѧλ¼6lɦ& 0¬( uKu5ʊ*i٬cWqӑj!:S҈@9"J=DG9)"k7SZ?5;@;BقStzP 1aLȝ;Gp:ĺȺ|% Q ֹ[Z ȽibĀd${b̔Z߫P̲T6r`( )~;E Z h񋡨{%{u|#S@ ?hvk*J㡯P?$2oAy-c\jR2 @Qp5ҭ]jSMƓ0Q.2(R#ؽfLV$mۻbL9oMH8>c3=46m/ dBlS>Ϲ􏘐!! Tc)a+W!;f9/1=\EL;?`ü+Vk2hӃXd8P e^C 8KN %+{dSѮȽEMpvEE䂲uI 񫋭J ! #i`2iHB~(02-Hظvv#臩Ā}~0g40#S4 kھN$xO%fw؏ZG\0YNʏ BMiXz7C\=FT, Ņ~[L$Uj68* PUj{m w sP"v=R6T2)aշA]n 'bI%^ (b ~xg/kk#RL!~J*֧gl̾vΔ!% d ]L2[F"S^K)h6\ `0#"A6ܪU޶ P҄uCM˼-Ȍ2=֨L,7D%ˈp|Ӕ9 Kc˱NDfc{*Zdhۺdpd(F#B=.= -=:0#khi HLs%r|>r`YLxǰzǽ97[4TRّrzYlh[%Z)5<FRa`6){XY:<*y@,o?Csn‚~ky;fˑvZOr }0c-^ 1muu-V=so7WZeuP¼M+\8+,(uG7%V[-VEP5n"ZqO|D@y$Yhh &o'ibe//#ێ@A`{]qa_GX$q̮&m`6iR:AS{BVO aqoVrIe^y'&;Ŧ$+(tQzKʇmD ݻ0^~ B?"~/d{ێvMU Vew |hxqz!* ih"0Ybs$*|y}d5  2v5\bX1!7ucilָۖ'C$\J4pc:UnO~aGX`%be`Q gKj=~2rEDCxx0PXLTQE UPQj!+&DmSaAxRzX uITS%T2ID7bILm?Fj- X|^LLb0$!!NFDP{.V9PbXhT G"VXM(׭4RFQ4A%%^bShEi\hetr0SNn $E9Th1`iXfjxyQDc5TM8ُ;E@4@LFӗi-rQ*Se$AZKr|^HF%TnLjYi+g&p}6 hxqθ`onI^gC `(g$%a2bvj> yi&n<,lEL!EYNj9F^< 4kI1afar|e0VYe" WSKif(B13.Ove"N mS^ >aA$H NyԲڮ\wi&e=$NA(Y j>);q#{ў)臠~*Cߋf88NdDE'DZP󶞚"AMxQSM^MMITy)Z%KD\aZ:~$t{y:%BjjG*1YFE8u9r4>hSH4+HQ)Q Z D1ip |<`#`Œ*Mܑ^W+5WTԋ :-$M"2` ]I`K^VޅL.c9Z\2+ӈnRR'9:ukrW7xHH=dIQb\L@ZVϤm:vՍ}BU2B@EչK}j^"i2{q!SXX+qH{wR5p6e?ɖ8B\hC`,:6W,HtnqtD%̤43w탤z$~¯iM&㐛 Ris}S@ UDxJ>q i*|}/ULA5{A|ģLaG( br FO )0Qq*ŒY7 YE(, +U YXFDѴLVHYG)4wu~;:T'X]H#fHn.+ ()Fuށ0s+kd|NWI;ɂJBE:Q'iЕI1'D ݲ袐A:P{ٯew0h9x4l?yA3d.YCUכ0)+X^Ns"dc]_+.'(=5 j4Ϩ_\|"%n;Ɖ3{q~I5A&6է|dXK HmWLHAPYŻȅ)-[nLW@CX?EI@el\19AR0dO.TL!mXGWYG(RDr IhZAMM`X~-J]*(aTar!bJ]Rpj}t_9KZeDB{ E2b 9Y72 %_% / D)a+~ ]PIKVPQiFKmyП'CDfAMg#0VC( K #`_a Z$!iHN_ldJ_p,MsM.Y5l CFNFTl%DTLmHb͂trqhi]` 6cr"QQWqUOp]_<ʒ@J'G։ʒX*lv(m!r@Sa"]bRDF&naYt2fСd;xDTG8)ޛ1^86⏀_枊^ff]I9ɨlLfPV QeFdƎ gVQ{i9'\dVf cEdX ꘴&E XPJA e %Uؘ>҆xCQ Aםk S-1d %xJV\( J -el!%Ca e{5)4 a崆Gr I مDUDSVXئdljQFpGULlj)CQATSM6]*b)&&$ \H&Vi:k'Z%.]@LFP8v$ O1M+N's 3=LVe섕.%$殺QH*$1 H"S:YdŚio1IM9qXhԯ BʔdWqlxIƑ~EWĢen>ܺEFhAe*RZvKJ$fc-Y+KFTCbɑF훊M#ͩV[R]8" zŅXL @K` H|QbeZqv"$fNCM^YP/qj- H7E[HV\׸8R 4U|PN*Zjn+Ř]8l< b+*/o|6$RчĈSTjHBГ鎄Ʃ`1Ond3+ptPYLd iaiwlo 7&aB)y%Ώgȍ2wǂa,DbPscLgmX& Ƚ6mhyyt6~E]) 8zTyϲ錐SMS~0'[duxG8YV-j,ti.e*962gÙ 0p/hλHUp~eF: 4OUs_%Ag7eo/HJ:9TF7yu$%8)Jqۄw?Z[_,Ɓki]H37ƙ;7~OS#$'>j52"o;ۼ3G<7S[s$ .tim_KA8u4X;r^7 GMpB_ELjKO. ,$Χwxi?ǯy qh$fTk  7?cVV(3V(J@$AT &Dx#"a fԸ#‹R1&RXjE2l&0 gO?>ĢM\B=Q3#GLL OR A*l訣_HJWά` qh]w{7R{,ȑDHE0.媕;6Xr)SFwd-uۀvӯRKN8tt wՎY"& 6ħ+6h<'uG96펇UY0GULwM;Ƈ?_~|}O"=(-v;.(BɠuKڨD6tNA*9ATca@|n;UpqrOhQF'>>GP&cpƅZB̠ ꩪj+$o#|Rl2)<5v#2*MR|hPUjjܑB"T1uފ3">C* VsrP !ڈjA Up+dM0i SV/j1ۄ$ u˘4Nqr I7m0}6y- P*J"9%rKDxJލ`Xx՜(LjGzFZN>FFYNjKNKA{CCHjvC n(/1NXbƪLUbku:L"\r"7za$Yf.F,j2 95u8+Q?UkT  .Hpc - QRGYoIQ˴ɪ3 B=!]n;2UqR)!"V0ʈ:½rp\Ǿ i/jE |ʄ{.K{VE4vgOw)(zIs:Щ@MD.3 LNslf1aa\Մax 7Xv2PSGJYTgz1F aq.jsRItv ?&:MU!,fCB/Q~-"JD5q1K#ִa JXZ$E#jzrbU)9{[ E=SIED'iq̑&%",=]-qQd=#P_:TDz uzWpiE]0Gzh⥏aatcԗ'$!PaXญԎ! F6[N^yܱ\reգ_8$3F7e2=퉾PkYR*W0_`)\*Y )| "Uꂐ @߁[v#XiDDjЃ,`EF"ĢY q*hEI!D2-ȇ-ҩmÂ1(4aw LF:$5rSx/ŅH~RD=I=jRdWѩ9rscqџZl$UOQfH8HGCkQg"LDvb'5y<4-^ ӟo-f5TJGT [jcOEY}P DuԆwl{dI$2bg+pAU݆^sw JN`W&JRɡި4J jXKn_pq}}{\j \O޶;9wBrc 3pKc8.*,$ cn桾 '1c(nTK],]DoF00htN&>C`tu êlh:C B` !!D ΃>)PnNzP(`*Kp%sfbhc Kol -0mD3ƨtV%IC4,?DzA6(,fۈ溊êBI"B'%0 pIY-)+"$:podh„~&sz N|' B*p NA NaHW"E! ZK,fQM5')^3@ ,]&<Ѓ~~R"ȏ33&>&D&qB.0G-g\M~eUFf'B$ prtaZJP'*"*./΅G1T]"e?g\DJ*F Nbqa@l'WDȶļ&.eK.άѶ!,oe mrkD *AA!VEH\ȃ͎)׊a@$D rɬ/*bd@1if.j \(D8ia LG&uK-2i"ƒMFr.i(z ('""EahuzGúRQ 9I-SL(BTaI325(<b <Rr>*X1P#l?#lHؾg6".>J,0&*H+BEN8sLE8mDxc%YHkCb[%pHoq=rfH1mԃb E(bId<ƶ{H:} ntL/qM!/*/j4j8mjNoh ;pF8RF*<<4!vn+5* .>` UX^dukV\3*C9o&):-W:b d۔9-cm[|c.n !Q>UڮU[a3' ."SG>twP$i06)4"1B&V$*玎AzQa_wLfDV3arFñ4'vT p.-dΈ2J+ o9t5FD n9B"7th 3Mtj5M,McOD1ưshccv2FkF}Ʈ,f1Q(J#LSn8#~$|7Ku 5C p=oBHM[GUv6ā:}#WsitsCH.sb"B14Xe)$6wm >w7>s!"g?ˇ@v"@4d73(")P1b$1NNjD7R$-V:Xd9 =>ZjZE"/#_F+Adfdw0QGP"!~$shfu mbyc$f",ff_ІiGM4jkxqis8-{C1Tl7MO%Pn/v]-ƆҎlQ+fpDuVv,GxNX"Syk#h\ [wGO 7,jZ@z\!o3-\UI^UsQ(PctuKwf窋fﳖ7|tN"IM8f&ҭm5x[xU]9 &] T#۵䞷0bIɑd?QzHȤ"|?7JbDIηF[7s 耫A,ceVLˡ4gsGNV1xf9m9*$NƦ*9 מH=58< :Ό81salM#{[&{'M؍Hmԇȶƍ5$8Ini|&/LVTO@FT{'Q-bwpZnAup8x.957 [{1[W0'r+/#I^5P4,:]S7'/ 'SCA[;{D[:ZjneO׭'|+And@,~&[dKUy'ƺXƹrIrHtICԆ ߙ6i8ԙ,j5Rd@J6s'Wtc!m:ƨe:n/qkL%I}>c%}QE>0 ! xs\RZ587|srl ?e:zeuN’6WU+3t#+Q$f8Ƀsxہw(bRᯯ"}dotuAۢS[fICC~_x,V52$[A*>(8G=0{ZeeW!w7 gW4{vKh2}IF{ӃE}*yi{9\:gIdH+>;ځ=qb>bLx1Tyo5X=x8}w=CtP=TFɑAI.,0zA5Wv[Օw?}jM\aO)] ;#jآ߄90-KQ=Ti|bmajMƿS;5DiϭvoH( _U$H" Q v,Çk9qbF%2"a%)\h)[se)cڜΜ< ghb *,LAONU k-)c-:6lecj;K6խAT޽z7(q1⅊H ynɔ+[\ 7sBy ,ߢC+|=wiZw) m[dA T_mlNP>PbDLiZLWr)KBXueguyiDQGR]G5IC~0tfe4id^:Ӥ3% aR5CT iVzjUvVX`'HkI\d v ai}_MڎuaY6dͶlFBJ]E_lV$.)({[>8\KK뜗\UePlVtc'Z.nv<REeƍכ~5;S./-3+!Ա8dH3Be]8WxsTLՆWY!+ .hURIuPhcjUXa b[uf*0GNkڦ?iZOuߔR-Lv0tSQf,AHD@)58E+o>Q(Ĩn uGz3) ˵f>,˦Nꩪ:$V-E]%5 X9&`Iok]fNe?e[mo%idèr\EK-[֋ [Ð%6q! J!g(e9|02GMt_>/]#$ :q?HfDwn(!0hZ"c (֚ҋfD$R.V+['l Zڒ$(:kZ@nؒMܕ)L)+Eb2?( IzQ}\r@bN[iP@U,P"QK:|&LԨ)L]h]L0 @'e);߱j_aeQ K#)›[0* 4oA1 1'Y˲7 |дC!D?ш+&fz6꼠r 5v┢qγ/!6[ry @7GoL NrM` "~%8 m([ ovdM}ӱ;<5n*Em+ g%ՙGg7w)Ow 'iqMѽlw-k☜ 6*[2Q[%`(G1omyJWk9 7Et ;eN9AQ^lo¦DHlK@|P/,Z>j5LhKWQjo)o$w{2nz::I]n}u}ݸHҸk\֓i3/{o$ 8&(MVPvwA=&J)Gέ;0a'[<<6u_{ڌ$Q &he7vtO7׫KNd^dkNl35ꤒ!#eFZ2i~wg|̪ˌ#a:{~32ino]fэ>ҕNT1ttiT  2>ck-3?8/Vj4je `@CQ'!FkQ/>k/(?AiE6R.Q fQeR5dR-5R/CImfcy 6ͣ`nX#BbZoVo8zEF}o$Q{bB${GRupp_ '{GJ hK (Gee'rUFӗQDq Ts%s;7Z<3[t$q1MX0qL׊Ii{>?2ZWu fckN%iW]x"tZ(#/(?w~Ǎ BM/Dy ТHy;٣ 3BW(nh'rZa'b`8GL%f{b=U2M82Rw|HdU7YWqyFxCU@))P"01;JYh~l~d. Dg4hg"X"u?%T"ҡRǀQ)1"1 `N~cUw1vjk1>x%iR@k4lnX7cY>`NB(/#N31t&y=RCvzX^(.(FgzRdaPo;1XfHm1ukG i`Ɖg GvR ћg)Wp@}$  }v(O7~7TٓYfOQ,@Z,FgXMV[6XwUvn@ r@8p0j(ڈkc8mij*pX!1ƂBE淚PIa'y掚!!RG`O(fzG$CDVKꚱُ礥'Wb9:[2uޗ"i?|{ybեy Gs,b 4^j(9yǓd3@攐ԔzpI џAS o6w2mi_z^r9vA:j ՗H/2e887iy!QF'kat[m3 M#՚=6IwfךHe,JŤSEIy|UJdv@d!I9:BuxY<9ħ7 (YoVfI)gJ fJS[=Ts82MghtXtK5Sxb "С5hQd1u':jaA+%ViB 1RqeI{xbOy9jírnzW^Lڷhnz<{:'|,<Ɇ!#+62h+g3}9oGq[-y}{)Yb,GD nCr3D$)Jw‰*TgByg/,d6KADW bRq*/*X€ն"Y2kVd)ew"%rv0+1NRIlʚd#B" u@\wcll٨N X`Bj)ms{ ,uR(2z]Èۤ MIK\Z6r*wSF+2T! Ƭkb k(V W:UM\ V f͞OXNjwf="k5-3 ]gcA]+XС!d3XB45Վ#1 ̬JlPQ} * Ać2vk qN?5q̙;@jC6(]-v-^\ n#{RGɇH7gz./WZ~C%whXYl&W919yI/hu#Jwc}!O[eUv,Ŵh:vLZ [-DdoHiL۶cƮ;Wզqɑ/WΒХ'ȼs׵SO`qٹN(6Z4P=-Mu{ h`e߂>o)A X AF GJ>G [\qB3aE3 Aj ƈǴjI$b&r\ ˓3K2Ozɤ6TL6+Z6C9(;}r3x3N&W6xk*kHrI`+ -,:=SVc 30{̲ ȼőJJbG環RS5W^q_wͬ34mpԚ)ZRr;7lBZm [Ђlҍn]ue]u'=|(0]8fAu,`q| =2! @ܺAwJ+rDJSPU_T>yt7{-ӖZpѳaڊh"3J*vZp(̐#PZ_ [osήIПީDjYM)D $p-܄U!C9HTMmh-Jp$P̓Ns+noӭigogˑv5c+MDV"@U['S2UL|SjWk~HlU,CykhLq>BFM(ݥDDѹE˼F+C"ؔHj㷔.vEKڔ_Z:8\K*)QrTۅ4 좹6+ZLgU٘ԦʱX*nb'qcK uQqv1Zh_%#6QeuGn.B5U@mlR!,Qy7 sKN"p 78D9֕.X6!բj NnI2>j0ח\4oviʩH[%v5L:-KBuR}IgUili+V Jf/[Js`nr<hp&gLTFJNo!> ZhbP[y4;- 4oposKo(CvMЄnMbޟs iA[FbŒX^-RG?ӟΝcz!.sl+LX|Λu  O*;Y{_s3Cq>k Ȱ ЃI- {y~;}Z&0'&,T> $!'7xҒ{pgR;.'.)/֨hC6;/f; ŀ)/91 ##{ ųB((ER WX Q`;1p@ $q+Yx,JC\^E ;ӑ" +jF#R7-3@3rL :s( ;+9C@.w̽d%<#ɋR;[x4C9ZI$0J# |Xh3P65ג>*,+G@Ű*9^CPO<QbSc=IRɠlЈ'$%| DO[|hL =J3S&EAqzlSˆc:uˇ[k' ˻8KABB%P̳C=AiB*I.c"WT24a*ưL7$ȜѝCG!>A3+sQJHC jȲD6A! ` ;MTjGҴ[V%t|&HmRlf+gF0 Dѐ!p 1E+3ϣ A)Sܨ=Gy[*zwۗr P=#uS,PxP :-,4;ɷ" ,Qp4僋<⇯U4 ̏tՓJ:m[#̊+` >  e5N"6DNk '>VjSg,Ya0apc~k @JgLTl , A+ XLˀ]E9; !BK%T'8\CDZ=\*%.%BE5]m c b q"1 E ;Dt#K,A+\I(:a=KD絖E͖إ]V}qN ]br#SᏸMR-{m GL]aL 0D~h)K܍4c;~%\{q=zT}GՊ͓x\R\+|4L>%ihp؅ 0)EMu!֠e;! b^!I%vZ&1[ _*6PX&~uLX7ޝHF)+b$=Ȧ9=SU-\=\9=U;-d}GPd8M[ &GH!(rYY h) ZSϢBM='廊EUQyJJ`dՊ-fMVM浻+gxzi_k0r `"*KP$|\@S~ԫG*~2#l$3sOu$Q1њL?(LZ bIdX*EaEEɾpHYC6:09I1!E".b|FbeV[Ejk^*dt/9dP E]9]I=H>Tn*7V4 t] 9H:H<)HrGAcJ3fM65U:afjF:kԦp $|3 "`^n跌D)؈nb``~h0yh6:pХ2k֖;1pe)eM)֮W 4_6pWEGf<6Ҫfjkhz >RsqQ]8eXt )#Kzbxk(k>Q<4_j4%T;Nd^r?D2&Z*X3oc,ectỦV5G,FiV{fd\G2udX'9?7ГQYJPX=c1*Y)֚5ZW1XyY fJI[ifWI͒lufWOj>klyZLN;? y7&*2-> rGPS2'sv0gVsG܈ GǗ9\>sgd/l=ء˥CCx(Bb͖6)+tW/CRgQ礽,(|"i:LF;7_)6X^|ɖ/@e_!gN- *&CdvƄQFOhzv'n6&`~NP,|Bh#p 6 ::pBh!\D,֚(a'~ ȍ#?2L F,ąL)+%vM;w3Q墕vt)B-1*ժV"BSU^ QTfˢ=6-۵j]H֩ƶ]ڍܽ~W$a)bAXjaG.uLI6L20˝6d)QQp$Iua:e߶m޼#ʛw#?.?79֙c_|];s>)CnX|۩t1WAEUڅK_QC=5g Y&A u'%dQUPaԚEd„2VbB(]hRBTėPThE9dM$oUS9tC~Ke!Ke8eDZF9[yŞZbi_"X@DT旝iWe&҃U'[ѩeiEępWWlj8ʆc-4) PEtҁDsz4jt *XJZ뫭G#{f홥,TvR)eRI[(NЉ,X&pe#OY"sr;e-VX~2x@V5^䮻AE+µJA7PRdx>mXY>D*W90hyւc;L{ɬf^K~z$#+/=klgVwrY#u^}>zBjbS[q%O+9]?Il∑rud-% 3,ѮUI7aP"`zr2ٰ26T8@ s"C /~V{X&>D]]eɥ-cK$FL IN61UlbF1U }2@y,iVV 0s[B5Q /r4,-jZ 3?LRH!Oe4'9$eC #+f+MYжke 6SAhCTyAQppx`$е̓+0F5B! B܏ծ.0$^cTjĕZe9;'Hӊg"D^nUu:O a㌞7*T(>Dect6HddT]FDE^>d1!wTfiGbpXO X+w">CbfSfdR-1aՅF=* ۅPsG aTiF4ւ<` b;+╞^E^*U#SIj<. zwSNPösO5JI,Q,_03a6b 3aDd"8zKENtzA& QmgYwp lh5) k^)L \oqyLa\h8zb̐02N^l:J2L5eM5[UdYo|"%z>0B^ټoQy\",Fk$ލ*m6\VYaPpŻKЙ]{Q.o-OG_nv#s4@gʶ1!*kdO'dI_73u|g'&$cZ֢bl'3FN͐pk픩 .D =ҡֆItA*̀3Wb72爬$#"0y.o\1ČY RlphMkRZPs(H̛XϙQ O}9졠Od!ܣnLCD-K`T[_WCMnQ q= RRQE%ˉ,b eaε_ .X[T]9mSĥEFDVS=M?a`m^Ӣ^Y 聟0%X&Ff%JWI=),ŰNYT P)u@ui1K' KF|K0A@p_t(.R,t!PcF܍TBX[[:;..ܙʕ(SrM\JmXa`Rƕ@f` "$ J`M Oh HMQC(!Ǎ? WK**4)Є0JdeŐhFGj0Β> DrO"%ݵYcak4\<)\[AF LU@UV bQ!rN%!5ͭem`Bn"_qM"!j謁 4LN D*DvWȵ1# H៵Q!08%Q%FV7x)h_HA<!;]ʫʅP@qe?%=6'9e^u B% j vyhb=Ew&yoa\NGɄ/d0ԋ']DZ\@POʹ F=uifRW>&EdQAhFWmfTFeY8m(`@( C|^Y >L`(e$B#[ )))DeMuRN:W]xfg}e\Z\)balL0@km4PuM,Zf,.WH҂xfnzh16ҘkaR#P7r]&n& #&^oWYhGaAC^@@d)dvvu.eIpP^诚gwBE'֋4L>@5BYg֢\ %jRDeIw^iFǁY%JeRVnʩF'šal4ŧ!ApVߏYZYఢ~&O_͒bi-b  !E$ T-T)PzŢ KȐ}&ߔD#Xd jǁJ!UtV$h.eL¦n*T\pmGl8DG= ƌ!ۆ*->NFTH-rYkIVmY>k]('Dhvk,ժkV8-^ჾnpSpꊻ#aΫm(>Q0kR 5ot2,\ZN)flr(VbT)>l$`zUQ{n([_/Y튑l"0ĂL\NE:mncXLV.mbF&g_5ْ ,Q ^ K`촰9nN w$1kaաzp[E-hњ VN;}^h]yKZLFRnRN mbfPfif++ЄPV!I0j*bl"Flr&K,'0#Y)[Ԛ'`R,^2f["No.5*HKu۝0w1.r.oisfz1Z︚3r^qtw34q{4IVC® .3]jN` j0 KIll@0 6.vʓr0Vb.r.J,e}3=.b  Jװn֡4kV^ q(8GjɄsLGns^L+أ\0٪Z͵;jr'sV{e(0XW*ɲ*#t`2i+'1H#Esӽ]P%_s_HͮM4:1OA^39"#6煐}zqR2]ֆSc3:0 1Q"rBrU4JVn{n"q䞬X*C-1ٳ]|]9kf kvW"_^JK3O.|M(%7_ tOOfd.o7Rb "GQ3ʯzwuh}OZp1YF">2Äפ`֘fmLH8R8h+v.JhMr6Izpe+.#fg0Is*p~tĶXmyw[n܅5;.74e?(\MNcUw)bhN K#PUֺEmvKxsFP{e79uWjxG],39K)sTy\7g2{5]x41 V+o-%0mKryE͒.]sG|HJo;ig6ys {g5Npki9w3@t ج HC^H0+q"9qJK5 !K0]U%˸ Q&v+fk/!ߩ_k6gN7Wl{w6/g |w?eA`I!?AX،muw5w)'WC7i[}]1'u?"w[{1{dK9;/94=k[mfp6oh{~|{]փZ֣~HreQM9`+#\o6b%uи>UD68(A 6T  Rtؐ`F5Zxq"HG$#I"Qtpeʍ2-jYRM;2!Ϡ@E9"*(Q=ϥI:골Ub-թ֯\Ɏ5+mXYM(\k+Z taP ޻60B 6|_Ŏa_z׭BƑv3ϊMo΂)vaY :g׊;;7^qə/wsi^<{K Bh!L5LJq{z7շ?zGGsh~W^'jJ~? =+h.j32%XS E0UPʹS1ɰ@#qWĐ$ m!Ɍ=jq7~D;H%'̻(;P,g*IK3'|]ڥzo+  \U]\ )n9W݇iQxrV׵p.60͜@=9MYlb]vܺI-z >i{F$k ւ:'la5+ {B]"cM)a ܈ؗE쉡\*i@7$[b7E\ Hqle99DE;Z•:bjuq~ú=Ҟ1K {vcϜH@6g^~ Ii_aAY^N8]9 ı7Yh"FŲ p{u,JLy$@rpl]'{ d^n󄆼|rF2ةi\! skgŤ"e*>aFt(DAl Ҋ=mnEh}$Em["7PɆL)CI7`j#FTe$:6t, Km<#uhDFM%gI?1iVNus(d^1S˲΁Mz4Bk(sq'>B(^*'˪X'CHhC\J׎x)2"&cdĔCΆq;TSբ36<.{nRuU V) ³;ZŠVq*ɟ|R̶GY QS/Q*o(эj,Fqu(:[KMuTm#KN*{0yjQ&+mHHC.JΉkW-YpU ͖K]i'񍍻Vmw}`7׶>zp-xhhƲS}3h ϴHV}6sf{f;hӨS⋶p[斶L44;č{ghckuN3rA5tE=ݭ>H2|O09&Jb[{0E٤GlQqޑhA--MF41㸍F)&_qtr9,,}<<:gj݌otbuuM o<% foĝ\'KSx#1műLn۬K4g}bL"YoffWs^w_WIN&%F#Iym3Lu8Z==ϯ5{>Nq^wyw _xWx?)_y_9yI_zӟWYz׿i_{y{p7?|/_qwۡO7}ϻO3?Wٟ#7=~>}OO/$ /O/ 1G0joܯKU/OpVa0 ~P; &o P_p0 =d pP C  %0 qq0 P P {/װ 90 pq 3Uqհa Ce/Q oqv0/c}p M ۏ Oq qy>n9}ű/q R  !!!,@ " ##$#+#?%:2(D$F$G$G-HDHGHHHQGKG??-->))F''M$$T$$T$$T$$T$$T#$T#$T#$T!$T$T"T#T!TT"T*T DT#GT#GT#GT#GT$GT$GT$GT$GTGGTGGTGGTGGTGGTGGTGGTGGTGCTG/TH%TI$TO$T[$TT&SK-NC6HDAGEOIGaPGkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHkTHlTImMJpDLs>Py7X1a/i.o-s,r/r5pAmPlTkTkTlTlTmTvTTTTTSSS{SsInHlMjLjQol^mm[mmWllUllUkkUkkUkkUkXUkJUlHUlHUoHU~FUCUwEncHUHOHHHGHGHFH:H.L3T?gDkElGlGlGlGlEuQpjlklklklllllvl~lylpsolllllloǸκӳ׫תתתתתתת׮H*TG eHCbȱ"NjC⑖ZdBQN+eP˕4M4QB G7 eGJ5:jPWhj4֔=RTkYYo)̰=zٰxZ%߾-: hzdQF + eK7B2&̵HQ푺`F Wmv9k؍5XμУK>]c,t1H [/r6E-6rQFbdOVK⍠3PAـ 'FV`Vh•9d_K`QC:qGrdNU(J؉5E(nԗe} `aDƓeph0Zp`f Z `f}qTNiFe9Y]|FJ]ȩibZiutR| uҙ"Gk xYf|Ƚ%S\%FoZ\em)TT:H"ZPS>[jxM4\G_*+=rLOdbYDEQf"ǘkw:Z+MZ`[Rj&]֊b27 >2Jц,q'R\hƣeVb}鑈8Q*'-ڦrf6XWK-iGz,ʦx."g\R1"P2,m;*]_A8N7ߕIu]eqSN(L[|g%!^[Yy\Vx}">g7CKd…*m9zqj)%k\DA2E>Km1YY^mۧA;mJ7}A![\p껮 &a€#xgY-MR8MawRfZGO[EZΓnf^JAg,2i@ \Nd";yf!H@ Ϥ&hLkzOF%vD@(tPT!Y 9Y8 m ylQ&#F9 dlDĤ9JXaW&sukqk楫>]Ԛ~ 2{cEl<@A:1X[QUH*@_.6d=֦~BLjCp$Ra 0de_xӃn-o= %ɉirJEiC2ej-/m[ok*ߥ&\nVյqOخl:oN\{7"ĺ'E 䁿0L`Nl5 BXj.\-HPU6CYSl7hNFΨhLt2ɱx(bjoe]t (k'nF2v/Xa~ Qgs-h-@nc}E&tqڒέWh͖zV¬kt՜,{hʼneaswԳ-:SzC*рX=2DϜzWjow۸ry~.uW|`Fq>@|W1~'yzMr.fR%{&wD 2s镧&d1NlZ$.&G7Qm<m-MEA!pk{EF_eCcr'7s'w7n`'_^&@fG~hkfX(,H:ttp+HgtK'>MwMd*\]uX'|`<|@LƒP+Gea;r#h {CRo1]"qO Ei՗5Q8F]R˗1t< c` [Յ x w PlE7f2VsZ2sVU,irGPp% CԡȈA7`Sx8Iɕi!MLw>ABy?4U("d`Uzc&wrgQs7)   8%dfB1(HpEqqA)FV#9QAA_5؍jwaW&r<0mCe3,VGC$fA?0H̑c0ap`@:HkZ:Ȓa2gNU;7;)(RK(%J&Q02P JY{9;=i!*Ķ]Vgh%(7-^EPC nH۩*p!1& PSlƇlJ3-K)@{cp0*UhSGnF:t6`2FZ3m2Bَ8QBQQaК3ٚp0=N!5Ehdccc& BJiER&Q_: i_CdTIaaDsr1 ((Upt/͑G{:pj0d*@K*ɐ",)1gm] ח4&7J, QI9585J\t8kOWYJMwe?o@@aB?!|P|Udb nN'RT~vwhq@B]wXD +jUstV]c0{ ZOvGcQ#dUR7ezPvc e@:DB!IoECp놊` G)CV,{F A@?byt @0=ymД頌ۑ#9r< ԑRkvHהvuR&&B{y}L^y`WSEcd0y{ }{@dS)fɣ@@s@P,/}*2Bd|R *&㫉ʉ$*]ƾ 2#&G L Ca8;֔{-VP1a"πLV\tRikWyn76:9@ PͪVKJN)t~ʻNZ\c#},,̴J6v@@MI Ȑq|ڞڀXR`n8' ?x I WSYJt0Y ht CMI'L% SsXL6 5Q,#̨ .|Y(O5hr)A,1F|s`ΪQڔ2#dQМ1hj9@m(M%Va JAȰa:ݡZUı›vnĴpKo8A[MLE٠ކ̦Ű-:"BQ,YfP#n&Jy M!u!/0c`0^/Ч$b0q \DŽ%,!>tأ@9rC=2QG=u4*GT> QpqMl4hyufRNM>4*TL:P"V\CHF886D#'\jM Ut(O߿P C#!)B 4 BB]n>$iY?{r%?ECznG@SLG iuϜ{^xӀ0ct ݇cǖ0T" Wt9K ɲ?.8䂉2i."DG҂{xFyQ%r:9*GaIlgl:餦J1S4KIH$M$JGR#Nɴ8JL@ɳ,@9*N312:<$b`ب[@J: 6,4 FÕ+[#O-P:$,$UW[m5X-JT:$;j-D/Y;/o 6Zzh$}SSK-ʺV$kK$E""]&Wt,ȨZj)KnX҂@[wcJjk/NK%DӍ&L:ܼ(D73-RFQs0$%̯Ũ]#Mظ R܂:B0;Fծ!ז</Ys/ٸZӲ\1%&I+,YTL 9D <sᥔXb$OW|FW\y=rV'jJɆsQcqWqD#4p="peLi&8%R(ͰCNR;]AG<5z3eR(C ]q.\8BWjUط( J R0 /Lo@@DA _x@TO_l%(H[1M\q 9.B<ԊVRC+ϸH1Ia\#v1)G+:aHXBØtZRJQ-kKX#>K%cKrA]c 5l1wDf"1I;=eER"GjAI/:p>|1ѾB @x9/yl"Py#J` R,i!!A^B4I\$QR*IT&N|.L**"eu%K)1!vSR>4#_%`M PF7G.vs ~r,F=| ̻t)ܠ8< Ql) gI^JԴ >.+'H>S-p}Z׀D ;%1 f|T1QcC95=JB) 9ME (7ۚ-lcȼCI%VhEwZ801}\jV<6 :ƴL_+" vW4u-@'%FC62Z(;$ Ťg!E(иZKJLW5Ίg=jGr\ni걪0O@SIy \V"fȒ(]}S! ΄K-'J ZŤ0#NRBd$T~X"RdI7[A@)X`r/z :v1)A!*'%.P4@rꔀN@I"TD,qr@u}- UqȬ"׻7Vj"vfEKkR6Wdtq=PuoH]ѝ5zΐ]ˎ`l-:w ]qXV$C3#AkQbȡ*=%&;]=+3$ҵdKrk=7xtl+gJ.\Z_;Z[/qނ^, IPFÚ)L3U>Y:ԡw&9. )ͳ;3|Nq)W+kt? A#2t0` @a:}@aBE)(J, ZJ@tP0S?$<#0Q0 aGָ֘Fl ŸI&d &A)Ð 9ȱ$,Iy$ɒ+Q JY-A;Bӌh )d*$+/"v* e@bXv4t$f@}`^G^ P 컵Ds,ػ:1c;D3ЙK,= B4pΌR 3`3% 0%95ZTB.B2Z|̾s`F!< dg;3k=Q+ɪ [F"x 7 #edCf(}vˠ,D0_$%A"j X5iG /lR~R4Ar .aɂjqǁHJuX󯫴0 [0(40+!};jBs2c/ "7+P =4:C {;ALd L: c .ѳ4(pj#"Xt2XC}ЇBfЇYxϹ\C^a7J8r5iAZTEOF=L,5 *ڤMRtI#1-?or/D Ѐ#b)3I(XG ͹J9* ƈ@tq?fԹM&s*;Ch℮S Qs())H1*K1q, 4(hk( b^a30FóJ1V rʸ,Rȷ-<% \-}&<=#\M5jj6I 8A.RBwU AB*+ܺ}ȱ@@@`2 @SD`TФ8үo)->߂M*`:Jfq9*%B =sGy a<,ݺ+ X 4W}/i; >b *vL ?bv4bX*I),MСɔKu= P a?-@,  3|]㫱0ӞEڱh*8MM[ٍ[-/[@ q< 0bG_0XEdD>dKiNf!rM*#۬ZM1yecQyQWM,JI#k^f݁Xը = D{mЄXJ!OP3ϑSUFȭ교ݕ=^Z]͇T;"F (= *Ux XCe Y`"^5dX8c|0}5e`h}h6>G|EŇXPDu[8P;W t0p Yc"KYӯ,]\ёQIS]RQXœQUk5~‹Q~}I*mBڳڔi ,a-ݬ~&KH .ٳlc;A`fpC%eHehB-6dAƇrK}OھeXhcaC>d^"jl fcN&WP;0…!"\RĕH,w+RXCv,B3‡#@5$Ԫ:ӎ# _e d㑈 tc)*UjAHAT% })3ĺt / sZl@Ia9{ %'pY.K&ۘiyAAQ'&@0& 4Xim0T$P. &T d7mHCC dL&i;؁X"mGke#5D;8iQ _>=4,Ү:C^^U LJ{YkAgAܜ&wM̲&5DYTƅgH6UFD.ms& BO!,-Ҹ陮c},Xs~_- *ܥs\f/-3.uc0T3@/џOӍ5ܢM<{ vy8<8C3(:LK7-6o6b3r2-$. J8XWuΜd?R( \GpN\85.Cs ww?3o U;<(zIA?g+4g#z͊17 DM2"꦳xxc="\H/!z(c`F  ܴQ qiYNkBK G$( j0?rI>`]ɤ˕p + BU9e0d9 JZ6gYc(BAqMj!ĂF%4)ε%lBi( \\ \c7UN߁Go-h^}uԦUvem1y/HYcy{1p`d&s+ BgF%o<6 0?O;d咀FPbڝs .FLуwVk fxAP^!`+(`K@(+œ!A^(7EWK&[MԈCI%nF!$j4%Qf\FA(Kx [tcX\%XOZ[Q}^(rB-HKU9%*>ȥEK+%RBE_a~҄m=vT:#TƑ BKC+FX+DP2+3 8rIì՞wSK>u>seXW*n5tKq>0Jۺ/vY`&ŨrapV[ XO:Z-\8[".ȃïZ|%gJ9Kl9 ~~3DZY -'m9bi٘Dq.s+)~'W=#W=QTO}8€C{A60PcWv!ͦ\ΚcZncCNT= ' $S:m?N%.YZ(BS:[FRy(eW_6UՕcbL;([3XHnI% tcD,K]Fƪ*p/)Aۭ~$~ TQY򐧎ԙeA!Ot:,lTa%%D{VS .]eOLe)Ѡ#Q8:EEhv*j鄌sXͥr+W*(75< S@2Uڸ4aKKŖ (ic؝%-ɵY59^]V%~"2DD-qudHFܰk&v\܅v̱*FEЍPE}Hy.&kAS$$:dUy9~9[ԖH$3DI`_ huS8d*.*QZn3QW08˽*1 3@|` EmǕ<%;Yҡ\re9JJpGpM:>T%"W6z)ס@OҁM rOϘU!JD͏l!&գM١, R ^NbհTFAXUӑdM&عaIfiIJc:kt*G)"ppZ}/#!L_mQJ\!j#l`gl-gDhg)ER2VռGxǖ\b0n'yZFxz>x$ =JIRqWJ<2MHOg`Z ITKuUifPNDpy(J=NZS dФ"TBrXLf"gfث=Sw(#GHkbkbHElijVI_h0Ilj.!`NMX]"` ДɟdSZCA=%-(UB\EN=CmNax-iL٭ M \OS#SVVoSH^-noxH u8d XÚ(VRd(-(ltyGtaO"l˗D:HLYNdHܓNPD4ɡCh_a]MIle.d(%*$'!XM9[P΄mjG޶n_,W4Vl)%U*B®oA@NSÅ-r fbPȞjġJ8`I#ᄛ`fGg:&nı2eH&Ԁv G$ܯFв }(N~qBF h ]tӎ4]BH2;*+/[-pZ E4 ߦ63e؉hiLT,<rHD "%IIb1+SQřPѺGd] N| a3RI0DkR”,*yF Th(Ԋr~^ V&O")@) ?AL]`/I-XB\3vΰ% @,!u"+Ɛa/AꂫdMLn(y`sR{IR č8]`L_9thFfktmtek|XSrwMLw1X5{ 2䵢8qŵ RiBrj9U`aK3ck9 mܰH23o6/o{hQ%by,r6em6G_{ A/D%:\ΰ,:q*!wYtuA`% y!yО/YEeU@~f* U* 83.B1/ 'v%5`JyNي^Y]3r9cpխl {FܘEt29mh/ϛsea8hLēR]ՈbUDe I:BЙR:lQle rLВ:^E\@|qJF>JHqc_K1~"Kw"LQH)rFy*qQL,`I׽錌+H]kag k>˸;A 2*+_9K㌫+?B&\.X8)وT ing/_N@p Rf6$}Um) ˕0aӄṳG- e\yQ@12ԩ"Ø8m Q.\Fi !1WhzDskW>]1DƮN5,ךo{p QYKޱQ&\u#kUqcpjyxujBTϝ29QrFU-+QWY-ݤB;ϖd߆xG'7<|nsn^sFG(^O'( >{_??@3~<.-"ˬ8ւH ʒ*)ÀŒ&TpXoWdFrjJ`|Qio_Is1#lI$|j*+C0RJ l"a2rC#Z̰vJS5q&5+ZΒNJGDpD< Fω~T=f> Y`mIXw\lD`MB(JDЗFq DCa4\f^k>Ab2kxXDJp\GJ'otA\E.:%S$NF5)\,NMB4I!eR$9UMYC+H*`1B:ChMETrCXCV `a1_9˛Ɖ>) iyؓ'-܇3,<x7 Q!= TTJaPu@!MLJFzСY1zc3MWvSy I D<'@g=$ FjрFI 3tE+nF}ġt<$8'>y+ y#yм!: CB$@{, h<ÐR#%Kcb%-̄T'\+Hp2n[(Tk\+?~|Dӑ2KR*nUi!En9\ zY>aMc$ϳ-nPb/#j; ̶1W햒琰p/|FaHf?hOP e4<HAyyD4e9+vEGէXeMWHSgsWqQR_DXFNY@BQ,* xݫn1I:e,(HSQ:rF5lت-\tќILHmnSA.F/ _+C+k 8V!hE縒HK!`X$-~Nj;'I tn[YN*^A]G< ϔKe#>UATIRܿe0C=Ni앵ټycJ+"<؞E<YJT8 F!K]4"~pA$s^GT?//F/8@PPšnK"ܥT BMf%٘#آ:Iy@`LZ2Hd_LJ`xcL:cyCW2hffȈXb m:`, &)Opɲ*5I"N n BlR1s *... sP$|DɴL'"?BRD$ȾG"$g&&/b53EkO.7sVQ.%&&p+hKŅ$ !c#ъHEY3^C!bwKhjWON4XoznIPPQL]J=cfWgWOR?Dá$M"/#;"oDJCR$U.GY/_QQ<6$]]`XRa} 'NDoD!|$j#[J&Wc4.\8%(2;̼qm:w֦oЪG21jl-κU-䌨I]~ QISb\TLqWH$V'g +#Pƈ# >g2Ech&1U,\cKUmum4jZrpr5q1P5qJ,2N#4;P<ƌ!zJvlB1BO{7|J$Dq:tl0EVbMt}C%fc77dHjJ@qEh ¬ڭ0Ē9_Lg4CP8NuR>+63i7oNvR66*7s4br<;O0׶mՈ!U%X-r,Iv-v{"DXJđƬfy,7_b5qM'E#7rԬ7BLh35fT a"鸘5 `[ONhM!>w=/0~}6Ρ.V700?NLcBE+4m`q{/4~%N*&VJ7b1y2 C:wy%lwKe怃*M\z,UG_˵f2g eIp3ym3@!qrlsp"ThⳮcGbW *.D=QAzCZB4χ"TڲO$'ic"4ܐ WȸpgNU[z(r 1:L"OwnG,0"mQ3$tebH)sg4I7"LĄY/BKmhM0Cu(i/F Un@ŕ y[;nJeer]3U ܴi."*)%cuvx5ri|ڼr"(sZX49)Ab|;[~--~aQJEQ;ݰIc1w7Z*E3(UR0E*H@A5ߪ)^Y`WWw#|u*[RDEm&8P}#H8@gƐy۵&Ffm.1fdu.G/H*46(_1 !B ;7w%;l[5MAI6$6h1Ӗ֕J̤scx+x::⻵ؐSb"X|5#2#0g$@ CFcE0tEwu]% jS)2<\)Q8<\lBypVFa̵_90:zu*Ž聈8b۶f] 'dB !B,(BB ᰇ 'Z NM'LGy%D AfbI]r)W\`hɓcjgf=DڜZpier&w]5ƬF5fQiQRR STf/%s&[lqBmO0oU/VPj aںt{pM4Xm]c"Şyx1lwߎET~K1wVpa <(yMH4"G|+IYB{]9?^m#|օim7ՈWJf^+k𞰑'z{jqlYfec.#GMRJLs%U+.Ud`ܦP5ЉQV*řScMʑnԋayD3ŅuK@ 4'<*01/5d}i'2TAPB$۹dn;`u vo_ԣBN[vGČ.Apdc!=LǓbMtBfa 2&C,HC<*be7 ˌ2!ٲ$G;q*G)ۄe:Bd1%No曓Kpi# gF7MN#\QeF'+D.H!I6JHZARYʂ@7M=I`\lRuGW,$ :$tDC^rD% b`Iz|$.:=iY^bH ͊%|z)&~ M775"z*Xys±ӑ@%EDFX$&H ՝!O6P"Z]F D?8#SgPM4,b4Z4g$r(ظԯ mp)G* Xv@ƽQGq`q~xpdcY# SSYҐKR3:+$5AG΋8OAr'5HYɊŕ jK2Ӵ`M^[iz]bHcV(0Cn9M^#׼ u8atϩ2&2hgnӁHxbP$ {u(D м~bߛɡޠ(D {Iɋ &xы  >BԊZ6-^qCȶWjr P7VqoE4<-6`);p4 h&+ ꭄg]䷸.z^crDu%+E$E3u,d\8IHᬁϼX2lVnE!mĞm h S- hĸnzӚsF9.MirRg< j&6ԚN<①Lci!2g⁚0z^ ^X:^8q:& C1:Y5`X%Qc*!_#uD0m#čddR5̫HCrU2ifʣ1:D*Uߑ#I*c`۟.Z}m: J;la_+dz@PIK'r!G.cjh rNϏ!Y)P/ʭTNN1[f\&?KO",YiԽ.Z >I`VJм|D rlޕHUx'm(lZc̤ک"Yg{ x#*4t"'vxGZV6"ĭ15Fݍߘ&bypMo~&4m**7%4a |fMbA,)&Qz貐z>qFBKݧE}LufƀW'-.?&v&$ijV!vy'j5!#q7w@F <3eEmk0^v``Br ){H<@q1z=RV0FC#1@7CC7eXT\TC%7 ofoA{&#F vfw8 :U=VҤ'qgEqE!gK!3=,UrxW!)X*7}4GL-"qd"4#H8fNJ%!=Gfx@ pLUtSNjM%1iv)4@/N/>ANq)m5CwWD&x'xٸk6R?xx^@CYF3Bk!m&P$@Iэ/r>$Da=NE2rCEqow|yHjFbbWgAq|鑅x95! A ed9PC9'}9CSVecaJGhwՊH}DtJI2*;%rvdp1 L"HC )[ـM'/uV\hFovq< RX@a@^1 $ۓ6?4P"2PPeg)38xS3zu0¤5d IaCI{a HwvˏKw"ts)^YNrx { ِ&]J{o:|uʺ FBI# ˆDFf4H<+:`;8br 5tUSy; 3vH/"t "gq33"۪ƾτLZMMfi*u7U/p9$(տezM%0ж!3=?$՚ @MRXk*PY8RmuCƚP0F/ʘ7n]RCH(z!ۆ]z' Tp?]%Wr79wjԞG}-RdMZ),::² D#ja},;:=9ń!AFi_0%Q Okɻت[.]Z?]R7Х->\:t(%1%C=j`)1Uh$K47"2`mqmAzކ %0ڽi[#+RziQl/ G iSY%k#ˋ*9Cp\C'KC H'# v|̫n6Ȁ\GIWػdo;BA;2+H"9[bY[ -8Q7>U4?ؿJYt2Cv 8w3_Z$7l*"H)SNlXR. 24S-\1PZmDee/T Pr:OI5YsEo-Uŕ-7ptd-a\!P]j}ᘋ؊5"Gp%n(쮋`{cH'˲ᷭRLC]8Ƣ$˓sX~RYW]>MB6s+2l;Lʂ1 iv]-jc k %F!v6F;%פi"R5iym-L"5A1ReΎ7{'m|pg)B c"7ʻ:g/ `Av rS^*}Q#q G(j> & 8 v& =nxuw? j޿v|em%T sl! a虔.9^V.r]èN5LZh 3{Pbرo._HsOWNmcɧϲ%ZAzJ+Y<ݷb쩾Z8'0p( ,BID+^,1'8mi„rCKZbP1pDŽgR0Wh%LI}ٔSQTfRZk׮!ۣYfӢYXbmKWn]yB_y\a1>•g:x僙qH^E9i3W)4a~]kܴa [냮d,$Uٷu+\sgL堜&-&.3cF>i40@@ LpA*#p%B(1 KJbD&zr1P*2%|&:#!A򈣂H-,$}rE&Ġ I i#,$T-Y,)8WFS̬ ED <̯RjϬnSvLOOBۄ*& :LT%PQJI+RI/4ӻ8pҹJKkS)PGX4A'uiaͧCOD#Mc@v4f;N9he77qV ZKZrc3r=7Zv;F%FL`r4%dZ7uڄaV2bd=2i٥ߛ|Z:a߇l=c^=X^/4@FKy16_cx};>̮44C7d]䶄bŪ,E&\َaeɠmQI`L(MIīISZFR q)Z#t #)4ZymqJZ'J/eP{VF eD0JQ<)+f"P=n/O2NU:U=|44e_UgZ\: x 0)lPǬыa)OM.?vN7'`S Q2&IMR9&K9@ W5qEMI &p<\+@ 0]{{0H]/$_y>hflTkƑef e1#f $],1e<* M&pBZڑxNt*ʒNfĵOybpDf(A QB<=:7z0}\II))_89+Ei-{#\Q?w\`XMPs-k9RB1uĥcKAu+=aFXu3M~znl~MW0 IDQiI4*KGZPbI;9<5,R$@ͻYv6-V 'p4@ J@x+"BΜi] )*ZwU[nw=ŝcLc_XPQm"6ႭГ,u>9Yfo%89C镴wKfUdS@W=AA,lceY6Pcv;Qwxh&~e(_l¸_Q95EF *2~p=91Ӽ4Axns&IoRTF+'2U/y=m$!nAn&WO~闁h{kN{m0wO[7r+^*q04P&鳶+q2s+7 d7>ě ,+ګ/@3TxP<32Z"3:{ؿ#?|C5a.u9,hC!HB9Eq9j94좞[D>c@` ɐ$8?L#Cģ?`0PK]:=kd 3x?[?cDcB; %2J ӱ @[7kr ]u8J((k (SF: j!j4 =#<&Fo(p3Bq$:Ii'08#zA" FGDcā +H i)lÃ[M#j/+{ܐQ?5ˣd _Q R5OLg'\r<* KKKa6%jZ,Ji@a97 2@_̦ ob-s˺r|fD؊÷kd̲<8qy˗97=K*8B+dL̙G209K1\LH2L3Ԣc򹷐>R+ 5,SᐁL{ H,DxM?]aM֔J d;[`C#G,NVk³d;㉶;t6;V6>N&$3@9N<[FcT qe,ad\K5c½t<my41@DI>=>FS\)˔lj3&@C-@\͋͡tMMI*NjIrQ$,#QQlAD ;c*I&566N*%,sE I-ʪsa=J\;s(L5tڣc,|r V˫2L̒LB9.+/TC C2T93CKU u/& JM//TzBpQͤ3DؤUKK] R8ї]< M7m#< KH%+ӎ4¨RSUʩ1 ޚJtp 2m=FeM|1.n ¥lcYs23[3\+Lؽ$BE`LJ"nj+4T$է))iHb-T1TK\pP*J9P]-Վ)&d)Imcax'? MlV dΜ^k">Hfao-hY,e>,NƊdI_qv٘P{ 0򷗸)uN86>dGj&uD%4E4 Gq  Yh]hTsZMvh%r,ˡ[.pR˙Zӎ 8:2!i+'UE.Ebc&,^v檄fC*ߟXp!\W(L޾8645{ 59\ǵcQv&뿬>Bkg}I-F~EdEFi̼PԅJIV'd flj=V*J {?1ݨ]hfU@YVapۙ\ʤ|_y>j<;1#oqŨyg8M;>|T{!G%Ì& ``k"6:Yr U62l hYh@kqhpq0]emӋmqmIf&綆TA`lf1EF2̦: *anaawYEΣ\-pƞYTZ\6sF(<^:(&BrChfd0EsK䏱4THv/PŞ8͆9h/dnspyAfXB?CDB'toyY̥c`ޚFlI]m"nEEH?!Z 8+<\*rD`_nqre Ǵnvf\n]CEW)-vCXno1LkGYJvh^lQhN/ٗ~[I3I}Lږ>,R/S@dfq-mrBUj-ewq+OQZu㨋:? h`t(p=mH*r@zoGAw171/{?{9d '6픽<_s=*Is~!x*|_SѐMt8wKe_^w6f'qž1_|#eNvu&zG.O-S45BWa&[jv.Pvnߨ-f#CAP u&C D dŞ9>)Q.Ou"!x}W|N b!p  8 ÆB '-,|q#G!z| rȒ$O,)d„RG']sΗ<)4(ѡ,Dz4)̦FҌC(\h(קF}*gJ!Lhn] *\Ujwݽq] ,80a ;QRLBv1J> Y3˞3H R>9u^Zx;l BHqۂܱo;9svڃ× vQBcb7\uލ^PA?Zs]u2j<»+RB+Ȗp:\"@׃ymQ}Tyu(yU`TP#TDY7WV2Ve$HAvUW1k^ 9ZZ`VKY?M#I+rZf޵ [U ^k`oV1BW}e{NV%YfThK}ƆpMZ&SpNm!=0*$*Q8J{egwG~8] H+]*CöJ V:VaӞi;P-XֹAMٕkqwٟ5D !٢F.ۮa}-Qeyp[:HMm []ܕPp.] ޲dNϧxzlA IP 4_ SYԩ0$ ՘UK==[WXtT{%F[`]W2\|%\pN U r`"^M⽐,yaY A~9\4DԚXUϵyK _NAK![bi0 #DN:1@&!,q܊*U#4[-ݒ$Ma_K ' 㿩<]`I\ cݗKYa a <JY ^!ue"/9a%]S%hɍ dL Y#L -!qSP\ !b%֜nهޏJ &cP2e0Uzн#ݩQ%YwT`BΗ,W @ b0^!VeI e[bNXh% EL"إ"*dE|aA,Gq%LM !$0z8~Ifah6]$ݳuH7GD:_bTݬa;U `җER,\> ta["( \r~ d6i"&J¦EFv."{i`$&bɍ]HI.t,R¬GHexl"az kR\b"+IP NnIKWp$(zhEeRF+Sf7NoqEq!K%׹f(I^3D~UL D*g(2o|M@ + Ld%frZy&,n-F)D/Rx!rQcJXfm1(ݴ Atmmrm&,_)k/mnVՁZ3/Sp{p܆$(z,L>bBIyʕp[s?.B~2*:#p.ZsqC@, Ԙ- /[,2]Jx6Ǯ66;եF> H$*\ GY53#W3PbV'1(+썧4r*k1l8Kl cFp-u^whX۔QJ2y3%X63J!t905gn`cNf6r4-V0ƑS_ܬYV>x/qAm%T*!WL̖լ~/͵jPYnQ2$GKk^P4Jְf/.G&\h])oP6t*zuv_vD+Yrڷ} $$3uvkKbY_&[&+vlog@߶*nWWw83b _^is!AYwʴ0Ѩ^o\upE Cmf` gvJOaf5w(6e_&uxw9%x%5ޒZBB^m->n1$-wϘ xՓK'"U/x.3綅s,YChr/Kr9995;`h~-[/0xKM1%'WSC󳡕V67w+coi7g_f/9{t a_hMup: 0q;!-;xv 6Wm Gڙ] Usqfiyr1tK[ 5q73tՕ'dթ̷wSO7Y}d w=򒺕Э3b'Oxh׺AƶgRث{j(K1ZaxAjG+NKn Y;dSsewwd'~(6C\{ 2!#=s$O8{“U«ē}˗Kp\-{)"]uF`PM*GĶ@K4G:j5Isd: E Y7;:;u*Vd=a8ެn]D=d$hp`B lxPaą ŌC਱#G^Xő!UPiKM$XӤ̛4yhN1% &P aӨPZ5UUvlXYʐd uJGћl]ukkޫ{wW-u*῅Kp>>3D 5O,gѡI6]iթY^xi˶]mݹВ[a3}qmK\9ɩCڹk +nƗ8g^?3%x6CLxq)9g.2zf݂Mj|93 hpF$ Ak."20 PNQF?R5|*RM.4UɌ*t,GsU^ |u-;S hevZTJjv`"p`JsՕd&N L[j)0 EW~0R#}ķ+-Q=kut%uwC.\pouՓkmR<&9⸽oŌZf k]0N'c>wE$UKҒ'X',!hK8^K #h4j04&5M5a u3]ͫeF6^ )(y bfCS@4& %nBM6r"GD9qj .Fq跠̊(ӌFэqQA :i1ݳbw;b{]Ͷ8eYrlxy‡qxO ŴJbHg^s3VI!lbZ@>37\ڥ4KRLPBɟ"‰쏙F;d4M3My5&-& LjIY4X5.!8©_KSŨL¶' fA5Pjc=h/'ڢWh20fEAKT%XEVZV٨SobD 8б\ 8:&55SjJMYY8A22g>:u!'$܊f]!+#73FK#ZYesm%mV|!,aȔ*Kcq{/[*zBât2zaMUE- 5:Hg>78˹qm]vJ=Ih@ M+n=n2kt"ЇE}= l RP/eUby(/MUZT[d+fv-ut]M?_HSZ̕zF8\Hv$jaNvsLUժ%j:L~d{ysxIrf5XLm^52ߘﯳ=9񻯊IH7x#eOY]-c*qc̄qUϸ+`b6CRZ;[t͚)tFp@y> }Nam!,3sʾi!ycC^RaʠreOJ1|D~bQ,7y/!mhxg=_;~.(J;H'$R"m"ĖS)L|a^viWvq^wyw _xWx?)_y_9yI_zӟWYz׿ۋ`?{^aׁO|ýON>׾ٷ='~>|~c|/ޏOr'0Jo+5/Oop6vA0^Pc̯hoP?p/DqpP#  0Qpe0 PgbP [/  0ð pQ5q Ő  A #EQ} oaqV0/C ]p - nOq qYNa ]i/qɰёQ !!,@TT"T#T#T##T#$T#$T#$T#$T#$T#$T#>T#GT#GT$GT$GT$GT$GT$GT*BK3;A<5C@1FD(OG$TH$TH$TQ$Tc%Tp&Tz+T~7TDTFUGUnGUlGUlGUjGTbFRHGTGGTGGTGGTGGTHITIJTHiTHkUHkUGkTGkTGkTGkTGkTGkT>]I      #"&#&#$#$$#$#$#$#$#1#C$H$J$J%I&I+M5QAXGSGLGIGHGHGHGGGGGFG9G%G$G$G$G$G$H$H%H1OGbQp\g#n*r+t,r;mPlTlTlTnTUVWZvZnZwm[om^ml[llUllUlkUkkUkkUiiXMMHHGHCH}C`Nk[AխLTץ<`e_ZP_!Di_EAV]5?]mlXbeYd4pђі rqFp9X!qךOӸ6}@Ҕab\g>1o,I?#F4')R:W?QzB"$qd;$J1%pC&PJ _p%P`_#XShϱ/!}Lז A}u+;_Ъ]WUI _qݚM4FzLA[*jfF/[hX#QJN 뗤J&%F?7.qEluY U`gT#O!D) rHzx<ezX%hEϡYW*A oQ}ZƦلEi U{}lSq >)MTvR5zH3A!mjR3<ख]k!HK0yu:&wHRu/,$okkBFRbi->}NPzn$ ɨB+Sy-S,kU͘H"LԠ>Wל&G̝ښĮj:]]w)tn# }:Zr>^9ƒD q{7;P$Lt&\7fm'hG)*Q mozfDBVKfvSMDJNs5L+*YQr[LNƶ4ɨujDnJ[j;%§Ƿ;VaˁMހ┾xJfH/r g=9ЦzzN&y>Lkb֫kw,I0fHcU}zF/P#PGܾ7ɰ{bNLt"I9?m({R6%\0e_H/HkbDIJQ¬IK*essF6p "B(ig`\G~\4L'//VNfLAkq@ 8(!Qea4gwt z@z%ٖr~"2}hrexm7uvȁhBfBkA1LRR @4R60f$7[p6 Pu p %ڧ}Wf =%R~6o3US8v&QJÄƆrkHO `emuVffIfcWvtx/cdpBt_qWtyAzyPC;xG$hOs!A:I+vPvB~![ZАk (Hۗ*ߗWMh'qI&K>iRg.V]hX넏 a0ZF@XT0Ё\DI pRwGCmC'ֶ^ږQ31|%VEqA!Qia",FxziSyn<v&z __Ē}Fȋ"}ߗ}"_9i׆hdXS5~.UpK+PHϱlYP^iY`YPPO(8F-9B-ʖd(WDXY(UTV>F*XBvdtc.'[ @T@)Yf~u2@-1p bJȅ&z%X*UjZ U(+H\UU3xEs@!Iq6rEGGQ:raw>8JeBH ꃐ BT B ().95 >txAx]zj%y1`i@˹%2J<l&"> q4a8tWZ1)$:"RvlcRFhG\J'Zy$\Q7rDQ>v}=؃3})zv[Ĥ3I _w`}R" |˰AUwSIuk"TTrGƹFxb l1Е.k\P\yY`ԩ@5PB$^?Q-Nn6D|by)BYYŮB`zBIjPđhgqЃ/'Yg >?}[ӷ{s`JR}e *_% }  1> A-ՅT rDTk6Zkc[{-0[bWP H&%Jtxx O " TP %nZotrZ48F~qhdx4!곌Y$H%ȔPD? iiT J%E{ ,̰BX}K1V* 8ɇ*É ݡ.@460%F[7#qwƣYZf%0WӑXU>ܲjT&ګCossyK5+)R6Nnf Kf(HX)}fC*/˰i [[5-ʾC>l @VQ%}щC 0 ?1x R]EqB\}IWP'[Ak8FAF̴Vpcr#uajlŽx( 8QPY#IA6ʤ-=a + 5YʴU"[GQ6r6 Œ"Pp  Y,}HM&;Ɨ{%~3F3} Q.૝]RJp_]]H˨})VW*[Bk5;7 I<hCˡls. 5A:_q:f'3 Y1!оcsXeJmJ/7! K,ikηsOR^ޗ Y6t{_\x,AKq%Lr*.8b.u^~3fo&0^͈@ 3v"/}`C-.R @["ѕ;Ib2"I"F%3U8 -ۿ/%8G՟_["(4oC yD`t!Qp u>탪o ~ QRL%\h(P .?^th<RaL.&yr!B"wDhIe&or@)B"Pˬ:KHʌʢ&*Y=I'i)!isI'`;QtQ\qoi HT] .pɬ*.*$:k,!ձX0vO#3:2nh@7ZI2@*ۢeo7.L3C pU7rvMRER\]t`:f@ AN'**!$uϳˠf(/+2NStBY[bbnHn[i C 2n(&@QiR?g'edDG/@k/]w>/Q'qi[C. AQo,1D!07xxCǘrU$ ^(%v]%O=%lB6'L4_hK%._;W*tgB; /dшE,2.dr1GD@FMиJ,hA25na4hȵ0B0. 1L~$9f)A Q >CrBDn Lj`Vsm whǼƖV8n~.}ZWDAHtv @*:R~8vOʠM!{h63(`d'-""5JR0 7DjPq[4®;P8IBf 0`A A3O-lb;vV&DXWG9Uwo!,@ #Pa=8ɭhN/g[DEh2W@9^8Y CV8{w!/KeiD_jhZxR\NN)-[AR Xz4RS𨥟y45 )X.hQۥ^s ݣ<إg/D93OlW:m(d!.p8K6;)+ ;5 ,@i?DCkjC#h؇jK@ "h1SQЯ.& ʨ# 9!b0/20<Ø0Q5A̋ ã.ԌRkND?AQa[XL8)|"KK,dBRd:9+8Rya y$BPH j?jЊ} L7{ИJL13ZY6958?@ J(b'@ DD a3JeDe͉"A:5ŦyL<3( ISO0.o83Q%tj0۸bp.1;!?hx̢; )^Z4ۨ b}B8}؂}~^"ꄃD"茡F â,@%3^KȄ"<'iI LÓ!="Ûηt9++4NђU@.LCQ7N0 :2<[rJ^h"D cq01IeC#x$*&LZY1 3Ĉ,,m F|ق+TCσp#A<%{Ӛi>;0H(;i$بJjTz5)&V:91V)ԍBVBD˻"V틏iJO)4gb1HHy4ÔBQk#M{$?w70EVmh<賃 ,ڍ\LhfyȐS@IulDyKd?[/ȄFz*q27?K#h&j5M.8 9JSr3!359 x09xI%:8؇x[tlFIy\hܦ:܂^8":׉$4DDZPr0H>`1: .J7bVe,9bט%5Yuj!)zT =Sp 䒮qڕ8#W3]M =E-0` @ @;#P"mڊTG: vVfJ'Ĩ7)QAbe"{CiIH[AQ"j*bCm3DbӍ;09ccQVȤu ٴ˱%I*]: a믓[@~77)8j`#^] `} | jd#} -eKC}Ї I3՛z3ED$Qkr4ܛC'x(F,ef` QplUP /0X戌3;Kzݽ)NtC6c 9tr"bg\y~u+$ ũX=(M6+84">  6:djJ-jÿ+}LjjNeJ,ܒH*,*A&TQr60/jH#KFِ͈k&7H΋u ے+y(ٚi/.~!l4%e\1Ӊ +]/@@97b/hP鰢^0 PCK?n;/ևEdKЇ{PkYG [p iG(T3Af,~ROyU{_J4mF@A*"bLAy,䤋ˣ^ȇF0Ў`C]HeKsඕ鰯1ES@99֥!]vsi-"ٌ9N0 g/r[F-FHuEG 1C/1&Ik&^@QCTy=T)7<ы3ebhy E2h;fqYT)TF*%bx0(@̦s1$:mh"^e(;׽͚Ĉdu  UaWJ_-MkoA2Qu6wg]8avwwO>@|+;psM*R*f3Fa ;Li`&fL){32?S uݘB-BH^:b.M5(b{Ŕ5Dae*rաI9l,Є( S3"1e1JH"hb \!h8?sZt#iNЦ3 Qd*xLY$=-KU, #2 ?'IUd^"*lWPm«KFr'@OCa]f{ '!I.#*k:\QfG+Z-DM P"=%YX%(5)R ztňHL Jқ IP`t3Egt) Lo"Hu#Ir`\AMƁpLF@Ddr L%9RO7;fsUEsV0ZdoFg212tCS"%4Z)h'xM2åY2D4e T=Y8d"Z˼Tk4\{aSBL׉1qVJ Z1֜cS g* ΄M)sby#'/q$S:qF ypѷ9S,ɞZ~\QQ#1 mFUK~L+2L,|dE`6%ć]KIʽEtϞЀ%^MLTM 𹍶ΫQС|zeO]YrA/U#Yɝ%T{HXvb (|W:9rSݝTݪ4ܥJJF!X{Kl] 6I5I%}\E%zצd mKԵu<Я">QbR pJS> D= Cފױȥ75lh |\!vdáF:xPx^QHKRKTFp4_Ĭfj"b)HJXwEH^L QjZOtQoQr Weym| oXU"Q@vHD{"d/WgDnDa4f[5 MJ۱ر w;p s)ڛ-ԃDGHɷVx+UH݁VKi'(hz 񥸎̄ʫR^NX«)b{V隘vDPʏ,<奨ō謘d0UCJ+\?,q(1!zNCʚEZ8Y50HA0V@$U_=RmQ|ApU Sb"V_ ߒ<W+gj-#LoT͢qiovbojVchGtAB-tX\?eqG8Z0|WQcdBhZ?8vDgiȉg ,`M!_g!23E nK I﹐ uJjP bKv\bڴޙY(8uBTt뷊 E^Ar Dk.IHi[Ršv #;Ha K>6IK lNb\`ɗ|yK9o<'P 6%R%Ksg& ;-> eLS E()cbnrؑPxYqWz"HcmKKیcHτKRmq-Gѣ#%Ma) ZLZf@bh'#j-Z,JT<7<'8TI0{’ VhzuACYz r-[,E%L IRf0섈ON=ϊW$1DNEJM04n"†:l`nZ(aCu%SN6K Ei']DؾQGOjf \G&l M"7]|#F$HfI6,cZqMܔ|MI4Wjns=&( @*#bb_]kk:v0[hb+o>,ŠI2%2yG[X DK`+rbs^T/tOeK9_`\F|o12GAZԅloqq7J%f% w1WXBtu^dtCsfƜ OBrYqqtQzό`Fțt+fJWKI* NWj2T8? d_[hv$Yf#AjK(Y8`G8\yV@6=9GB5`_"/ >N槯v&K-YBK^(Rr )x m<8(EN|^2cP^ށaa <_zI|,s>os( ZZG: uvDrS0Zm[q\Hx{+|WiE>r=,"j5QF<5bff)x8/~VoryУ $^F;>}iMU8v|2H2b7~C'I`TR"J\8, F9s%PһO]1Ĥ0SPwK-۹,:̮lj#yH9PS}W+8l2@d*Vb Fb~,`b =zƇ|r.\(e̘ E~$-mŴv [ (HMpjHRqF5Icӧ;j-SΆlr"[S<e]]G:̴`I!SSj\ #L0ed)̑gͼ-gOvitt$,ņmvAB=ȵ5 sqATeCGA͏W~BV_ _UP/џWς O?}}[7PwП)^n!S ;o!0%"# 'p^;>1,Aiar2E]0@(ڇbxi#1(xq157P [R,.+eO;v}eMA Un'M V∇ z&׆(*Q:lH\(qSn=!JdKD),*0Lh[22K駡.4>p2Q~G0CbR&4ӅFid STF@\r'Jx0NJ5S*'DJKE|L.]@u|3䶠DZ;;jҫO S-)#+^ Avx.䴽r5 /~©҂ƪA]z}w*u!Qmo ,RcY3Jfǝ@.i~C5|p VJZ/q_ I3vcmWO4&SYppH8 N4%QCLe$|\sDf/0@Şfz9%BӐ77:jrH׳f53Q\e'HG18B, mO"V z?[wEc)2֦zXppكao4btK;-#9E:z& 2! s%'A-O/:B̀ee]HH;c0 g*u<(&%s;h5IzQŰJ?4V4`C0?4sS^ S23"%TC9At)|2SQ6j`4Rz2ҁT^!Le}.3AwC҄,kɝoϠ, uGm%9Pve[2FĚ^TmcJ"_@(J ]M\ (@)GP4"$\ZYz14&b~! PiD=#ДTw˥ q (a> z9>p4%A(M sU'+ J34'S@HW#0`W0mpJ0H`ބ6MP7hnJ,$42 ]^,ޱ/b򦱁cSS~ p¯K)jQ9'4LUjh3U-K&<Piy[e27 %y0Κ5gZO8g#S`Q|^ Ȗ]b v|SkU$7ΕCnb2rLF(GtCZ%2jQ]#@vbrtc{Ū@;T92q. kO17qTZf23(e6J639$:?JH!<3wTD+2^9MdͺoxbkRVD PcwXl^F*%Ė$X r` A44{-R=4zB`;ֶ@pJ圴nq{P2[b#A.[{w%rV7хt}MiG!R;rAwU8Jo%`d*N1V)wv҇Vވ/bdN4+" $Mznc& 4,67cs )A̤B N (j,% E ~B[n(@kMVi(`c~0`㦂 7@hLRHʨʇl˪pp4 :5"aG%z׃k9hF#U2Eު(BTLM!Ď-~%Ob@|ʱDO̡)@b h..B&2TD,m7ot.t+yMtkK$ ۮm1PzIKv@*Ah"4FB`y̩L2 cee?dB\B"8 0pIp*z'$4l!#BɎ%DP@^Qh\V% ]z&-vnm .z]]ͨ6D0 -Z ]UA%jW@!#Q,$*Vf>lg$bB$N0)QYB F$r"A``e" w!(LDD9RC/bHg9%Q f\ 00-D{1Lz165$6S~%)٢di^L-B1`FBZ8#".~%I#Σs1s-l0 ',(F.8*""TV(>Xo:\"g`xCnoph#,GD k ȎLCm&1%qx2 2EkB[A_5z2Jj>M*$vȉ>‰惋ttgt#Hf9(Df+tbr 9T(. -d.L6oh8/q/d7b4 Vw/1MR Ib1$ DN3t1OSQSQA.˸b3 ۔QSS[',Rcp)KVBS3#C.H=LR+KSdԂ4B2K![x%KYT%8s5=T2'uiVbԣQTN) ^)OJ:PCnY8Ҁ=7-5 44US`y!{ \36koev6)0ƍqZ5JBt0d):c8.Ƣ."S"p}2,|$(Y ZL(ABc9p7[e\1d?SFyrz]1"Q<4h^cLC!4߆ֳ& a%/{C4|94Ck L%T#VTt S+R?^4CLLZcL>f:"mlFWtJr~EHqzJg4Bx!Y0~@fF)."isya}ܴ $̀@MAF;ej[ ff4 n-QvsQdnmco'Gi'p?5J 4Tq/uL@ cxu#$7rrHEbc!$Nb* Xun<;v'tCdЌ(goW`p74Y3(5P@Q^:~_bx{5z@YM bl1a`{mW [t}D\a#(}=wCYVoj2ԵVfgҪOfWvdi#ȗ 먐0)6ˡR3g(7)2hJs0%"J?O Ll% tҖM}ѣsL._3˜oUZo ,!T$OrxrXyEZ`igz-s~g#0>VXɧ)fG|,L+NsFٕZy ɔ?C`Hd vwW|{=D7/tR'i}}*kM,@cc%@U+evuvuR|TUC;f.1+$._;Fsք~?{2%*ʼgqWGDCgѬ1ߤL=ډ};[P+L!@< 6N!Ch`^2;I#K6mE4AzEzvURQQZYoJ,gMwh JpF)\d8yLyWYѠlˍ's|)8 ;}= 1l]Bԩj>rb+!5 :̢IRx,KדۗA},Ŵ>)^;ϲe?Ur<-We""I]Ϡ(g!<^ ,ò).J3{?;df,KdqrJ1ddhtO)+R%Q[{;D~qa'آ]qɖ~@B 1\Oړ=j6aC?v&)YrY-UlyāqwsvmtzŖloTe])!c!3 @K7_u߯w{;fIJaD[ {l|QBˣ=^^fd㯨$IiƲ;d6EFv+djc/vr Xr 2铋]|$+ crLa+eOSUW4dh*F0lB%(6|4*ԩRRzdέ:` ذdǚ-[օXhϊjROH.ޏAX`$$ O#,[ڒ8b`=Y/#^C^wcacH$Dm޵QI߀cErE!e 9]NI~ .UL!cJ*V 5_f3.l8gizR|duAI!N+WU+TJ}U]MUUjXٶfyM~#2J jjqnap\oh~1jH&@5Y?}) 7-1$db؄>٘`$=,,n>3dH8PEVϤٝBĩEiL|ӒD AW ZcKtmb gvF,=II#uLQc$$D48LY*mT$Mfj=JM$fNDFV|էPtj JRyoAD.rD$X*#ͪ!xjRE/zrgJWX!l&Wa|ZfNi뒗\n9>arQ +j$/ >k!XV,9MXRanhDUS8;eJDXyd2 䤩O{1;0D=iKlzS8=Q,p1X;LC0,峷ݨmAYh*>*ɁtVd-Pʗ\X:Ҡ \# qP4$'jDr55yW%ccXI*}jWx8,0*?y~k)iJְUinIߵJ|NR-1c "1뎾k Z]oՈ(# l 6& ]iyKzn@#5T6QZ EN1Jr{uc< T E!(:&d`&qNEj=w[3:HVldkj uNo+Ǝ&"K֣\׼V$Nz %THf#޸#.Zd'dPyn2EdN6!UT_@RKI<NbAȊuLG͛3XzĠXɜ E*iY鼥:Yn\o.Yr:f#Q]N~}_SHke.c;_Đd) f=p/?I% bLց_b#^E#HNbPE{. *Yjs hӘQLq!0?k8`s$7 ydžree_y3A^X$AqVUM3ڑB2jiB4QD7/1|ooE|>|wb"UXM5rqa~SY~}7u7d_if%7(G)Z626gr;JI'(+?qi+<3g5(RYa!i'$iLɘtxiJU:aY8+giL3) F,bL!=d' )M(D8-_&D8l5Dy-gl] &i0a;t'Tno&6YDA8" p4:HzPS@ybb(b! EiQ7 g81`hXxDWxPr؜8z7?j9IfK<(*"a>9:awȌy u evvsjF(uSQLvB5$?w>gN7,C-7]_].l3"fk57ɋV|{FAA' uȒ7QJ| M|R4ؓ =9JS54t {g4/_u"Uy_4~iVn.QBH*1_iGe)ڡl>Wqi/htZbCkU4a E5MH(TJZ=q"-&$\ti82qJhDwJ0i*f6R4ȌA'J+\o}n3tz).f<Xo-&!ا'j=,?L/S9mVAՈi}qMD*+r!+KYIF.y5ڵ/#_LKmA 1ܢ<8WD]cY>8~0⨬ 8bYw[~xuC^V\q9ˮiC<+IMZQ.@̈́=NXNB3%ަL @ߺW$M~"ňռcZ~Z6p BXIA 'R ؆{b| ͑*/aTn2q`jFfn H/(XԑI31:NF1a"ꘚ "ʮ/-KJ4ևN.*>fzi.-..ח0@|V2eկy͐=7I1ўFɫ3o ';Z>e ;Fo  ,VL-1 (TIV[NXYnmuTO paB M,"K/3}\ f̖t s@$J4;]SN"4(EnWZV}ӭo֛V ;mlV ]3-4!CApHY"޽1\Ȏ"cmpm\LTFljy񭻙UܚkױasmjExdqo%kf`uҋԷu(.xJ|yw_^}zǧ?=߿l؄ț4@%Lz*+PB& d@]$LH ٩ B/p[06[@PG]LQF&rI*sF6M$AH2.I%6Rl9،~'>sO?A44,P,u+ꯝDLҪH-֪ʁjD7",c XUHTm+3T8dzŠym7S*pV2aMZ]n[ d5R-ҭԋ Rl]VV+yU /<׾~`6O-ϥ@b{G 9آb& $q $G )<ivoxd;T[>IiI+Lś.&4jNW9HcSGy;HI;M^Nh uTϥH?&oIem텮H*TɅ}}0 ĺ"clxBg(d}ٞ}JMsp- }x6ZuàNސUc>{̞{[y<⊕zsly8  1ijM,NLQ"ߌr܃gB94r- iE5x%ň8C8K+21eLNjA.Fll>$nTD$Q竔U(N^i"UE&TDư#i[8K:L /qN1#߱ʁ&S@kW[V_LO ӃN.&I8k&zկ|^T89yA{*] 0)| sWΖ{k/ 4ϥjdwL/H)3[إ0 6F?SdtnPF ވHJ|8`-#/5weIpO:S/`*,9${JFnx:=)2_t=hg,W)ϡjmh[^.A2/# FXϔ %>|&L&6_1sTu_]B%:,4ٙBSIUEHYSu#DlÀ)=4X6Ĉn}Dnʼn| .GQŊB-~ ӦK\HJB!1aЫde9̡XN%FU]VdW`."\Re%iL Hyr+bX;?TP\\+l቉8j9yMhLZa k%և5|f;OVM&Yk!jI0##dҖclB ٖxskpw^~Eɥ3\%&G][Sq)W}5/- yoՌ/-QJVX^#ӀttRVy1a\Ӳֻ6 V>TvfqST~[@WD˽)!tyw'I!m2 ;rL@" 㘅m PK4mb6M&>q~`U%ёKs44{ro9*6uad>zt[]dR)C I_[) ` O#θSz;rQ97GZňnRz@⌷(m9s9ԑ^bUCPx*Ϲ,ä909l"CDd.*Q˴ sN:6jHl::N1^{h&?;{P&w;@Ydgbk ^ʼnoab8Ÿ [0ۼ/<G #["0t+$yG%|ګG"ד3z+$3#?3>A6xhy?AC9S+-,>9/ "5@ѤiYW[IM1s?E*Xɳ{ ES++YĠp:Y\JZ"eEzB-ZJg|J)2&A˭}ֺ" !l뭂ӓ#Lž8Bc8>Ita[)\Q37{+4$ @>3$)CDzؿdB5dB99,$s31,AJCÜcLD#NIT#NlN[cmk ;TNl˚ر1Zdʙɠ ^ &SOJhsED&,Y!ز Zq-G(3/2,=uK?GNa98'̿~=b*0i$[ Q(ⳅ= 55.ƘQ1HH@ya$Ī3ҹጴsIIi? (E{ SϪX1,ӥZ6Yd 6žɒ1`E-AO񈔡, F@4>2xG!+恾V)}mDo}Ǐ ɂSAg#S؅H++)tk2 `?EXTB7ɶDe\Ae ,T%2BN=UH!9q=+t=xTP,04-Q\ 8\q F>|!J:H#IGtU QVhm)Z+5,3 Q W@@7 Q٭Ԇa@z[dE-!< *\Wr7ϵ) AE\%NJ-NjeӃ` NmZ}[UxdYMeuԜaLY0M3^p0H8ٍ;ݍ:+ey^fEaڙS^-6bGԻPĿ?EQ'ME%XƋr "1DcFX<#H86`ܷ,T-Hf \(PGKIu=(¬ʭdv%vT]\+86UT~¹yǎ`O sIr*)oXвD7 ,*c#zg()vZT^"f -fmu0F*-g%sNFrݰ(3Emb˙cA'kBRT3Tġo\«γ\ܥdUGϽTFmTgd )b Eg.8֭R.,e*|L8'Q<*>Vq>|M%|jnڭľ۴k"pnjqVj ]*jtj_b{bۢ0/i9l@|i᱉ieCkfcE5K2DAdXJdLd̝NO&s;3eO1uˎin Ub- HM.McиzxERff,ifI"pvj!0ejPcjꎟrg#kxj9*?^оs yzb֐JNqEXBŲ@LXthŦ=&"$Lgs8j)2]ƌ쁮PRUpBY=d)/8c!qݟI,ǰȇZ&IA* ǺgIɜ^X~}>_tnۉXB zK["j"!&sr [ʚ^6Fd~Xns{F~KvTA<!TlslX68@WlB.lznu)bF[\[$ەPw\7k*"?pV'v , EQaFmkv`w5\:b@&mnl_1et%kZXr+Owt_w],4l- Ns&Enŕg^h`pDpv?0@xlqSt qͯw x m2EV!C|韙WoU_WO@ߦꈥx&/Vq#i`v&mn؉ZbnLG!$3j$z;h^B_j,uJ|7r"F<^wsDw6h72+8߶{E] ʕKdB1|AO]􈸈?ǩH^tMG.%/alX&ꌎiࡄVWHL§}8`f : eh_aĩis6s7ڻmgnGyJxGm۳Fܳ,YwSd{or2 <"<&n| \$ȐBb#ǎ->!I%OLƕ*=Œ)s245%K!}L%O/]0DNt-JJuV[ ۋ׮ƢUFIs.ݺ4MeRiip"aNxƅQ1/?d9#ę9,?CZFz:(}m3mPm 5FL ;blR|qoUs֫ߒ,ŔV/d ![}gA^_GugA A$ &ta.PQ Pi0FZ$C,H5'8b`2"xdEZ)ڨbp%QR=dS$}"WyGWZeW=ZI&9^S9T^4_sԝ,TofyYPuBvJf'\\&\go }ԈvgMy)2yّzݧxq[|ߕ+J*^xekV暰iF)d B˒D  TѳJF=Ud{d8ţא;/N}:mPf k#^R.[1LnZsqmty~g}1(2ʉ~^z v˳)ofv. Ffԡ5Q;ya]K/$,<Պgvjnm zb…#Z rEvvQᆬdsmT^J9hR-CPN pJS0Ucn.<:=_Óy&Lo9#_yrɍ5uY=hIwϤ/mfbi_@S[/aUjN0jXF)Gj}~_'Ml"P:CO2ӷkqPZ2L^rTfF<a;ʼE!mZOH,e; 'RLbEUjdŊáBGڬld%F:IQ$+\&rqdHD{ 76E ~:nWio+5j$deLV0mpU䖶A>D ! Q$CI1 7^*fV1$%2;rd!P9kzK]{Lg9Z+R"lҜ~S::crQ%{$GώУ^ep22J`.=o}%! e4"_HphCJcd/0ML FO%yxgrBe`1(J|=2Az5ڀ4LA#K yWSPBEr.r2 4ۺ"F=b\*)+;Η}zH!dv1k['wFШjaK1Q^@# (g7c"?uhxM>vΏ5če3mИӓ:JßƙΗV)(eEILjORUY6V̹;m9r@n9&R:#tL0 -N$TKMj+ Ņ%^rWpGldW;8a绠$yeQ]jA@-nekⵘxMdfpƏꬡ+t3J.R[]}ZIo/%L"o?#smCJnғk<P )rZ㎒䗦<:b(.F&,\z5]*k )FɉYE//lt2E)us!W&)bJhƁ)P mH&qZmFv*2C9Αw$mJ`{_eޣ +\*GJk:yRMJkֺ}4=wܖ[nrRQ<|YjVKw[[w^WD׀7Z7Qԉ|ѐuyBҕ\ЦPqm ʵ\шfTf[bhcGbb=ڋ^r-{8[wc^Hb_]O9/'e)3w[*sTQ`7id;R;qf/@~ XV /Bsqj7?з _ Mr3 G.rn ,s17ypfY$)sesw&.doн$C|t:h]"섫ԡ6fӽ7Vv4D^lLj.Gk eƿW3I wqpDɁ,/-,N 11`-j~^\ݐ2i,u7]!؃({ O`p} `ԍAlHYVV͑ڌ}˥]m]Yh A͝OaNR b`m K.#& Q~}A^?X~%޳=ހJ\cÝ`D)DaeDp^O%9 }M#dBhI_ʕ3RF$WY4ʟ߹# QꝇP `<[q0B\\p 1ܠVFS_̎|}`7q^59$&ɢ[H3"Ip `|aI83ad.ZV.ۉ-!8ɡ $2jOaY_cMa6H cNY ]eV^1PS؀} B#]GHM^i̗v шQ\M#'2ƕbG# "a$PV Y1VOZO|mF5"%5F)ajM!7vS_:pj%AERvee&I@1d$D!$IKtyQy^SKJFE[jb_lg}f zfc^*`́yN\g4䌐>J%QF$ %C1PY!oq]g6&а02]jfV::_qf#^1-[Y^,$hGL@Bx'NpW=RVb-V)JP_k~"vG}]9ڽq$diCˌ-LB(>ណ/jfif%xT0cKfhP95>5m~7R%k8>CMc`^b]:cd9w*sfW7ie H*"0jE E)xݰ2I+,`Zӆgy ~n\-M(k=DDbiXDq`VΤ)iL* T6*eD WD(mf(4(&6Q5uZ aj%@ 귉,c2bҢ^lk,]/`ͩN,:]Rj}ZkRj,vט ]6GH,})P*Қn0aT]b"p,  6tnCfc4oP$^<jʘV꺹ߞoS&%N#7v_'m%o֗pn*A k,k.2e zg\'~쒋Bz2mE$|^ fҮc(ZBΫ{&zJщ--#,lqZvom$C&^Ï6#q] )*bݝ-ȑe ɆeinbI(KBqZI _kWfsc0Cȉie!*Q*Nb)]ͩ ߉M|M930°(jg(3\+oDz$!9Nʬgi+H6JtȈq&XLQj<.0cb|jLm"ʖ_1dΞH19ZE(H0 ,/M_o3`YcUBR&͍Rrlz_gܶXa h'4ҁY>b j&be-N0F[7/[4t3k1E^3du12{q0ؼgZ$~X3*FbުOdR_[l;J'ǮωZH9{9ޤ)Qig("U16BW4@gC'2 tK3IJvs3pd``4`ogx]!CDAԢ7esv4mSG@Sw7Q;ijaBu^ n'*Y.ybnWq2_g!t=wae`4`"Js7us0p0b{ jx6Pb&q$.7\52wsW4洧urZ8|t'40sw+zH|s֔$ r x^TRs/(z9E4ʽ9{xr bz uWu_&xMՠ띻'9h؀3aP:Hm$ 6޷=ؑ[=3 ΪwyynɋZ\@Q!Wq»9eSvzܴ2zV&hvv"!W|Ƨ殶nd~<^pN|sȶ4v|L7<$lwԇ##KE%}wcz$0z.zb|Wym`0px8ɋ|;>7{R{+Dm;}_M_Drs +Xmj'uc>~#FWI:3'Nr\> Y2ўBGc&X(ФEfڲfsuvnܻ; ouNH'%Ƒ"\.ʒ S0!39ъ+/}y1rL|sju>m Ɔ̦ ,l\L j 14̐ DB]lAFmDIGzTzdmЊ ľJ?KPKNJ-c.i;R.;/d.+1ӯ!! _@*?)\0jQ2Sr+LQQ4NI5쬉B#D'3\5͸CG#CI3XW۵^]UVb}+6?1|g".=N.-;K%>7NhdrɥMu:VcUЧW~- MEaOxB\`8EԂ1GY7iz M>GL95_U*U6U,>$^5}r޷zH2)f4huvv-\+Qnʵ4f )| x|3-5RGնPmK0.Q[na{=`M#ypuW|}6`rbŜ$eunvފ3[ӥ-kFOI=uܞ]`W\lw^PȮwλ,S9/6{P}=_~+lytr'Q69n?i]D& >V-9SK芷9h^<bLzQ7uD:J& ސ|cać'p,\Te4eƱV[%e\ml=[xՒh\b 4$EVl3}:> B^1PN<JRHD h 8BQÄO@|g'$/((9X"Fu2HX'= ڬ1.YFjFv,pƝt$CB52.fu.MEm kw [$Q{ZL|nI}T*Zvy!k[3&MTd)Ԧ@n8pДrbAYgy?ʀo-[ P>[><>>ABBIGGTHHTIITHHTGGTGGTHGTH$TH$TH$TH$TJ$TW$T`%Tq&T/T;TEUGUpHUlHUlHUkKUjeVkkUkkUkkUlkUllUmlYmm]smQmLmPqNQtZmWlUlUlUnUUUUTQJ>}4w.t-o,f,[/Pz6JoEHmPHoTHpTGnTGkTGkTGkTGkTGkT.RT$HT$HT$HT$HU$HU$HU#HU HUGT>T-T%T$T$T#T"UUUU UUTT T##T##T##T##T##T##T$$UGGGGGGGGGG@G8G1H6PAeGkGkEkGkGkGkIk]ii^k[k`kkkklklkmlxl~lyonzlhkkkklũששתשששששתеŰњH*T I`aEظ1Ǎ%(!jl6ʗj(_μУK׏(ᢆmJb8&Ǖbu~3e-Jʟ#Ί~u=S, cN1Y1 wFXOvX}~X{A&-+x_*B)b؉bAߊ_,4PC)f5yQGwqRnaGg{ƖJhJա4ݜ=BN8!sRUyDqfhZR-MqՇIٴPQM 1LX9XiSIWPZRq_5Xa}HebF8"iDӳ*YZkxqVErG^EXqhm]wUt|ƻ\/cJQXd5Rvcd\0$q4E|K^gVPEWcE&Q} .UU9[nzޖ')k:, 4` 43!} 6S8c'V9oNN9Yy[wIr\YZ|2:;䩧QnRjpVZ"ǖOX(NG62%\Y֮Fu=dVtԻI}2Ͻ&,{$95O_ % ~vtF.Sh=GCڦwYoqi֚l%R81o5xNӋt)pǞNb CbD$ HS.=lRci@t6d 2"$ ѧ4aF'L#dMe̚rֵa)zЂBIjD")V ]܄3 ;a2)%>*Gڤ&aIvDtb;⑂^8\sT!&BT~Z&E Qs0W a" @@#0ZR:X`Rtd)]YSrdY$iZX.Ѕ: ~'^U2/pP3iHCXoW1p%&H%k@䪎jG]ocj/ޝx9ѧ7 x_QJJ0L ԃ=@vIDE()t`'DᤅdHQv(z$@l\a t #0#NPBXa YՆ"idcENPvZɔt#ݨⳑL rY&[T6b92 ;^>I$$RxΐT}e. d$xDgBQ,AO.ddCD$$r%B.d\kҫ&&X=l7;2v]a.\v=''í!s'2%'  ,0! V AYk6""/ FEF["M#3&VN̵jĩJc&iո!% B{p9 w]p{ÊR2k<ۿzw]| 6r' A@HRd8F s QP7T2[2a7csGi.wWk5'3Za .7 c 8BoB7/:]Q5 5Y.ڼn]@]ds87=sf7C]Ǐs0XЯLJW/?\3p'FP)DNv?,JY c~hgNyCt_x;8|ʈْ x]U}x6X"ABU]v@2@7'rt"%pWXpzqg$!`Gg!#fك(hX|W.uRpA41L%fZ&k],H"vwcc+rz< <@?:P<_<@O:?!da?ck%hֆtkgjxqʑ|W!2Q!/Q!; 2)(5ADQtT5Pa7/7Q K$=51CQWg(6!ti,'k=#e1Ouc٠; [ \<_X X9^ $`?kQ3&b8rB5QQ%k6Q*6p4|O f~`sut\H4wvZ"teكtftqtifR:3‚7\\t.k!I!u $=<,BLW9@E9__(g3H;q?n3vZiI]AKg&UBf `a˱b P&OQWr:?UbQA9X.ar-׎g Ph"Ra{6w{  @`f7 v5IzW Twz@pXx@~Qg5p&He%(}U8{9 bЇ`]^)`$v$.P5Q6\xzFgLן(JJ\K.l nt1}g уnxMXх5m%;g W^Y(ƅ-pgMٔ6_6FKhZqq|i@ )QX;F?wmQ&m _*_WUct5}q7!7}pp=,< =QF8 EѸ~ɛc%6(nQ+rTzLeVa/NPHS* ]TO!t[Y\VgɦJJ=h=H .b]aᮦPkqgeA~\Yv\R57e1rw _#w't(eS;jsך"ѹY@ pX.C\RwhkY]AYY' Q"MTߔ Ϫc)),(_P{;?|#jD Ũ,"\õp \ J, J^z,>Nm 1S(^4tECLtTb '0@|^ r本oAe \ܸQ_MX 0lr6Gq$EJ]Ґ82gDPN%R&!*q<2XS&8, )_PY،~±| ['Xgj7UT 0j 4.OdmѰ @Ǚ:GdzAtҝV A˴Q]мY<} W!Rqf`gYs/xnj˓=v ~?4 *Zl~tE ЖBnLǟ=uX%#-Cu(,g넋+gb_V~iPUV?>d)42rI1OGp p?=e.ĒE~@ eCEҴݜ~ xnso [>um;z ,Ϯ()dGR(7gS"oQ/L手뾩 ¯ c hY"q4G4E+"=_L?Ƅ(L*yO3:GA_1Hff-oZ+x]aV#<<1 WX`\*>=‹LK%W{.>Z?O'!et􃿋`! l2`h?HɌ-k:>gi\\єLu\I%ý!Xm_~e ӆ  Kz"zy_n=|>4O'| ] pp857MҐ, ܐ:D`AWV_t"9`EDJA aĶoZs 4a eb+nąQ+G&fG)EV-_ޝp/.]Ġ5Qu5V`"yFSb9 )cvN:ivJiS$0RK)%)ϑ\DRiqԨ@@->҉v.]x%ڋ՘.\ztOsΑAɅH<;Ma81pO9==?6sao!r@2ʨdbD.,PCL" Ѓl À&R|'q"t0GwAFDx1 LP -`R@@ ï'D` ;#RB"C9\ .`dhi'pzq;85 ӓ[xb?NŁa\tXNդX1)@1)j%₎"-Eg1ڢ7I8@Sl b,ಅ5$jS+#bcUnEC'<12q5b~z.)X'Mp%6Ya_#-44BLdn 5I(pλq(a& +B nШ9yMhQ'4dAKZD6 ޲hDZZb'+{1o|dR>-ŋWL\[I{q~Iҝ]-Dbԕ YnM˶n(pD`l#ض?㖸̈=`66#ʝoLM1ݢT5VJD4ZQׄ;58$1T@34)N,4g"ѨMJd@ˆGA>[#:DΰbDɸDr? _. ^!: xC 8DÓ csEb 1 8=88豝CPa#3 ' 6]1o91*X E-!#[*Q3P3 ) 8[;ГS Ca3 2A+*7:80Q ,/H' x0D8$HtHo8@xH 9.Ę1 -bN@7 "sГ MC(5C=r &EӪ4c:$̓4`4H#t:&A2"EF ƵmzROC^3;+iu1vZ, z[; p!j./F̦ox gFDDxo$L" 0 X BQh8{i`XF'Bs< 1Z ~"!*k<2'04j 8"p<pPhKn:P)L%0yTd+ac]$2`t.Ļ5ͣPC[u]JM!V;Ͷb&߄X`Ug}q;W3U7EE4@I$#6Ъc!9VYP36HȔr됕\,K|2%4cdǔ?A2@(-=R T[ _qAIz)C3A}XPe 3튜 #[ +hQpӆ:f@9< J]:mC@ /ˣ"<<ؕxRLu Y3 =h' y[q;e['9sgIoj$һhD*W%hӲ>/Ϡ=k `sS^Xu12VW \NOm#Y}}M ɼPMD*BD 0&;x nj *UM$DJ,;@XH"˴-fq 0E5,;==)Ys3=ӕE2nHըI;23JT)yʷ^̕1)9[қ3M@`9 LHt^#r_Hxxwh9 og@'x@wHKtwQwp`X 3@bW]0#$a_{u8d `ڈ4қ阏OR8眽&ѴWinK"3BԫJ11 R Q#ݸNβя&53WbX'a6!X %S*nWO"ѠnP0^NN|En$㑭qC{b tēىOyfrga`\=Mq˅٥qjFWW|uUvYqXQsykēC BaPTrB'jTb>J%t=DF.^N,z.^ƔDOJ8SASpHY棋XF#FWIYuT%Qeڱailw**R 35#da͈ɖǡm%-NbTOW72L0*R(qeYE,e WS`BP -Ƅ"Y0sx=̂QfIB]I"[YCA{ª9f)^T'(8 Ȕ3LH>Ԡ p!:anT100ΊJHe# Z<2X 6%Ù{q(ʛrpG;ҏx#HENSďsAG=}$i{rNm"*J yE(z8k~T6K!^aC,'h"RYq(nk 9\+ج%p*:A$h""NhdLkf:YB̐%cXn&=)ch )$yIVd0R\6EnYv9bLG0ĂgNo1Iۂғ)^k`CH&,&\8~"'bYt{3 >J>Ojkc´H0iuP܅"VzA(CP[ :-snp$([7[3C0kkR"ayP .f?=xϸ7c\mJ:7+oӿ`*gIR w*w%XArſ2EU$C7 Aw4*F2$"$W27m۵mN %Y2Q&Pѫűٔ 1> >wYV eް؆@1 s{gv.ՒdN0~(`vߺg=Nm@r͚Xnݻ,9\Fg6rmr#\&w 틏yhU,6!CL ́ e#SlU_]֤h_} M?\Ws`4Exɝ8FD\!=Q= DA ĎP؄QlMFţֻ`EؘY  zŮ0BcQ@ʅGMD\IŅ(%l޸PalE0΂ĸxSSIZ>BZ|d IZMDL `Xeu5m\F`_GBLjHdfZl|T]- ?0=2B|MQD)h̆"NRnH_jdhjƈ H fWViHIMW:T! %΅-[6$Z<-in,O\RE@J'qܨvډ2LRe(~&=2gAKՔ@-Y|⒯YQ܄fbI񋅉ĬƟ< PDE&4H$q2)mTt [ZA NiG0dVD\ɽ-FeZN)=\MեZDZB@+)ߩ>͘Ađ-EVOwywEAsQji4 Ozj7ٜVjd K`hid$LҞېMF0D0"M ҫFJQ $ m䄆#!s}S2orzg`+?’"j9JSU,XA`HO/v,a oUU9^M>lH@BEhLĎ@8,j|R XXx^St,j2ݓy;9Ih|O^(qˏ.y%m޽EV,$c`҃w&6ȹ,W7rCGw{vFLHe`P%`!GfxY:Ƅr$.PǛCWbFT ifD9bmo!F4TJ̶]߰$pHj΁0JWtr iɀ~"Qv e4Grg/ D ]ɪ)P݋N\_5^CDďBfY%B(xL!Rz?2`ˈj1i9dh!b^o(Eqo0 pm^ vVKFɥP"E/'hی#/[ .D8#GתvnR 9 i<5c#o1~y7Cb{HKlDp~u.fNg+[IvHe/m^N+{"k胚P C 5[7zTk]rSHE IA,D$6fg?ɫlUI˳@8 NrI'7NtEAP܉bEz_};R@$PM:b3f븝59iIxNs95\D:H.STʚ$_$S##NxQIEC&SF&ћG1 =hW"2 ҅Teo 6[^dfj-~ Ʋ2p-ZTG:XpHÁ& ⒀weT|Emwa5hhFR5 Ez*څ !mè+HbJ5*;Ugժռ|ɥ~74ɺ,#Ye=2[ҘqxN<73;"1ѢEe ;a )Ig&li%b +5J62e *WeSUXi(ꈽsϽ[*S+6Cc=6d˳ϊ덶 f4Zf4<~NUӼ2iPM:,hkؤ_mW S$.a̋2^t`)Q4GC&V2qT4Hd(8IR1s)Lt_ wB0(zhE3dUΉfVmX23cq1=GF^A@-N㟱NHJşD G#HpFDN9M?X² S׫Tah*Li'숅Na<飽u>O;Ɯ0f!yC0 ]ºŒe UjլV0vdixA |IFSPK2Cgh4,1MW8ZIu4 ki3](C(S`;tl]֦fYjؚbrH@SKϙЀ':]F 0SAזȤucso^-~;Ste߄v@jto:}Xgs l'X{Op3x4"aSI([Bei$TZw&F|6I>kb2e3^i& Lo+7,@q+.ߦ.5q1 2g$nWu%=P PZCCRg5MmV7ҎED 5ЍUTcr r^ bx*!x\Tb{Ζ55T&u΀olZ >qzdRܑd$qS5/7V_ I Wjb^u73IڠϺJnP[ŌD R`BlICIqE$5G^pɸA-]?R?إWiAir^x7Lu0Hק+jlaTU@pcL@ÿTP{I13#rVŅ5\U>H}-5hs</LT3uuJkn-yqF#A%K:%vjHH~j̺aAXL{q4+\ft&fI[*BJp>"2@(E80""Q/T*,g/T l$mFfJ.ڃ,|Ol)?B}dE!Q -en 'GPMRFg/3&cjbHdNDpKd$ī+R,6T4xV:Knv~qŌpT37L(B"P@H[~(b"&HF*")-P*B"*/i.qqQn ցNo6oNt^+/~?'B[dH<*<:b^2)"zu*L1u;U.Jo M71<Sme"F5RT2'DM;|MB>RttB'gDN`|i䉗 ɝ҆sj(7{w31u\V*҉⃣RvUP&2gx- 8.xI"Х\KaV/QG2/-X)Lr jZ#n$= vgABsT84A[C3P] I̧Qx60y66k^!K1:V Lg^؊WT/XouՀ)-mk\R;-w!W{s!7Xo mF>=Y`F7iUheuݹAlt f7\Q PE w 3/SM'\ 4tp1$WY<q{x,2^u"Gn3XGuGLF |FW{w󰹀e?ԌRe!4HRyrrjjz:HBiy02zHdH0m&XEqU;隍S9>kbh;Ч t1SMڼq"SQh:b6mqӍz{uynrN,ch|yr 깒=H`fL )pUY(!j΋g1N9ƩW4"Ǝ$$E* Db;/XS9ub]#,qSgyRLD-8O8{T0s4/j6VKss#ϛxtPň?EW帿ףq|^fx%/, 9I:N{]ULK*|Cb[aCȊ,0dx =j޺0ܐ 6gCU.(cc򕷷ݕg$C[̀jv,簑9/~__2{7ۀIi EJcx+5>NfBp! V㰭> P˒λjefu㼦C PtsӦ8 !8`yqG|Bu;$ɤ{XcVgv^U3XY! aԠ? 4Y3襻ѭۧݞ?븝3hP9ҘIVH.…G8f4F-bhꖩXr LhNt%D5oIfBntҤI)u**?TZ_֫Z&)ctZ`=nv$ܑkuwn9ukfX%tS"385J9?qI%cƀq挣]Ȉ:jY`vj:AsMdq}FTYicv;3~ܸw_s?xޠGw}ʿ֧)/LbA4M5iQv5{t- { Y7Q$y8U^xZWވ ~8w*8"zPR_jx8Vj}CHW8P#j4 dmɈf\~e[B_dBIyt_|ddvVDYẕg 4 dRMS]9T(JuN SSA6b_F&Bc&]VJ:EKdK(D5!ԩL%Zi\U)VNV&T'Iؕ@xdm]f\mmXD'!& WYKgfo=Vcx2pv2,o*'qMQ6]Hw%b1I'rXA/D3C>S$G El6Ǫ RsɁD _2{"TQV5'uw)5]{%-wL97Idlvo#h_Ёe曘]`nitIɽ*Az$!iG Ɉc7~1rW 1Iu(2,SsPɳC>Մ%KEzFjQͭׯE"c,?z<ެW,/V_mWesٵUxA/]so+'` &uiF$fqs`o1XS/12#prCLFk!62h:{6y-D]Β9dhԆlh >Q _vA}\ ePvೡY!)N"ql\p>fPb;Nc>n͐$Ϗw#$H2#P@ 1pR%(]`o9( Yu:LSYB~'^ENSq 2A\p ,3&3ҘPP9,JuX*pRG&a5C#1!cPsH2Eȩ?Tc4SO8m Q%[L%BԨ QcԑYǖF4w r(5HTn㔭lG+l_'L!B' GLG4$8y@(Kt2!vYTgĽO1"XJFLwbD+IL'Q@$I=9{cbFBƲd]qzRۨu9asuU0a6]Z=0E _p-۶'Є{oC*g ؇.rIs@/᜻iN p߬O?T U0BZS%R &w]vHrH}%gtl$rH5gGsv&S':B6`Wg:q1}&qJY0P'uZ"/u85ieRiW)LzZcЖ)^wt(G 52]4 j&yE,l4lk,FTBxr `mimy-ã*l?U{5_R d/{Xha*Eap1}f1Q}15HUb7r8~.eoՀY3bgK(c83'Dg!Tt wF)s?57sl5~-Ve+Nj65 U2JG#0{GU?S3XkvVXW3v&3Jh#XimH&qӦL/zGp Dji(n /eԏ⏪T`jamR)F5>f)yzyzf(@qzV)F2@nh{;z o%nCnE _#n-{&ȷo|χbW9}2o10!$vG)~lt]vs;3VC1ppi'DhF Ss'bX2&bhXej)c7efh7msaQGv|!i9a9{f8AsI5ieic؆/Q4p Ne>>u@% Ʉ5!]lKテ$y: @ SN5w:29m&09I{;9n|/E/EPdAK@>6I[Yf}0XV'C3ءs%"qt;a&*}p*[[(c)7Cd.&r?hr'C3YF-x3!K8BZqfzĤEG*h7-TgYu$/Uwu{vefj0CT©ac:5]է .+>y#i:;ZOk1)@x^5؞=ɓ3Yn(` o% $甫J}(Xɠ "w͈VF~!Et "`wĐur)~wdL66qtyATјpW6b슘:N6"3!QBW Nf;0Վhuj:vik;0艛H.CRysqhybNMؐˤ>kc)7 [ڝ(hagؒVw 3njߦPEAa:Ƈ}дQ[˕%hʉK `1LrcT3ٱ452dk$>ţ"R"3hԮ4F{;Z8a#Sc!N$EK6H$߸{XV<[w[N\yj_X.`KAl[4++4,c yj::k{Ъ<|-P *qOԩ SMJ@@x'h/a\oҰ&Ir}IS`9#Vk㷮K$R,܀Ɉ2*)X Cڼ‰7%Ѩd\ SGAVtĤ}HfP][Z%37ib9r\X8jNlh)Å߶%-3q>⣽wrzЬĸé þQ/G]L `\u*Q3Wt% a:SAځGXьgK3cw@ zK`dZr6rZUv2(P͚cGloJϝyQzfRχmT:(г Kt!G,q{ ߂-A=.F=ퟭGF߰\ߙ,P'GeQBw=><͇{03ו]LVqyˊ+?x"^('5f2a4'!‚+5Ϳn;ZZAHNq7㙛A}D6&B灤дųuϵz+x1t?D5f^-$]~V-ݡĽ.檖p~oI1=J&acT~ajz5]@&K齯ԓN\-]IEi:4tpis5F1%#@B9m%!wMVhhN#M/*sGN韘j:t"ٵό3 CG:`$jPp\H8bŊs,jG E$9ҤG]hdq˖(]ƄY&K5srČs差PC*E:9NUCuciSa#K֟ذgKz,Y # Y9;RSղ#nŒڹϡލTNSdӵNeǦ= V۵W1o6DqW*7Β9ȥO^}zޛыkt!vN}+2 q!L)|&ͦPRI thj+#j'JXk+̔LlϦsN,2hmZm;q5OΒOe?hJ\W{II4pҺyKͫTGHSt)fXAmkdqpz W=oYiiHs7;.[y^_;W]uܾ| FZpP!Ys8b5%if+: (#f`,jJ-F$>2HRդ7h#\V%$k %lKWRH y)mS&#ovĹi&G^͡4(%*f) fvӚ/ib:Psŷ (Fe2J.}A `ٱs`&;- GJ!2mHɰx0 /Y\r(YZIㄋ\ %)Gv ^߳*Ge/K-Wh2>ؾ(? c be05L.c:R؉hg/R}mffg0֣8Ҝ'v$j: ۖI4lea %}l;T(&FhEaH_9;ڧ,d+,n2" KL:,*1Hļ 636%+>iV*Ejj yZe^Q+]je񍏕iD_i֘TeeK"-nppڡ^"*8.`eH:AȾOIRe'LijW"d44j}_[(Sړ!m b< 3RՌJde^.*@co'H.9RxD?増[9S%RY̺n Uh듞)l.TB8-/ r:zR|1ɋDl"̛7RҎW±W5ɧ'Å03LLJș9!dB#'y9^xZ(up{5W^jT5ʋbU3yFARUftF Ҋ4-zv|thBp-<5Cu[ =LV &v'bUX<]6vSŋyu'J3ixnx c OMHgzZ|iZ5b'A n`{ڀO'o-T ЈIb{}'Ǎn4߻ 5%dVBX IC3O֘)&$OTsߌ{,_S$ͭI+u׹>Vdٰ\ml=w{J` qIݛ؆,/~Hҭ ~h.oG}!xy$onٞKZ5ޯ{enm?a9~ZλǽzڨTNrR(iHNQ=)u<)Enx[^\C! 9Rhj}Oj t3B0 X;ڸZUk[,oҏazHȦAGZS?~5XLj[s\@ Z,<LE<|+É$iۘ6@,6a,; @c2t1ƔH7lQ,(S,AbLJk89 L#̳"8´{yɉ8+I =#,H72L5caEg34Km;a,uYoT#2)cų%K+u1H"Gk! B=J|(T”=Q{;>4H" ?DxEUXci郺ܤ5݄:?+NdrAJb1J6ah{3+;<9~xjL_;Կ#!!0H09L#$eҔd)ՓܜDG$PI{֫S:dΰ|RE4׶.m(BJ #,>a;⏖T  &\li ӏݩ,' ʡAG4GǃtXsTL5TTiLѕ)1qA$() J mMSQyt=#3&3ZɨZ hؑZNI\\kN \޻4TS$ӟ1xۣ:9۹eJ SQbWƒJO \ܽQA'G]J J-A UY"O-$ Qe $}]㿪#/24/tUB)HoJ9͠7҈#=*Nތ)ٵ^4jV@ޖ@J\Ll9VpWX5U΢|_qm߲Kʟ44s=lsHOSLHX+И.꬧dxЍGvEP `Pa-P]TLULr8YحaS ԰ʺ!M]?{.ݹ2#C?"_ ipc?k9;.ᗨR1CTI/]Ť5=m+cd9O6-Ӣ  3@AN9L,Id&_̞ݿ7F P3IL!DP%]ON[G{Vý<4CJTW.h jU3Ĵ#E[`^tr,^f^cNDMET$l_Q ؖp ^oе ָ6mc%W=<ˡB:!1!hWY޼KAhLFA<PTeB-q`T` awL8LXLhEYmۓa&0ʸ͙K9E۾4BpI?1 5P 5*d=cZbE|]iijR`lf-qd?:^[`]Sb'F8ϋ1"g;Wh.ݎFd&]STQwi!ڸ`_+v[ Fi C::Xt` XaNjbn-Q9g~dZimfvNjlffnHnQ JnT _;kR7–_7ɘ7V`^~%cQa~"؉` n9# %]/NNB:[cI]nE." d/&hr <+gJ @X,b'jb$0mm1+p[kw,#n?l!rvpq+؟!מf<5*pʋwigh> <=J}tlJ_l3>]ltYCS5nb|P7a>U (E'FW<.ѡ ھ>fNDsqlj&fkQg XlnQDKj.mf%Ϭêlʮ6lp]+ GR=vjvkv+W %ɋ0лX`N5Cn"W4=XpqM ѐs"=si>E٘Bh务)5(nF_tEgkxi,,D  I+;#j7y@uW_6njWdF@|OvA&a?6uIys!2CrTjPG[9JCSz>j3?Vs?fŒPpfm@h&~{/e&$V:&&0+(Y&5aޠ[j|S3b*F$P{jfYm-dToW7}V/nZN5`__'yNvr/"gdgw!/͈+@&@7>~?ACFz #u7cKVw7i.USX4mp1G  "<0!ÅBT5GbHƍ9NxԭxБI[l)%MnsΞ9c„yM5 MtҦL:MBM#bV~%bزdϚ-ڵdݲeܹ2Bq/߾d4Eތ9ŎCWG:Ixsca=XNG"5ά:iSVb1)lti{۾p޶݂y^К'NTsD}Վ93&,>/ˣ?ќ _}/,~~gb%hq5IM_`A虄4^~ zw I0OQ)NAT'-b3RN9dKi#X?^uWDZأG-[=]r5ZҩV`]E9^6x Xw|V' vYs&`>!"Zs]sBt 6n/oWYwe7rXٝyZTݭ:i񚟯}Jj"E5{QdQ$^1;jKU.mr'FQN\,/HcAƛSz̡ HN?J>BdhdV]e]yف a{F'hpr|UU Bkȝ(gѳ*)E$@rr4āک=ݨ`[R, F2//k[ Xc+[G ^i蠆}#H)#`I&9p.,nUnOS{!|1TypV7@{+Yy/9'#ߧGCiSMiqyVV=b]j)=Bi'k]rfE Jf5*۷tϏjO3MAktu5jj>{AG稤_cY‡="ϓX,90Ys\Xl6.Z̓!\O{gELŠ+ 2Jj *OV&0BL 6(!F-kK&2(nbk Ȭ`CGtV d2yRV)Lk "' gX.w٢djumMkmի`sbfIra \[&n`-S74‡WCU"Dn&%isgb\9_ze/ӹrΏ+Xw;hX3iHE}|g]r wR_m)bb쨷b>%Cя$3`F3P W&QQыZIxܨF;э3 )pN]c>Z<\ڮ8+UrSY: 52Ou[1ii\abY FUxïF)=tI#.@S=谽h=19fDjt甖(ͥ Qh}tθ7Bv5jl✇O.^+WMd&YVdWA[ZъL<F{c=fX4n! fV}aN%VjS.5KǂH؄#A#lvC}*z*-%aT˩G5yjbG^=~k!&u2V}pզs0#^pؼs Y9:tg!P jxfPvQ!VԬO %۲tF45iCцT2UbM#idZcY0mCK+7I)e/4?n[2Rr۶37 kKR_W+P”(//uCN`CQ 9D`0-wU"LK1,qL]$%,ukĩI9MUt_J0vy¢ll{Pj~g;Ro'Ic9MpPc 92HsJi Dkf{R,%)h-*[J%p}\J5'enO43!NB8GY'milW/Ap,N ]j؝RBie.*rRw:>fTv=hڎ# L/S#^vI=prI=ඵXTuVCp+.oW/ [!˂2[\G.ŗ=t5u Nx`2L=uY^)XIdYњbH$؇XAؓMA͉X sVΉ 噅S\\I֕ITAxH]]%M,ט塺qLՒ=)€UyyuDt>D Z(^MĴۨ܆LTaAO]4TDvgҵJem~i03.&Đ)l͡mPD'З$bnY_|٨N8VL s<ѣ Fe<M? A~cA*$hKQ ]ꉢ U%FM |t} CqO_jg,ڨX-?fjiw< xg^ƭZYR E|.{R & #U1;ؖDGkF8hk(K6(&X?Yfx(S>d䁼ZVl]aN~PM=UYe6ڭl's#GHE%w'*=b)52yM pl `$*˗쳆n9K"2>J]PX)\-gT< !ihVutZ-2u-i~j3T5N*%MXMq@,&To%mӾCmtªB^vߦ!M*u+-5vj.E~)YR\Dɔ|F%Q(ƎIҸqJ&l.n>JnFh?e폲j+?*SF¤kRMm(BP`k:>˷@ȚQ!k^ɢW,-/1>)>nvt:!(,vK|dK\ Cm p|4TKmA*eآ I -֘zC]/ں]rQ2}U|oX@zPI"+6k^&򪮲c*KRm`B(yPezkސ -Fbk ӆz&j16cn2Q0e \Aq6_L 4 (Xp呾[*R'["-3ɥ7= z^ԞjՌuf-{,%ǒCөmb(Ah#0!?"m+mr΋uƚ v,E?o)eNI^^pt[>*t3g#!үA Nŧ5Fg M-FdRHUsf͛9w9+PujիYvr瞎 I$پXJ/‰7U˅V<(QqRLا.9G|y-3:T_ܪCqխտ@- \ԫp;LBvA=7M ?Lt6[3ȶbCQFfLJNf4C$ lHl#i|&1IbRE(]ܘ0S2dN=Ԝ͗cZN636QJ4SPOѱ--@RG ξT C@%HT {>o3%ڌV'CMl%4TcݕWԬt&ZmUM-J]Pf=5#P%j[7Z@\>tE;}vD=?~$T ^.5Ԇ M IP̢i[!J\^EIǤǔ}< m|Y9R$UȏkqJ Bfv袱r16P9ѫj Ω4]=Z@ǝ]DF+K!Ë2E㶴R*dZ.,qQW=R4\&OOCEekU%|3=Nqs]XmNT=SHSN:#v$zڵܳiD]zm7/ynqG[{;y E;`%A'XWPq@'a^_C{pS#6[ώ(rZ xalIIR`Tulg݅cP4gyL ΥViy%4Ƶ$ˏ9\؜fNK`2unhK&k@H!a C X?A)s&P-X} `DęCſF{ _ƈuAZ( .) Y0V +Nɜ&_ ߿\Y0p2CḩˉEHmmߍFnB2"xd:9HӚ5[ ~_񧢾zxESuQJCR[TYSS\+4A24M?v8|m Z[ lHJ _>^ԺniQLbQŴCV^]HRl&%jq̎w,ЋGnSCdR5@θUJ?1e&J{ޠ= jxU' j'jUӷddrh@!E&縹' X.8\8또&Ld+YT|T )5 %cj۹:=s!<7ZKsՄ4v) 4; N!VA5_)9*JNG^LuixJG4qX月ƥ,&={9Бz㰵:tL&)Vi lf7ڇ pH]:*Gթu%#y<WK :3@mL0E14O[Z|ar ;8[ERxB3Egl3YE9Ў3/S0[bh0Ӹ+5ծ. ܻȓ!I`<cZw9Z'[XtɄ\Mkf_u#ؽT/IhaȻmhnFt[^-#IX/6/ߘg90C6)ygB/g >WrTCWHǻYǽ.4_|W|?ї_}_}_~W~_P P#P'8P7PI0;KP6pC;0T0h80)PUS1s0W/sMep GPE p] oP / ap p uP P ? 0 PEP P 0 ːqP 3p}1P#0P p'q0 P p S0Y0  95 ?/Qqus [p!gQc0e #Qq1ۑ {Q-1UQIg߰Q q w0Q ;!1 P}P Kq"!k$M)%71?#!p$[O2Q1'mr߱%#gwP(()0)))*R***+R*!!,@$GT$GT$GT$GT$GT(AJ*>F70A>*GC&NG$TG$TG$TG%TF+OC8HC@GDDHHHQHHTGGTGGTGGTGGTGGTGGTGGTGGTGGTNAT_9Th2Tk.Tk+Tk/Tk=TkGTkGTlGTlGTlGTmGTvFTBT?T?T?TBTKTWT\U{dUlkUlkUlkUlkUkkUkkUkkUkkWll_llarmbzl_lYlQlJlBqD}KUUTSK?~8x2s2o9lMlTkTkTkTjQdHV}@IoEImJHlTGlTGkTGkTGkSAcF,M%G$H$H$H$HAHGHGHHHHHLHUHOFM=M1L+K(E%;$($$$$$$$#$!$ !#    <STU"U #U #U##U##U##U##U$#U$#U$$UEEGGGGGGFGAH'P36DLO"3C JM Da ;}0󷚏RqGYwc% U4ACVBhh1ueuVyBv-egTvmyFه^mfUed_$fܴߍSeTNiG>MEC|wFU%UDUc^P^agvwQX`vjpf[I .=gP-EVmf[(Mru[ORS\^U;5UPf}ZCNVYUuD:xO&RwզLmVSgo^`&fL0pGSY9F0KLJԘj{Y~qomD\|`!+&̜1(,]fTHnF W# T}ؕN x_J{͇I4_f/̎9z-VmN4gK&eRk]S- ǸYg1h0| 3OqrgY⯻e|o鷁:)֝gjT&,ivq):Nx=}G9*qtQ҆wՅQpդ]4u:!RTInUZYYe5kU[-.kS-OHfXz틵F*+~O̴3̬X0qKeEcUjb/πRY vl5NJ} ԩN .a@0:=iMktAOu*—t \7Y~ԲE IL,&C09f!-BB+Z2'-\'"҂İKRSN.+R*SŨF4r5v3L@aF% d, K}W" ]5*N$;QЏ@@:p6JJ`Od'`4@.؁T]f.N(O;Ћ%%aPw#'& RĒF+K+!0Vpc 9l,!>ZF,Wmv8So)]B#)DZ$OiN0\Ra\L)&lHI^i~KV$奘dyMBtROtbRBIʬa$D*,G8q3Gƒz&n JLRn#vB!f isdtWy(>$䲤خqZ'9G?V^fDXE35lV2YWXNRO sXն$' (=q+P<ڋE _U2LdNØ3[+QF[z-I' tZH}_`i}9PxٗTT @p$> agCJCjE# * AKtJ4ZX,Y3o*%ѥc xټwKsj&sȘ$%;*L>'AFgmc#7Qgz6L2^W~ꕮY/z=l&+vB!/"1hRH!XiCZ!DPԦv'N$mlC2֗4lVTTdkK|/-0>T}lu#U|%fJR}2yrtʩP^ -HXsL\Iɐ*m]YQ  uRႧرc,jGcZ, ?%mX@*A ~c/Xjs3yM\j=|}j+Yi[N±lO Ldy}Is  "Spܼ'҆oyqOQK6 (45px'@[&P.,/az/nb\ ],29]p&. R&~Tƫg1Bw)'=}M,[~O..wL Z8#ǞrS=8nBc}/RL؎v$+&a*n[+#>% IL,^4Y0fXc'5jNo/Y̹qQ>ZU l6-t,,!R,p G $)*I_fGB6gz55J!egXHVgt.JJ Bė'^{qPRi4vl"v,piI!wmGZxjqaN2E<HGqV~*}LNh!Ok:b!.Bl!6dVA0P 0(lЀ0R.0f5EX{7نIAPdx%;Dg5Djq 3t i3#&j@x Q tgUQo|fa‚p4%8vb bqf~̸J'44Dt U&ætx"fVlpC ^Ef0 hȇ,Hq0YuYX2XE(4_4gt ]!uR a4Xjb=P":=8l@ XiC3%[@qQ%Z;IzÕK{xN@!LMI qK@sd_yG-K<iQVxbyxXj)lfEt#qhq7*zՅOif]@uA+\N1)B%4p 10|ȱ j 7 vx"p0Y\zh21t ᤿(Dm!R(Rq!p!e]!5R4 fgA_A(ؑ'5|́X0:X` yjWP egBTI'C0kd7\HtQ)A?GU1 p Ԑ3j 0|>i2(Kg=yf:‹+yx.U آ4@ Q "s<+Xu)/U9dWJy oQMrۧ jNڶ<%-vl :;@i7€vvr[Am @\QSM( 02 Ţ \m0N4^d,VkFA&(԰h ,` A8M+o9(eV{VEPD!c(Al@*RQT<Ej0QnWB`VȞFy#ph~zNqK %gVP$ո#)@ h'H )t1=C%+qS q # <żvԠp iW'!'*K'9 YyÜfmDT۹c;P@kQ0f1GIKp@*!6bsMlqTaϹ J!HiHi/ 1: |:z jJ s64r-Sqt{vK@+ ܀P!1m(70X(W#$6a&}d7]kNA.ܚفl4! (Ā!`rXl\ x@ܠ--=lD `5KTuCdBVB ;:y\A{,۟}yK)(zB` |𧘩Y~ӛj0WJʭcV\Le*M-ZS+! .E v \Ŝv.u{ ] .!9t#Zu7@57xs2$C0&ڮ-JjX,?G p ~O6hA- rr;RvLqX fR "/4q{''z<y{tD }IщvIvH Lm/eNq6AX[!%X B2?ȼFΰ<itAâR2$;/cDδUh< K|JJ,C3\7&j{ȉm]=C.wZs98crAP@f^ʫG v`:wBֽȰn-Aq:9 ɛ,t!|Ւx rA@g 8}| ( YvSYFꐀXMc#6 (lS U)]'7Dc! RdQ1Ggdhڑ '/FB?$HcRd?(8[10uEr/\91fv9ThYh]܃`}E0 7GB^>W˓GRbGp6%SBrSHywv{عKjlXSs⣋i}K(_ L(h O*.U!F)$"*mVȒ,Y"Ȭ=w)xK|L/ΒяXqKD $VX4PИB9 &LDw) jɣOLDR¿ 7K&ONI09ٙRA<@@˄MN+ (&#˜ie-l,=jGA$N*}ZDE#0 (n5Vgdjbf+,azUХENQH m͚QIi)Hpy-|4h(B8g1Bѩ?\{ЮPB>&ٳ$a)Z1~ďB;]o9X_=5>tXΪ/@IX #ˡ¦u6 !ZՎ"oq[(!BAYF:Wp!`l4ɊQ7JOQ^8>=ۖ˓#0P%6^a*/ 俰oP1 gŴVDkK>>˸BǤ 4#T&mႄ^Ͽš::¾=2ꬶ >ئlJ ᤶnֈ\\=R@C!*<"$qM hQCr$QzQ͉XVxQzLP2E9vZPCZ*))eA81#l,*ݣ:jJg,*>sg~`D}{ѣWh}dJ= RMׅIL/zT0RavdZZ#0d9 $WʰAI 1A "Bn#DH< A"8q[ &N(=0A G$ ~r|0%!!EcA LJvԊD\QhX!uegs'KR2,)K łB5tG?4x3tFPX>F=,ʄ4̓T`׊GDX7M!u[!~] Wb.(0yUVr"0@J[4 K$ɜO҇~Iv3i**p8)AMHҎ`,bUdG^(HsyPdJ_D'|ݮ&`|RҘy^ @@JtBMV*U^ .]zRSָ'7C, n8b1IuxU)I0h-ʐ6~h'KNC5m;њ dEa9ILVP_@I2CEPOL(SP ɔQAe_y'8ŖbdTr#79B$sJ0A*=60 .r7$My#k|*xwZ4 2fą_C:%ߜ/Hv5R" /&-r$lvԌI&\0!@ E(M/TAzDYJ1ϿK߯"iH<SIs3:r*oQjL!GFp۠lSr)Aw521a%-0=Bqb27 !ʩ,E5jP-eH~鋍(G=G*6=C"GxR,Q7Άi bOE#QC=f6fkvŎVwWzEٕRJo dܸysu㣼(YȬ Ϧ!kjSiW(Ϳ. ,VmFs,; -2)@.8 2;򺳵8YL9sI@`  ⻈;;D l2;K'ȃ<";ܦ1 ZAh+G3$;ZŚ>A{~5I@ws) Tk` bcQ<_` XIZD=A@A!0Œ渍/OƁJ X+ʼnăމDJ& p"(D?~⑐qJF[iP uV`HK3c)"95x6k+йCQ7d﫰vr53a ;i%#.\)< CSS L&A@;#8l0 #6L I®898Ҝ&+px:8s{,L s !+4'"{>ϋ.@F֠*uf`FŪ+ #$}J8"(]VܯR+ٮqib.iy)3po5F J=?<+%3 Nq@b0p? 0x#DŽ~8\0EA | ; шLP݈[&hAq'z+(; ыӂ^POC HºPKO I0 <*Oz0< /6D&~3$) :(qB8҇X.b ]<3X Ivd A4!y)㸒8,+p/(~|,̕xntW4d@!%ؠv(117T-+ j9?ѓlS ;N_ GH!N t<,UE׸K0ө%klit| W̋"'!MJT.AIJp٨P0@T;>?x+z?у>X ݜB*/ 0PnXSHR #%!0 ɛ#r y$ɘ XP&3LwO)'- xr?qG9ųi6R̕9Y+'-7ݸ)Y^A;E7D`T8H97%\0E Y|'Uekݼ^;n`^JEҝq OȤX LB >*Fָ%( [ ݵUWa;''BKAN$ 4 +ܡիEtQGr>DM^՛ uʆW_\]$l \2ɜ\R^8[_9 lpz = o?xz95$LAY>cJr]A%0:rQNQ8ۢQ2 (1~J\8RY=̊^p$F2]/ᨃ0x:8ˇ Bs0V H+s 50[M7ɂ:%A*4m[4J"̍3Lz=Pd`?퇷"zXJ䴂GI6 IS:j\.^.Q0,UP?ߩ$403 aYq?> c b~JtEƛq+Ib)Mۣ%g 5 qx|Z:L^D/:'7%h1gz ;>6?<c b̕8_F+d~ 1s8l~(L=i(H~c \iS.D"+aթi' < ,Af-u(P.@"["}ݬiaђB0I3ɱ^3쑽/n :10 a;JF={*kTb*QSfGx@N*NڙQa5Sa_ @2>\8x H6isT6i\TzQPߦ/F6~փszQ`4._\}$X$̅gDL Ӽt4\-jм#vd]f XQw%A9Xѕ*@=/!Qh-gc g0(54_̢RʫSӘ!e5*p[ @0vA0>bA`mT~؏~XNsi~)M  aDf 6k hS\A6^+s75: X1f3Y tCCs]  3 fsٱ6&A(NYM9*bՁrŞJ[8^3J)}`Rh^s*9<8J^V->H.dփ#Gfk/d]8NGdE&em?h\V0\٠>^0M5:FS}:oSxg x> $a}P/r¨/ZM;#HBL=T,?upiD|a# xr#fgiE.oM+o*Hq@LܩO8"~m?^8u)oBlPܬt|dTP (}@QlJM 8 YE2(/u+e*V*.__gA?^yy h5Y9:&"-<;׾zHL#(zzL^k;>}޽p"{\luۘLg;R9Vm[to#aW4hLMM#2D!s#^ZBC 'XÈ=Eha1n\,DKa+n긵c(zF.8P4&H`gCQ{:eKaJhVa`ic,f®"j'1g1҅H!\5'e*_LzK#ĉSK^521S-hw<:Xf'©xNQe3=9Q&t;!䝈q;fHٱiРc%ԫ)R3ǫQHꓣ1(3:^ؑ1R%ÜU򏅂$[$DA5]08pQxN%8+YH C7ٵz=XriQAU)~wXDik1̅lAeH8ZMDT=5eEUScL-LC\I'cUXISE'ʅ0Z%9IkizMC)]t hA8G0OWRB i&N%YU):*c V6cpyҩC -eh,ld;sc{UEPDSIJ꧟YeIQ/ӎgG yJLNLT%P&$՟IlđLqZ}=̜U"lbx٠9oMpFBYbY,u['Jՙ XYvu1m-7[A]Ў u& @<&*?tS>Wucubp퐖hВw3 YQ\Tv)gi:o=l lL9A:7;f;2.TQ7_0G*%)(O/!%sH(D䁏S*HqMK 'q&$H%)(׶ŒgݣZ WH/FdrW sEP4%& J%JjpOj&9"ֻ޵DOIrlK<ȰrLwJ$t%(JLزm>zS׸eyۡV=EE&bVcHD"h=m!F};< R3+\eqKȀ1*+Yi#KզD{;O^6[Dϕ4PҪnSlXnƙBQlT͒0Җi㯖fpluS".i)^/F(Htњi ( e-xU!1r̍! Gc0o"(@Yz0ZFhڌ.=!-Q4Kp;ܳT!@]`\-3'RfZQPT-7,%-< rYy3<>hN䞨hU8BfFw#-:byB-IkԔ蹋{;[Ds-]S"FP~xCʣFQz\ϦY [E^ANQпܞB(q7r Kb@ifu;5=;QxX,mjȹrgCkcfo'Wgs!9T T;,>/bbE%!v/ 4]iP ffNpFq(}6O iy0Vs`Ӓm D7ӓLOk4Ek~M#z'Q IӁe3 u-Ix n& }Y{T4y%m LhTZsdSt$mK$ܗ9EH\H-] fDB}RxQ AĎœ`,;^eJNMFFiJR$:oC9WKNGMWEXpa TD$TBb`L'KQXΑLѲ-(QpG~HLdžK>^< OZAKMΡAR)SDJ@/͋$]Rl!Hb]q+ɇYl)G2~VŽgY^$ dYF5C _L4Ϙx=_P] [$_uRѴQЗE^sJpܕ/=dYՉ& GoB` QTXP΍^]I rT$ M E >J@pFͤ*"S>QQ58p0>d\=!$F#iH~L\n9yF%$qpWOa_,ЄQp^-`b̥AWE)RRM sj"IXyLiI-p#FpyFF0jdO*h^żpDK`+r̄+-ȂI !$h'DF\_p]DzpVZd8jV_Ɋ `(рRra~,,`,1cf%ӐrЁ$.eAN-CFKLE]_Bh1\8驉9)S|!$$B-Qgdзt ǪIF| ƌ<꣞ge\9潪pfLJowjS\:֌`@h%gvKhD*ϼHtE╋{5Dо@Y}fn,h Ȓy:T*gmk2 ֚pF^?R96ɉ&La"lv6YZDReacV~)Օ$:QU;LrTSFyX \HIU. AxMJNY'ÝD<=FZYt϶ K Xb 5a]OTd!D~5&pc=| tTU]). I¦fm>L~-*`n2 Ȟh qVqstNTq N]ʵ1k*%ʡ0PNSŸrX LPė`MO0$ !0fL Z Ovٌe- NKoa>Ԥp]ٳ =fDX17Nl QY]q&GWW2~؆lKh>ry.# UmMޚ6{FU Kf{`LH$Z;R8f\LX3h#o m~zR+BzrRE«S/.*&.Eb5U^d f+/dLf1f?3vhS]P OHJe,Jl=p6xЄLTc N7X*mF iԈ\ }I!XuϪ6TB |GgGwtchg^}L6G/ 3G3HWG´/*Ohѿ\)Wi,iWjUQϪGψŅ92Z`5YQ8P)^X `i6VA: uQ.(*bR*m;Dfy蕌Fw dOd`EbP+p.N8c ^629b@h[љlWiHFZg ά> L 1 >??|8\!rebVfBɥ_yhb~rɢ[U!Bpnq*-s& +u=dM6"87Ȱ{ՋC=YNw˚(RKqF+suYnj R Xx;+syU#Nz I/.2ˈ57TvE;eW!Ɨ6llX0 ?(^*N^jg6gov"b~vy i,rt9Hk(11&AU,YqzxDǛ eɌ0('}uO!2ӟTnd 5*m`Rs0dغK ;0dž`{'>AyGC:NN>"ŭYDb$q<CNyU"|MXk2F"$Y{#~#k'+ΘC27Frdxc_npdX`5f˔x JnJ$D1bD97zƭ*IXf:p!flb @LI˄Z< 4DCz9B5`:/>MBD^#1ZnXO|J H̵D5TT22=D*Mņ/LNAzqAKFX&Rt1zJgv.(LЬrCQթ;+7d&*#02ϸޘUa--涪hOK{䯱B4(B]) Wgs-{9ȻCEhJZ{*,. Q 뚿m6Ho mV5J{r2kDVCG D:^ 5l)y4Ea~ƞ]*L Q] {˯AWw . cBxBe s?@>6FrfMŴtnd\ŮäT>% gP>s(742D]Q'JqGb(Z>@\~6vCϨJȔ.cI*I*RK&6Uni]Xtsb1W9_朅P=pyK]Ƽ5Ѫh, C6\_AeUٙL 604b - y bn(3iŜ.P65:H[v֚B;nRAOdURoDOH2Լ,gM=hV~ЭbcC@ԡI.c2"% Di#sh>#eL.o46,G".. <2L=H@D]h`Y18{(ȕ4  HE0aMNƑ֢ϊ6rgU|/j#ThO6hBƒ!ԎԜoZ,PB"&^+E)6־8/B\QLzFlRڌ,,mZ!oJ" G?MvK-*eDC( s|ǍlQ)ԋ忦(!C*"m"0X"za5(K¢H#;R20E@δ'r"?<"_(╊" d"2.D-c6{X3C"G˨Ex9J J b'|0xTFaB+0.(j10Č떐gJ`|.R?ށ,B LBEzJ8!oh-v k-_bKQHl /+ ^Bdr%va"3U~D$3ִ+mC "' /4Dxb\I.W<31͹ds?ܸ QKSBO8?g( Vhji/"$Yj޶ԠJ;km,IQ.R [4 FJ2?.")>,1(3|^i?5"%MV D.G.B5F,v@Cs}0<(CI+bD!DƣDQ N c\ /D'AdiN.iE%s HUd!N0Hm`&KHpt$ % йaGS/ S22;H".$q""6'BR-b(~4 '{bZ2J&Q7bsRk6A TQSweu"ŦVF\XąaY~cf ˿;͉9z ~ R=γB%7>1pvQ$Ӊru}m"#~D꾄@ZZ1C.>.C}'544RA(UroL`r̠r|=\4*J=R2#3-*G% b[0%l=gf;¶tR2LM{!xBTgՉ(#!#| 2`dpC4Bk\^smks.um+me<&V$3TpzέOo`f% k9|fuV#;d( '"I4<7=F0Q 'Q&M4""5=D>ޡ։R3 #[%;\ib"ФN @=q pZ 3ĀrCDCurCC3v (( E|Y4)LA*uAr c}4:qTdEvEXIVJ-(悚fkgWKq(IxlӖhm%+(F M' cӦ>S S]ν.(M# |6uv8/1!RmRxقX7Q@*8ۦh)Ćr–~4p,7&r _]p74BH,;/m5a7/#uԘA&H7{oYFB"Hn%ڮk஠ًyu{{H2tu0Vk &9##"LYzT.dlNWx'j93ׇ?cNEH?ed4Lו5{vC;tu7L}}|NA2͐ޘ9,r:HJJt gmM%oKѬ4JX*7Xɢo{G"tX< Nu"ԥm/;E%h}S1ڣ'5uL7oWPY_.D:S͌ʧ)ZyvWXE%Y%N Irtg<$]D?15ب*]De N%e?BhH}U q|v%.y<_}ܯedJD]|SԈ {˸FMvͩnZeYt汾KFm.M$P[/_Kɹ\u<̶m3Sw74# _u+s>B>Z.R/VR۶!4AiODݼUd_o鲋Bmj ҏ;:G#̞(4dçt\tj!U{:`wuY_7]sΖ"D2SI|l k]s3I o\^]Zhr { Eْ)Y}Z1j׻;,V峣$lFԼ g*E$]6%}#,A1 }@M?=%i܃CzR;~1,guzTG58U;)RTxK-0q|brcCh<&N/xXsc(rHZ=7:(~" ]YRCɴ%Vǒ*;)1pմQz%0Un'5=yp`8ҪW+ "e(fQFiteȏAvdL-4"1^ܘ)Y/ahpJxr*TZ+5lz,WHN86ڳGÞ+JܢE[Aq(eW۵ &3u1s qMlʜ3W\]fѡ?ٱ݋DΎz5RC+ӱOvo*N!f!7~N靫og=;Ix87u dۭ=֯?#՗'R x` >`VX!iHeTNjg1Ym5xbj.R[tq#A @%B5&@Dp^K500VMD›P^>\a2ӗ֘mc?bМvֹc:sO/,e4:0F*$Kh"N i~4E&KJFNՁN`[UUZ֬cv^ixy&j[R!kaU!aˆkdRf9  ڵemtӦ\ȽCTMoI4Pq-Q[\/ \iimuQw Lg ?bS^w{w_|'[g\ Z_M$o/HX+l3.b!L,hC33Y$&-4N"H[БDBBmdA vc[\;i f05Q,7 nQ+>AÜD)9P8ixfczju| T+L+v34J>0)I/I곈%i!WK~W_D#UYEUVfUwTy5R?lPG-CZܭ]襴v#rwSli4k!e "ЉP{!&z&}4Xv RF"M82c#k>VAml%)d ButC &/V`t7(S ģ)(*b;9i0Z0# H׾HYHޱEA~PvRIt Q&PxnD̛O )؅'l;#7qZ Ҝxt'1JOvw~#1XŒtr))RHTMd# vRӑ%,5@*G8Y׺ j"9[`|xZ,QJL&&%:lȽ)ƈ0h54 _r$vfI֞pc'!b3,`8EAc X2q(u4$k ebFIUL`-$ z*y]Z`I/j{ y(Xlŋ)xg xr779XIeŸ} AeoAfg(ABud!(+Z\WLuB,vRRO2ctvLqTMha\53,ilShd(0Q&-q)ɚ"G$L^!DŽtY1XCwe-AyjlAE@H0]2d F@ 2ⓁXRp6aYYLp9.!v,8p<5!wT8$S&d;:a[qyt~UP~gs55t>zqA:G9'WvXSo TrD(:R'uGu|Zp%գiuLLiׂXVƓ >9_@6)Db>Ț?ؐYC8x"9c. k9յ>BwdWAWiAלƝ#2xR蒈 +gw 4@s$E45T9eVpXa):ʈxR8yDCGHHzaŤN5U4wأCJ~5~? Y!qa# ؍ߘJRgVZyDx9v[Ah"0hgQ 0bl P%A >@3Yx֒_lE f(NM{kQA^1{n&t؟e+> ڡKsNɫ7p: Ȃh bZaۃ8~uDdfxIɤ0jV2j6^6eU|ӣB깜)p(hT>Ҙ1 |LtRP9)Z"6m&yyKlAѾ!ܧ9$`>Y`n` Bo B!TK5w0 ؓrODb׷YB#oEe h>x ) " C?j-1H׌ |srPq  FZXz$-c4ER6[tgIruH[4[ggo<Ʈukڦl<+4Hu ";\t)>q4@,"S6+Q,SʜG-51N"mI[9LQBCT̚$ >0X*;@u?^k 1w1J7I{R4pb@ƚx[2x%oU5&~;w'As\ebEAAfnF49'H+V֢UH1sH$[RJ[ZUZ2 ~^2<ƻb}Nu &C;A1ߖGpŨ>P0Fn ːʽ'iAytNIdFYjX}HRbSRSmR#̬w؜DʫvH95etk6)z8ҸO|{;. d8ϛ FL eP,ubm !(Idt+ɍ%D gKZdJX۴kXG+zg lǶZ&ǽ {ҿ+e4#@U_ѳc{ʟӕl-!4S恾]aՒ_RPAmhyRi,Qj 6u^zB\vC.IzErU"'>AD1 7'BKٓsI"*;y9 H2IK ͣ '% [/\ 6hyf]ż[gd%1Wղ6$%:@#ƚ"6e(ĝ iݰ}i nn![L$[8wV-{Jy8{dlIkfߪlޫߧq0鵶Lnw.^̯ .UU_&q J(t6$U47SgR':ïPY3-yJQ{:y6vz-`H71qZdKh<ɛ[&b %Ot7q]x3B+l>j̒-翎>KyP=sR7ZdYn{r O֊i%nMlR_,Y|u&6Ɲ%`}DWjE=Ƶs aDf̠qG x#GQTiǖ;$(^ة&mMQfp'OzJjըV^JjXYݪU Φ]Z&;7]j 7^l% &.a{7m]Ȏ%u 2ˏ۳{F7ZiHcƺaCR"۱1ntiߥ *,8.$OK,}Zߣ%5R~|'?b!Njq+9ߕilLl!BzlL`4+-R$mkLֿ" ;T2r6?@X?ݫW';0R̜uQO|=Ov֢ΘMv|_eOޅ.]y[qg/bi2`t}cc'?cO*e 6VrF!Nb@ݨf5K v3- I:5$pN($(r&NKTҞqmoz(dK4ylV}'A(}+QpGH@"WD)Ā1/u>RYn1dc+qV69cBPOE,hX l@,6³X+njw0V%L2:B%Ah\oC-S1z,ϑK̈W,Omn4̗ /e1E~ f0-yld$ ɤij^Sޘ*3r TiNąv7B7q ҦH) 3镪–fR^pHU [~*m%u=YM<{VCPQT2QG:#Ʊq3lʙJ"9X1rtUHǡ&0\a*ZޖKigT.ӓiݢ #EgFlRa*Amnܛ>KNpeOLI~ oc3)qC0vpw!_XJKG-{Ȧw!۾-8Ȓd-d&fg drñ_Oi\o0 mYJB|~Brr޳*eyۤ7gwZ3-ud4}ȫL6mCr<拜Ow_.pdZe[Vz?]d"r"xy,pxm<}!H iM_E.ǧnJYӅӕHˠ/=H[i]&Z_/S.ͣrLO~A]8os}Lɨ5+ˣ X6P1ՠm7W%< j :F):t4Q?5j)2z8):Y#30>?c |ðA8á "<'KmFkBX@)&أȷ 4b(y>S1ap B(f(@ê)D.GR&>$v|y܈y|'`e-M.3HC$k{YCQ3p?ʡ?[Gl!ǦFc5|`R&qA1˫桫@pjAlc| ړ >px X\K+) 8ʛer8iʫl d$ +G.CI+Gi#>]~q"wL< ' M = /y4쮍.kM#1yl@[FDA8=K:"A3?K0 <*I*J:L\̯ 0׫YsB#22OJc|Ed Gc(ѱLˍh>%ıB˻f:WFNk̺}aB+jBLo, ƕQBnⲮ(SLb83Q .lz=߸--'=3M I9YOQ/,{%LH>3tHTIR??I.ɞɞ$Kt56]*?ccEdk6k@;\ěyy{sGMTj'( :KˊPLU &4NǬ LW 'LR?3 =^Ue\ {a\64D+HD8GtDUDSD 0%B̲6!KӴQ1;1yQO[ȎbOMSOϪ<'"ީ6 <eK\;$FUM F )=&KDKQiِԌ#% -,UQ-ȟ  _ٴя:mo:٢[R'eҭRU?<4N[458-mδ/58'9)i[r6źpɡ :䕨$ԅX>*YT>Tӆ X`J}\:YdXdTd+zkt[hP]]!w)U-٥-W-C{N]6z߱ ]/'ѕ@֟5({LbEaMB( L[󣙮 +>)BIsλ |W?tmL-צZW7eS㙷yRa/y ڪWA ԪLlZ$zܓ [۶mU E}۝mRL*s.Wb{gIA VY@C;Dɳݼ>qZk}R$㔊-RVET,-[ɵc2O5sc5K4IP*G`$\L 1Sl WzAJ 4 |% vC/X.cKTMP@][^NVƠ)p=,չ'.@,>T= xBʷ!2aqEB&s| (M3\-mpV1$WTX5[3ᏽ{e#KWME=цd\K h˷hqa@6`Cav7#]-#[U$RDd=Ze QWLUM3aMj>^C:ľIȔ !4#M/>^21vc4ȹnN3'9)RRҼx?Wx:2.U!c[m8 K>:]fΈϮ|ڰQ ? UP1~ռž<ӵi=E<|dr~#D]9`:Ҥ9CıV [%٭-e z&ԓVLc6_DP9p/򄳈?Vu/j왎,P_6p>DCJ((q(,)+[] /n0]ePqs$."gc飮Y%&˗s2**'ɘ4IyJB,ܪ5Gc6>vs+8, W;pI24l囼57uYlpl2 DCZ!=9R{<~)Q{őR1x#Q<ЬߎgsY6eha-riD-dn_n6a.bSyoNh0Z#<-$enggĴEpu 9@sup5Uxŵ(_8[{gѥYZ(;`x}훳Pm[ĎD{/Ͷ`wFxCm [x$e`\6~ᓤ(UjD#hwGݤa~Ճwnh>gyb߲ '~}݅^ x4>djy"B(f[jM4?3&w]NO OퟩwVӐypDG*'j{b/h@47(9^ [4zE%L!^:L(!X-ZdV> )r(-)K)s&͏&4A'ϝ>{)4(ѡBoEs:BhϨObz3M j 2GLa8ߢ}U.ݹvkּxuNhԯ^+čpa[A@3ΞRvVO=mZ!R+4rc۶M3mopyr͟w]>!yr18Wu[Vr̭NN@y#)|Zb58L/_=6GIh}B'di0-AFUb5b$Hx։a։ńH/(R|AFQ>UHW%%dHE4H 6UYnq֥^b&]y0PCGo{8!OT"YM-Vqe҅qQw]v^ YަHO^+S(D^#q2VJl*zBEʖ^K"[̺IL)+yK*.Q9a5}E)@$Lo9fb.\f[yׯ~)\VZVgXKo%JgCFV~Y2oPw:eЛ8%:|ms%wz9ksݍg]NNNrZ`8n]y\FMcbw}{" fYouG[VX,( zTɊC!)}8W})Q %5kppY /ܺv䛕z J@%ϾyZSHmi裁Il|<|vZu|**W j\<-SLzϷ hϪYXOj 5KP[25Z.1\bTp` d#&wA:عY)I9Sn¬_(tr2tp҉P~\qd5XS]쵓z$_lF5 ˪8 ΊƬBKQՓ˾0Qn+ OF7TAǴ)wtxC5_BT[!6 %doHŧmlP!k(Qy+ pH(%Ҕ r8I&ĉB9/}KKtNMUĨ-v$Lng&I}Wrg)ViunuJHY: ;Rޕ ]˪(N@rj18\2͏PXs4RȂھ"4`rB#qj6MmRd P4/-.PKюq'e؟|̯r>#D'qIً:6M)EmReVIkZ §D+eLM`z_nP17G^gcS}t_fl>v%DjX NE4˱err1SXIVv8ZkZх@.yⓓ(Mq;6wk'L t*Y4J߇5QA;肄$MI~=ƷJå='HҮLcIA0z W8b Җas3hZ6d4AaJ2Q<\'Qi֔6{X`Q'x^j':sX7 ѷRQ_78ljxRx"m:$lR nwfq=ù3~r[iD6u+ kC}wÅ&eZsNd} ,N㸇C'_yV9DEyB!yPS߂aRJRM ]n qiںqFgԚ4ўiA~o^ORRݱ b` 6S˛ h$YtOIEm  ۛDE!uBȊ\ ֞ UQH ,R|4"牚#_ajN`㐚k!Y] ] b5 18^D^aLR%^Npޘ)IEI b=Z]IE*N+ം{Iᛍ^؁BlżW~ELTVM α(!c}Xƍ( a8:7~#M2R,#BbݝLi FpuZ0-aKЍdK 5b10Ud !];Ţ8Q$C~XL \CEb0N)UPM^9ߑ8fI `L2Űݵ :NVRZi^E-ک!+;2ǹeXe i Х,`&ᡁbTb_Ib>Ia^_67bq_:mqědR!E8`5 b T ݮD2$ 0%UBa_dl~y$##$p"D.^݁o=^ * ECtF0Ɏ%NN]gc "_6 b|QG2FRLx!_8t$b`Dpϯ- 翥+%=aօ"HMjV_ldUDA\$#^o6m% AϣirA&'XNNq)cQ"fs'7JI}A'xLr QŚPlycߜfij;=V`0{($B'AmU>I NIF^X C)tb 2VՔ~E`` yJbf\FV`f|d[/Nffk R FȬѬ*"FȄڃHe+))NʈIfohpB"4hp&zZJWv%gRZD]vh)%[RuRr^smQiP.*fP+jJF٘# R #2bMNZ4A+ʦY,fbb Kɝ&1*4xݬ9ib-ZΣ(4gȶU 򥭶{qЫ*UwPZ]FI {`֔Wi -l5n 2: vи,ݑaf_O,Ak&iWn| U(`HpeZni9hi.ӒM`c=VJGj䇉x*К*l>F2w r^`zQ,GsjGcfJvߕm,V FiMp.٩&mPM\2J**784]b ?NdXK6)V#۞0ܶb-n,RwΦ-m6{T BVXȊ y.~I  jOso{JR_cMƮ|+ey eqn.tǍ[`gm}j9ԉµ Цbrf_ e3Se1Di%Kkg U12%^kNVjGhbMFלDl}ZyASJp"vl5G(5+hJ@l#w-^ &{-͘E aF ?0.*0r^b$O.*kd [ttFS.[eh'`fY:EIKl$DI jM#Bi$\ Y5!S'чwoಪy+9\yw\yњƶ9 huHcnD9KHZf7L74geNJU1^9Fk#ƉZT11̓o[(vvB78S Ǯ&h (;8./S0a}m;v͊ 3Vpk3.gw^ yijG&ABYy5Q8w?vM]*Y3;M7cZ?_gZ.iiVc~7>H!:!߱7іj]5'ejzr!SRF܆ _ڵEAd6w t/{wo,Bz]M܄lc_?©៼ҹ#iN3yy4f ne풣+}c)?xƴwM-v%,Bw˽)d@-B%>NPtVzgy&>|IrO,ZpB -T?BOQCebmX3Ħ/lnTSZ42VCKUG,lJJk\-#u^y5fW:,n*KM}:87OJl>j_qUYoYD6;AutPPzJ{_z5`7Pة#uY?,X[E2g6SvH7XESS~r`(K%)ؘ}YfD(vf}Fs93ρ#]u_vtW~{?Ɨys` *y ? HpXb®");|R?V#N_D Ve1n/ŵW~~ ˓M!e6%f_8g5{C[ݵfhvvRSZ5uPkd#<6JP`6Ao1^yzt!c:boh= oDJf84bҤr5 ^Wbh vBUFAP;D@m.s[I;YtѮW۠ CwNHDǡًU;opyσ1إ4֩e)?X򕹔W\#̰X,Ә,h-phh9&tDe?LK$]ʑ6R3o:WCN(Ǹ鱜fgD%zȺYUdp|IO :k65q-NJ2G? ( &?g 4 Su~L)%v^O{; x<:')I1U3ϩ$C o@QDQC"#?YJE@'s-z>i.QԈHD_>:ndtij\J{B4sf(ANvf6'Ak+bО(ӄT" *k'fڞHeX[`jlV"EH[GdhA9TI> I}MEF!hMLIS8nX)YNiv{)kj_`8>uP:h-(|Ȣ /`P=񮲑BW)*h,;,6Jۜ^b2!2J%] c%tš()78@UU׈^jFJ'Iyk;Scd,K2g,֝;U\ӊvS,nyR u 0嬌]L2\M Y@oH1zm­hRU`B,Y2iA%C0Qe:V&}{ߏ x6v`柂o=H*Y~*N8|ꆘf$ ٪¢W'{>kX(5~+(;ȷqr&XG"&L0Y%6u:&X (!)l^ Dyz-+欺6Ls6`MN+oLH ޘeM1zpI359ypt OØT;CgWjTSR(˝ﮍV\*?6{H ur4)_y_9yI_zӟWYz׿i_{y{_|W|?ї_}_}ɏQ!#O?4oD-pP/OPp9ߏ&p,pKOLWp3/-T0iYpw{W`u'Po6gpq0#pE# )GP(0P  w 0PuP }0p s P0 Dp = P p P] /pPQ 1c?Q31 71 O˰p3P 1AqIP 1kqP %q-QW!mP+sDG 1ep ?g 1  ePQ1 9qӑ M'"/p4#;#?$CR$G$K$O%SR%G2 !!,@H$TH$TH$TI$TP$T^$Tg$Tk$Tq&Tz*T2T:TBTETFTGTwGTlGTlGTkGTkGTeHTUITIHTHGTHGTGGTGGTGGTBBI=>A6<>/>D(BM$GT$GT$JT$GT$GT$GT$$T#$T#$T#$T#$T#$T#$T!TTT T"TN        ""###$#$#$#&#8#D#G$G$G$G%G.?>0J&M'O0P?UGJGHGHHHHHIHNHWIl=HmMHlTHlTHlTHlTInQaPjRkTkTkQlIo=t6x2}8AMSTTwTnUlUlUlUllUllUllUllUllUkkUkkUkkWkk\ji`khg\U\RWKUHUHJHHHEH9HDHGHHVFkFkGkGkGkKkklllllllll{lmnvollillrΌ־ӶԭתתتتתתתѪƐH*TB + Ftx # ()5֔@F5PTB4/*fE8 qUMVJ`SЕ69*])͝Xٹ&'*帆&MAY:sۘN ;T݆R9_=gaz~B|hY]k0MZhyӯ忟h*czdvtoK:0ǶeM׭Og*"{6УKNuWnwHฑw(fȒ*O%L]%OtRKr+q]%l\TDQw;Pyd},ѧ}wuXeeVXfUZ_FD$H>kiZ::cuYeelj"<7{E~TyZf\rɝcfux^b"y \KD4K'aKKQNave\TQR](THbVBWkfgGV5X6LZ_&`6b}晪'7aYEUQPr1Zgv[XʅKQ=DU>w:0;Vg. }~ gB ĕIv_{=E{a}^~9VlJ'MB/R;MaV:hJrfWS!{1M!^'d!j(UGzVhE# G ZKm_Է_ݧvK_[='F;ㅈMe|i״y 8"c:gԽ R6Q{tPv_se|I54%tbՕYFmqQ4{[+dDsvgFl!N,2Ze%V-"4U(p_-N#NH7z))As@ ,a ˓AC3PG(: 3h4&+-Ӊ$? 4$o@ $\mXC08kE\xqGaNT朗#ZjU0!欈ѢIDejH"QMoɸA)mtI5cDED&(@ :2PP&"R"I~؊Iѭΰ!DDBVvy(Gs*OT;}]" NYѝ-Yf[^̔1zFq\}C3Irg倨ĭ08!v@s莣fױsPu`2aCGHB( CVa g), X蔖%Ʌ.<)f/(f6 $E$L`mHyKt 8"TFOht6% FYs\\cpW:OH4U){yA2PtzKzbN:ߛ#4{P*,{MC(6rz i^V޻t BB3y#Nuʕ)-oWi%)++:k9lJl`+:̱.Z=(4`$ 8Ӊ⑺!B{ ICd+ϰ!. jQq?!i|PG'%q M WUzYEY\)Zi@!x`R AbF#VZJ+"\g$ؗu18:@,g61[⾌[A`ʼn:GIHt$_p !9L K{G\L9љo` {jtǟK (p@ ^*Z5 cĤ$4;{B1@f s.衡_ncz"_Y:|K a~ Ncc2Hug˔``zPys(-uRfh߻Ӽ֡/  &u|&6/VZN▅P[@ K I]o}oEGR>'|ɱyWH?1W^k.f̝mN)lY&+в* :]o%;Ӽ wFְ J)CDz,kJ@.yq4:3@|)1ǚz+.^V<ŀ2\13J!]֢UXGv"mBzӮPGdm&Y1LfZdٗG6fmT1yq$!XJ{s"4 } --d3L\̽-@ q +r":8"%RO'p\ђmv)$o 'm!_Y2?N: dhj43{Pɥ'd&^b桓AIhFheyzl/5, Nːre?F y@Lr)Cꯊ/^:{$> C + +?5 ܕB,kJwK2Xm쳒N<;EYZtV1YCJ uUAnW5S5`a:;Q`Ȏ,S bPhP1> QD̙ fԙ#1:e$F!iI-]" i&\s!Op D-Z /R}l(!S #=$Bؚ68V'Iڎ>Dӟ@@?„ZˉO(Xr5k )fMR:fBi7τ fι`ۮq[v׭g   pp o޺> rx߭3 `ץnOيfM.N똫-\xu7UY*D+RK dA饗l11ǃ9>2C2HJÏ% %,U,O` gl}躠m @& rI'%WdId2'%DH !E5讽KOsqK5dsM7 ƳJ1J(&Nlr4!Ixjm .[,Q\+!b.EJ)].<7Dm3 TEaS_$*TkH¬ a{uOJeH-ЂYgYi5fiBpvhoDn 6Fh]:W›Z8KJ)͔l-[&ITBXYz.Kat IƻbKiiW;W/. ϟV5; dR:TuoPU8oZdY$ܬAg-RѢnnB.E X\P0F(0×\g,Vɘ@%}K6 O f`2 xТ^z(;f c&9Eyz$A2I"EK6 *cj:j̒x!qbg#SöMT =&I>ʯiLG].Ss6_TrXbdrif-3b֨cQ"H@FaMnRGNJ%(.%&/!%) #IkJz d HS4'%EaA9=5xm6l5BH%Ebt9UNVW.咂D2Htϊ B| l( b1Ej@Zt,UW}?m?RI+S1HN ]D@XI%i_ßŕyU caܢ%93l`_Skڢf W ю?Fk$X!l,I-B1_wafH5<U"Ld喢,HoYY2$+4#[5 3d Jebcfmd>E`"\o;i|^jqz5a1\`J*jbEERi{9Ҥmw[Q:`TE[\P7+{uŽa/!GPT,YXGӕ⢅ݑ>0UEmJ!6V$`I FI`nOepXIŌe,giAڐsfb3g'as`fZ^+2-)WieEJh(:/dw1 dᆰ_`Wpe[#g,]R 椓Q~٢AVU; I1t#a/=7^&o [Rj6B&2/-jKtuNzJXf?h^z t3:K[+qYñB`M4ͷ5=SZplfzrꐊlzEkD:߿N06hXyw^?>pM#>2D֧qbu*2I;).-85h % ?vڲ:qaJ)z I }2뻲1A 03ڎS ČҙÑ:{s;\᪹1[daAW: X%:!$7P; ,+*8e8o ><Zɥ("yzQ#6DкY042؋EhK0'S,Ej?(&̸ïY47*EI y435k`1H/`I! *F"‚:SX?sP EЈ 0Xu$&@ &#YѸ 3gI*ZБeX 2 'zP, a<\(D*ڌ=W(R6I'ģ Ʊp7$Ó 1U::; *3@2 P Bh—5,T/;=|b.CҬy}9\E%&ycēiƾo۶ל@S>`^qM|Q 5s2 !0s,9sPsKPv04 OS[@ѳ8?1!s԰hjHu꞉4 QVKL /j|%وщ lakԓ(̞ q2Ժ%,+HVKBL;C IP{4&,=M+SBWL }'N 2hIu1 A%؈Tt|KlZR^VN)BZ*e 7LSmı VpUu0b͞-CLJESƝa0ذ5b+A6|rF%M7r<,c*G6UBԚ'J,4+|Xь3LѡZH`s1X?Y$Xǃ#(*H5LP}褬aH}L+j [X]ò59*jBV5.<R6Ρ89NɓS BN N[ʠ$L,@ a ,< } @0lʅ.E%Zv YC2=ɻm C̩bHy:UFJ-OZ)"Y\  NtU>\^ ْe"؜şZWV#x}`̖~/_ <'h3Bw[I ڊD o#8SɅ^F)Bn[Wo͝ 璊GUWm~˱҈%mJЈsMZ0Q,8eDe&5PVТgR͡4՞HiNGdMi!MFv$mXEnskJë]ZgdNVVJ_-܊~4z& Iֈ7#oy.W9MQPpq+N<+z\W+p佘r.RDߛWT uRөW CwEo:_/ 3mh.?VρPH60(әZҋ (Ga 6ϠG'hϵ`YbqLmVAE5L9O28- 㽷?HwX0Xq eh-8G:?cfHV|r zoN+CJ;|v|w3VJ\zpyo9xL8NRy- Xkzz Z|} %*Ê'B苖N ,Ӛ.\HXbB,$%I e\dɜ(Jk2xX}N.b͌%h<Ȅ&C*YNR)&υ#sJe5l2e)-ZJH5,_ݹ0"pNJbXRҝ)2f/h)jƌ26S>[DR(Pn» 5,msrc$'=[œ2~ʯ!'=Y·N$KShwZt+<8RRXyTlϼh$TD}XVsgXh2%$ ?y-XR% <+WG)q׹oy|.9zG &I%^bq"U!iC|ՎJ%AHeN fl5L_T2W'Ny]8ٔE%D5Ncl0)X f\UX%&DM_^rE!S2$Skp\C}r], -Q:SNǛYZԢ$vV)\5bfY `f1,S\;&mXVXip%,!%oʥ\R$]TQ*€=C l*6]eWvI " 8L1Z iXjJ2_,bIMW3(\qTU i%ZhUjAdA IbETg!eVhXFd E'E3,Hɇqk"{Mic/ X^8WPVF%S ^]Mn)UV_H g$y>A?("IuRW @AIcbyI[:&%Y'w'XM8 .AyV-VTHDqʛjv&XXG+*Tn6_| +ʰhD7h!(MK8Agů_բV,%u<+_b%,[bA$4͉?D:&*z:V15)k 4)`@3&3x=]@c\䢓88/Fs40ng]źd\ j"pI)2 acIBsG I?BBrTeZz>Ȱ'Vc8y4^5ՈcL\ǟ9hhdl& À|=K^(r%,7"n a>5L:)$lvԩDڝ!l]vwOJvy vqa^7"|!Ol1j"`2u)$6(C|5U}\ :xMZ'RGNO(ȷ!E2J& 1h`ʚ+2NķYdA'vMvt:(k aXW2oݰ+ _E]ogukŅiioM Nf^8"tJlHIArȊjS|>ܣ\2?K1یI6/XZt0X,hyVfQ)!*1/yb3$ (h _$2 I)^ ~Ք:!B+(6]ʯi $;GQsxbzCX͂WA'$Y3jS9ޓ @{0|N%C|qXqkЇ80OJO>j.8exe}/ %yJ IM-HZD$@B/즖5ȗ\/uWzT)!_ @ /uH#Mڵi犵%hܓOt*sSVþN>IIb$$kVs_L@,[8OOԨLk/Gfs&kK _Ge|LS6h@Ro!Z^ZuiPC;-!5J! %@a?$XVJF n mpg儫&׍ɮnwH׀%[^ %m!KםS%ٸAsbT#: O0}+h<|槑сV ЕnpJrHh*6*UV"I$|. JJ^B(ܕRfJ2g@ b0NOq}#/il-=R*8Z,%6>G֖[[tS1*8㐵D+_1ɭ#WX?ɹ_N$҃rUƤH(u-k9I׸% g(D:cYV:4)H3IP(f HPnUxYā |<ss QtDqޫRGIH(P(h-m lOɱLL?STᕁ eԒ BK3HD]S3ѓ[|TPǽ lT]َ@̹^ 4A ,iљKEQģƞyPJAפ\XބVY}XQuФSKDlh}G KYYNSZf Dz c`iU^u3}`9#Q.OUT{ڊyoIHPPRpTy4 oY:>V8%LiN4AJ#C~XER9NR8NntUU\]݅1)]˹/EǾ)Ǧ=#҄͐}ZVOAP [! |VaG9`Np']@Rm7t M q+KިDNFOhQXeV c Yċq< M\ q%Nbd"R7؅(T-]tD}ʞXhJK$/l0,(IpG?~mEBL0fFuJd|Bj#H:\4 1^4Eq n^@e8 m”_m}GM|'`8 IBYD-{M bp#+"8$5!\!VsAhH Gs8K)uGE8&猄ZnI[0u\ԁm;yt@e=f1! e`ċRU]%B_TD5N[/ ̕XaiXNY~Q`#>Hh&ȄI*[XQ^eau[\0%s[@E^w IdSeIX>^ US%],Bɑ2n LhXtJWh \wUjP{&؞⎺8ȅF*̧`) !\lDgXic,a@&nF0!l]uyap6ǘ= JNfr^fwy2[pIJNƧ*k ~4 v9RDJY`܄]d1dJ! H`VIuvI Z_QEMŸ&'8Ī!~\M@.^Ix$رR& 'Kʆ#.65eGG}ឤlEIBhqo"2չ^UbnbX GH-@BӞ-*<IJenپľlPZUꨀ1f.ć挡--Egkdܦms*]dj2n mg>'+Cq2[٬#ai2aI 'ĈH*z"'du,ۥȊ̚djLt}dsbAL h  >HCE1al&zPҨ\d<=M\Hp,7PE\1xi2HYIBAX$P̊Vph!0M`[<^>*QDBbհ@a&i %-DIAťת8]SN[-{r}n|Fr13u37!_rĆ@2Jt14BunϬNc~{nnB3X]DRcEHmn_ĐI,bL8B8F9lbr)/F -WhB!@(( -u'(vXM $|asvi*WnF 2{l.U14o'nklv IKJpⰤܠW`pIp?sYii,A``'@p%*N^me&؎~1lP! Fr=!v/'AYjEp)R[f#LgLiפkQ+,CUY5q31bHRcvߠLmE+nBgq[(kiX?yd_EѴ(_=E|&n.Ob|TKDIۼkJJ@@!P( ^(0!ƒ /DdЊÄ #(ta GM,,Χ"丰DG-a*\J,]rԹc!I=r &ύF/)fBX}bNXokW}R9)9Xe̹Vm۵O\/VJD! %JX +*hݬ#CB)"dKRkK{4My"*AoH]@BzP4U+RSͳ*}Vp˴T3bQ1d#b#C(1\=*re<,DqJdGko-Cۆ+\cW [߶5N`{%ͩgH&U@R(b a:0m&T#3yY*?i2y&0i79vKNNG5˯"n3mvh$AKuoz+VXF/ok]-,Bk7ZH}!Dr :aQ; ҳ!9 }RH o K2ER H䓫lngWO}Zo}+VySRkS!18: Z Y@[px_>m-iò }%B%aŻ"IAph'"tD  Q3֡3}O:t? f1bﶢ31H={]"5PCLpң4+\ZXJcI[2(7 d[ھc< H qU 8RG ZZԐ#,^R!ǁ9+$^[%)D!E#Yv qxc LvC2JIWÉB=ILR+Y-{ަr+)SJ]tuhY#_X(aG#L'1bE3,/.^!ETQ a5Lz/<X?$nBHXNJF x(VAj&!LTZ>.cH d",c/Q4+0%D}ZJ)iZ(4!zو"TD3i R7lFbAlplaF;q<%YR&MSd"1{IeK3 *Co/x$WHZpTB4b%Vn$g J#p.Ɋ3kLe/G.d%6TOv."Xe*ET:C$!eeUbYU6! ^u.~TҋA$zx-=6"Ofǐ.} f0R7=PI5^X ̼Z!T٩L⌮A?KP4<: IB$B $+Y =@U@FP% ?{T pBbzZ!2V]֤u2Cg>(lLL|*ҙ@ eF9֎utc먻3vk޶y!d~T#AmQ%@vY⹕jsPj:w]Dǩ G𒹜.oġQ ́6զ65iKIΊhMxdf۫0K;\l"ɉŠV65en Olp2V$HឱW ܼ]uKZhB2*j*8Fhĝw7Q.SwxU!١iL/>uIN(Ue"tߟHe'#^?8 MH5#( mHC#jv^벥fA90զ*+]h+,|ĭ>k/PA$3r&$@]hq9.]k^+qkeT)ƋuWЋ/Wfҷh UBi у@ @. /|~.#E,}m2ȒG5b/<,BP^'0\H4tP@be(dž&I*ƅE|Aa#u$*)6h.u 2ą4ZTAOʖh eCBа4Ԑn &e A8lnC⢫0FdG3PBѶFBQ;$nB'=D.zFFb+!RV1XU%6p+iEl4G )a#R2Xaje/* OТ%F#sF  TLZU8AfdS OxBI|/s.kC}ozO*+.PEZ /rIn cHQ!ze0# BOBo#bC 5#-%m P1#GNj2F0?>DZPAP$sk%7p|\.f ~j @st A&H8f@@V F-QegJUtZ%U63-[.N3zr++NQo+,#t,+E8QSA5 8Wm:mg:]u2e:&{S.Q4Th̴L7r Q.d%ZFԌN* *Fe"o%W2 D4H5(>AU$%OA>)YgVc4baS1* &P4,TO@ˤ$>..QJ"^h6J q&rWcpxӐG)@^j1SYŞh@HdiA&g'^Ok$6׾L4}:A'2bBdm~SSTT/8j9C^UR΍:3;c/h7dZQZ.Yۇ"^H*M(@vf0pT%j $AxAG;)>_}bf4tbVv6FV봎a*{b'b 2c4 C}ː/`rAcdy(l:Φ.ϰ//pr^v 8H&piRD#Tip,6,~Ʈ,fB5T6jgPJ^O6^D0~,,t3fv~kVES;oՈnXTvWW4%Xg+"iOW+eo绾 ,OHĉ8LbBw~ HD.up!5Cnd#G#$f}\^0OC/+k)9x3ɴL\^?Aimo4NveX{g)47{T kĐfӋ^&H~w!AǨ?(HZҨ lXfi4=u0~UN©--H/z 'i$ӴtSN@XjV3sn%g#4%"x_$)Uyf縂ɢn7v8oCVP(z(VUWƋ:]uvO)Um7Au0Wc,0Z˘'+Z66Y{_z/|@p?aTp? 0&B%)+16DscP=cs\znYFi m5 F7HɌh94D2eJ;v)ٰȝ(K ;K.D0x8kVIV47E.RN@w2m[Eֵu9Dsl~m%Ř O0CR~Ř!Щ.t&ĥqj[[_%s<KdJ%=FT'ꥎ0;%ÝB.H^{_VU_hЅ %.(aNJFbJtdȎ$9zxA•,[| 3&̆ id)RNְ 2_C[ϛҥL%}4*ԧH J4kQX)l)邤B\X BJ|+ZtiDkޮnZ6ϡR*(ѣG6T䩓*rfFJkz.gӬS>y5=ϖ :.i7O ݺ09rʛ3$kI5ٻ/j=|Ǜ/:y!?-ЫH 2o/ݯ~GHPZ AVu]{pGYG!'ȅO"5OZk|A%rX} W ~5H`c8c~@+O~pgV:iVj(eTNPWF%|\Y`^yu֘U8DaCug YatDJ KaР:4u2aw'I&_DAuRIezY9 5[ !YզYce[qo`tW_ZUapX&TPN*je~)Nlֆ iiT~Ì6kZڸ鮫v&A"[+&tЕ7yMz9 GLĴ~ +_MHc6/e!t EXQr2A0"<-)}ٱ 5%OM5Z=`UXㅜMg ZdM0jempMڅ&+Gu tZř w/>I.x*V[K9ys.R!2ַXQZK9e72skjEU8_B*V!skjb_>MS OC-UdK[&k8=3,wn_B (09B¤vJ rRڬnž0cz`b#y*G[H@ NhF.KL3]B"ɠvs]_Z ~0*}eH֗RV2j:b *`ӏOı `Hfm[)j4#jHxp@&#A' PM'_̲!P1UVTԡ.PY fcʼn+ ^ۊs1_^JRYeYĤ 7JiZ^pc̙F,T7۷.t~93GtEF\8Z9sH=g XH4y:<!*RDQ1ic aSbB X>|D e )%8;']h`W92"Y1" jF:׊5e(UtT)qXƬ ncPW{6jmv48 NB*DJr)P!e%wA ijRK*,lLjN>v2cEda*0C<`,raefuRQCnVvÜԲ$m{tF)MfXҼo἗7*d: y:g Z0%L E&f 9cAHGLn[}t ߫┕ * ;ĕՇeubT.lJ E}8T!$ƢFEP| րnl#3ْ$k'>/A 7?SM3hm"y,9c ۨAF_:C6Sl̒Rk\Vαը.Y:{(|uȖ2D9"BNV%WSe*sւt2%.zc`MX}$b8sB9 D4rܳ9 [`'4 TJ|HBį/TȬH5`٣NLRq ycVԬQiYYH Q 05 .k'?AJPՌkij}$ 'Q |\D8ƑD0B+=;(;vMT)9q`z ݱ,9%汊=ȉtwa4cy.o3ctGҏN;Z.c$⎹Ѡ^krixk\z݂׻dHz[*7^N:h;>ghIb$4' 4QI_lN 3ƝʖQ"3ZbphKm~nWg뎅=PUdB.9vB*带%A2st vgt[Y4*:-]tR[t=J1[uLˠ"c1C5>Sh,t=fL 肐f f VvT=->}]Ojj~GxCk6(8Oɑ(P&gvywlF1Ņ#1a7qUzf|T]{e(3Q.{Fv 86|CUghTTSd|2CBJ1 Ј 'TD~6Z}N%2q;$G!gx#GsY&3g'e4d(ٱh'vQNtJ1t:UQvW!gtLWLgJE{4Ƃ,ggEe5fI!}{\gW?>wÄra51SyYx]v3 mzpP'Qpq#|ǧb.BosH{4F&QV#b zmW|ʇ96$d1}0\ 6%<%KU0B6s(GU8BXrby(?Mp]^eIsL6Ze-#:h,Cr3&p QA _'vƇgRV|hLIiRai/=Yic}=)<hVkDZId.NNO0 5l )yCV9yaG@73IφUmR5.' RK#>AF37n&Yn% T,#5FbhBŝWTmJebGTkHp55B ;a7:2sKY%_qHIV'~ 0qEdCS9r'nR/1/b s'\y9s7=e6[QF?<ɂڒ:hv`-DH_ׄDG☃"ѤQetCX>uR*YKldQFx"@h) (U_gX/ס1 YXl^̦(G4PTR As5&8A }2' OYְ Z |m/)p6zɷJBWFX:#RHc^uٷ} q ʔNɠkE8DwIdJj77`ɡ ꧴hxxrʖr0#=ĥ}&8$.i#IEiLdute)fт0LhyiTjY);jUW>Xg_ZD`&h {餛TVQ,V?|z]~?ϑxA"_xAi4VdmЇ#ހemQV{}@EYPrĈlz2 pȆlH#F} bJUXbqo w'%dyKRZ@ Wk Ufw~,wAe(g3Bg..Ytв =KK:X1&t$>爗k=OhDTciuA"h̚wɏ:ѦIPg )ǖ3`@9ιy&P5R){0C*?Mo%ED%uzd]PQʪ7I&ʪ>J@SzQ[7*7JL^V|tա%a\.1 *kHG<$\8IfkiX=11p}u.idzjSTub ͘# ;Y$pA f: p0 " ;\iK00*+4C(?5,Kyǖk5[ `h ux{(VUb`Us0 Bc"/C"; ɥ dKp7|(I# s H sazFsUt; $|bŠ#W*H 4VL~l~:|tb(Mcĸus"p\|Aux*YG Ff2ŭƵ:R ӹ=iƘ`0HW=f6ХHah9/ݼ[M/}a%A%k0Gr13Q[pyӅz?5`#jS}͞AK5|ղJ*jR"L e )Z|gsv#B}#$T޹D,O XkDygZ) AF tfƗ) -yM)y,ԣL"IHl>J,Kx Pc=7[yJ~KՆ S/SF&oSΗCדJ2$P8r$ԬR(E#!c  7B^L8"̿Lp)nY} nQSX!EUBF9$%}(Ƿ'qwAn!r3dG'"*#1(*Qݷ99<d,X(lq:K]yYPj)?1 [Q^T:LcvTvfFB3JƢ/-=06M;ŵAZۑ ywlLɔ׽ޫ :ɇ\VdDKCF$;&*̵T1|;7xQu=b.nE2 ,-#y4 &̔쾊W^RO}T9|(''|Q9v5X{02q)(>L<!cd=ݙIߒd }>e\BIQ3]{M.6k+鬎ky*Oo߬Nc65?۴5QGz,r R J794\K1|޵bixJRz"g_P9Ddj'}tM~q8P}PV0eQ$7X3fvx֥j.̹łÿ[ ]-R k-F~>OmJ)JG d/uP:_Nk1m. jq.h-6]GUVJ0V%. `Ad`k.ae1Zƌ!A)DUJ,4NXzͦǛެusǟ== 'O6zci %Uq#=9"劳kRa %QC ()k2}!/5'Xxa,UT\'đ#rA+f.x fiԧU\e[ysm̡WoݡA{8+>o2^ u5f(2_ q 0p%R-_.&~&)oa0B/w“/PC9bzݒKTkgU-4G#?WTDD}Iwjꭻk W4{5NMʳQWB `Y:x?W ̯AJV* pce+9[rOF =X/fܭ 0a1?+dƼMk;w-׈L[ӎ6jǭZͭj ?C{y .(y^IPwn꾓//~I6ov V eRvI*r'J07;r*! f0C*v,gkL3}g#ю#G. P:[C PN AR6%QmaBBDb/"K}uSϤfa}3"vI5̝|*uv7ma _8PV9䭒eP"T D#\FwM|24|W'-t`"iS,@dȓķHKNK>AVfrAɐ췊K {EBdV脽prZְ4ar=y5W +fqZ3\7*hؘlbՊI1mGdB?D-'Fдl5Ya+fQ,؎ ]\ī{ : Ĵ-Vnr}P1Tu.KעjxXldsA"ëWҶCLx ^إ&dPtӢM|j[5nZ5Jl$̦NQGExu#r(Jxi#`,Vw3Vz;NMWj6^%dss YDy@!0sF1kÄPIN=0|Hi&xnc30_RK3/$".&mB$wᖼ&1ytmt hWaW"I0^c~u%K!D_Xy K_a3 |\}mV@>-{ryo@sbfzrm']J,^ɗ˦NEaavv:ٌrNFO}+u-_"^$W/{9+a_rygB Daw.o{NmrνA"͟F^uװbJկtImfɽWQ{/=1^b(6??d[ ,+#j q{6R6j%98 k <̈ێd"8^bZI9ۡ=)L=3tYBrʸx 5[93$|:(5$r>9 0ٳ틋Ⱦ;#jA#T:Ѿ? 7֑B;C Vzw4?IT )%H;LU{? BN G#":_Xʲ'j@L,J [E)U  T JJB<7`J>lܞ/=p!'r‚FKD E ¡s^ r"l0s=`´Äv:.T;ar̙ɢGZ><+L9>Y9#'QDA[pBɨЇTHCTǙ̕ċFJC{2N.%FNy\>ی@$JU"C m)5D3\ZMµyUDT3QI0GH^ZNF@sSB2?WSK$dE#eYZ;MTOO+Wn3$+h2!sVY]7uSk7 gl|̏vˡ1|^u[I),(')ZX!kQ3*==HlԔ%Ҷ}'9H`Kn.$CM+eסqBt \ŭRkWW*AXosNϒ -$= ݤ[ Tİ@A@@h`TŰT$]L!T$^\j^1UP$8YA}ա2™߃-MڂZ̰}É0g却| HMMr#q]`ё"{+U#OȎ!?m¡u-?˒̴?:NĀ4q*0z lXL ԅ=aaD-bKYls.b"2:^ն4PIRh OËjYAI&KZDӬ<\ЅLKȟ戠98,-^Qb Un-Dv[>I%aN1"y:(׎Wewv@$T#7ۙ"R;'81W]]>`ĺՍʪLId.d/Np4 WP׵%!.|ɶ` p)?952%} v72S5 UMj"f#J.Xmb5Y%Za*l_gkeѵkłvRЃ诨m ^n +&ly =@uhE&RDfEۻTƒ~Q%pF(KS3-@a BXzXK֮B? h*6lafj+Z1$f@%fafnfi6olVdAIo׶]O qֲcdLBGK8T~3_+8,hh2+:Ζ9 Ɩ!xZq]1g-ц9gM6m6o"":.r5#ክڙHKӹ;f'V++Ϻ5!L_9$()^jl:$]Vf9w.E Os݁O'ξFkpng(p p(~8i YfVIt7p=P8܁05ؕlUl%9[Xul³GmwT3Ar#HNm -;$n$ r]~Cj[%՛!vJ@n'aa/f<ڬvgfB no|B,+&&YfkkـE7gJO"X @VpX!`AH}@qA(ѡF"=4)ӥN$*FhΗVZmU)֮W v؟=V-jRɓkKPv͋wNI8 lS.\c ދ,0/ D=h5TV}'VL9)_+gBⷶQ{1Y|NJ)ea<9r;.{l.'uV }{fZwMYU镓C[A|~ט/-Q%'SIH5QGHkXfl $m yr?t<զaS/&SS=^L:^Ňq5h)yU]m(H:]}]j!QfvkɝOŚ]d'lqf'$؁M\2[%k&zM:ɨ@®ן02l14jyl.os{yPW)B\t[zJc*KPkz[f&R|m\@IDnI%vaoًEqTR#A92N A&쌅lIYb35U(ųF%qVg]1hJSDt|r4h$0ecAn/".ɱJ\߯ 퐆\"AR)$SGf^VrZJ ;4$m9 jx1Vc%]A x!8n~y .MY53F`Sdr"TphI";45-%$I|-sI(ς78=՗x4p1PHP 22EE{GڤF6S,B!DI0nl\2e12 Smf HPkD9 OggĠ izb4Cqa˩lB0t0ʼnN:7$Ťl(Ut$E# 1jVW}gc|*ⵂ]eQ+͕`U:iTp%3$ǹ>-IyJz0|SS %XI9ˢ)kX֌F$L,[9Ȝe6NiU|uY)QQ:U밊JZBD}Dk\uP .ǻf:+@?j޻'ww+Ę"MO85u'N[iaƲd=؝FKo%λ0~?3|!!w&o9VՐTh/PWSJKɰ\2G632MgZu LeVP/f;5i8%ܑ-rG0r SxR7X-vB܀W4K'v˴8ƾ2Hmj_!w'Nrj:en ӵ':kv\pm=klqS~'mn5GM rKA/IJ/Xa+H!ckn]4MFt.x"V9R!F2J@)ENry]ďB|b#{cS0pbjq/fr͒QMg%P5('Qi2ؽs" MvK\ü׭8Ӕ;w۞-i.gCV,4 g_/%!,a}NsB,S|DJDc8Ƅ7&nX02D! ËJA7EL`ZzHNˑZQKpKߜ X֕!D͕5/F1ڸ%^'_!e,Lmq'QZݞ ԿLhk(q[nɝꖼUd]ĉ~T\&`DDUNS9wPF!Ҵ sؚ &b٠JaZ"ZMLMPx‹ &"vq qM$BW?BI!hDZ`,*Xu ]ISZ͏Uve3etM2^bhp#ي7!"N|*AEr}`֢ٓ++m# `|ܯO'0bEJ̠յE!l_I1{Gµ!n$$PiA݉ mM)e5'&ZfE @@q8#G|J׵ĴwP% ^]@DPمT * B*֞Y%@O(eѥ\ Xt eA++nIL"D>}B݋dqRƛEF`!=J\Nqc3>@V#ZN ƋـiaWJX#-T2TYpD@GV\e"iRv%lϏFbx>E*a0+Fh@_2F&~|d3Bbii팮5'lE. *V("&D!T mnIτ_کt^L⅔^\Dޢx*n0'%NpaiLj}iYɳ׃踊.fjQd qԆZ& ( 旦ެԇ^ƈ{lN%`@҂l=Gf6 ?moJ~,ml(i LdBd.oSne*tF2ĂpĜBnІwO4p@2ppFf *DJ:j.& ܐJ&U޺ܮ\_mpt"鑦k\mx!+ 0fa/b `\٭gV/6~I6mbn؅qqIz0Lrkq龱ΒRp)OaDFTFOfVG`:o"osF-\b( i)%67:RVdHuİZ6nV{+shمTQlp5Z6| ~= QBe ao +>KL^؎Y:{SsxW T? t? XSIdl/rRĬ~,4Es_i(F!KqqY4gĀ.n!Vʱ}1"O+5_^YCum2{.QW<[|S ,s!2qLj:(,G@kW_Oƺev *+^h2ChgWҝӳ0=P_"ќv4=vL`Fu8$YHblMמOd [B]yիw.*&:%#MipT~SH&|KUĤcJMX2 f\(4-Ѝ`{`o0 s4M,>]ĵ&/X" %2䲶5F>z *yCi/M IQU2_U@πWeJȸBկ<\  q `J^Ij2@^YZ2tdRe4>hxm@4I KO&I|-6Tϵ=F!'Y"ĸHfCVR>,ͩ/HyTeٰfFF, بfbu<L5RM L:ͅRzcf*;wYϒjI5o4%HQYީRRն2}*ǎ=n.dZi183&4g*0).Waz+Zغy閔 :3mfNRN44Gk2τJX2ĠOA*&'V[Fj"J5DmV٩[SR ʧpr(&JBL'8#\RGtM슂"d_I?*4HĖF0qs*Th7bgGis]}BUE=!!M{Nml+}veg@wD~W,ZDϩה;%vOdJw 3_{b/\8@aU[,3͈d 6٬ ,BcLڭ;xq\vk O yg[ncK^3ο=ܾ͆o!AL=b*<'Ș37,C|ƔrH.)7LzgJ _XZǑzVGΌCژxzF6?2|-/jf/{z`vnaCYBfZ~j)Zm⾹[*.-2 {o"xE. .33nLS5 钟,R41@+c6sRd<( MAz ͆f~Yo;gn&[q5MiKLӭ;4c>H7ӭ4"c{ZhoU>Ud[ZZw,h㷶+=yg}BbG->AYoaKyh4久!?^ϧ9vU7,{eH֭ĭ7;Uf#=88$+7v?/9_}_}_~W~_P P#P'+/3P7;?CPGKRTpR[[bPfYusmpupe P i o0P c P }0P ۰ o0p0ݰ 0 PP w p P/ː0 # %q;Q9 !q A0[q P qq ɰcQAs1E P!QKpqQÑq 1qwO iqű;P1 Y1   1!Q+ 1R-1"Q"' 'j?r!QQ R1 1MrUgw%2Q&Q$Am(R' r2)Q $W( +R+,R,ǒ,,-R-ג-2 !!,@ǾW ZEAЯ^!2BÒBS sR =͡ZEJ;+i] [UH!OWQV'T;eb%[X*z${1/h7޸ hf. .؈ $=~fb5bIh4Yi_w\l0)b|pA!Q|םgrWG~١{$1,j)%W&JY6jٕwCeR\}դSOY+!NEdTj͑Y` |\UYnƵSDUSX5ZLCȮ`b}6 GEW|S#jIR)Tb˂ƶ[x}kZY|dSn}q'qT y+ 'yatcpv+4 W\AS!WgCq3I'H_b)sXvUiZk[H^U|dX[`ζ\#yf9ug+G"uI36]digbgA646/$Ƽ+h^)S'Yv״gVgG{׋Si 05Π^]Kez%nySO6Ҧ.dٔnbfuzkWuToqѩm^A$8uZ\l|ua?b?u-hQRn;)Ͽ{` 3KGzJiqNp0^fWFCЎQ( aw5 &!j&%@ OUʖ–%M?G CIFBB<ȣ i;g1i,pX׼3'K#/pT;GђX- }&qI~ AtNnPDF}IpcSdҬEsr5:Ʌࡉl/0Q# hhj$,&pvn1|KwDiPsI%Q$u+* ztlb̬(v˥l*2L37h}`jQhnkjiEhje@ӠۉF34}ŮpLl|X"7F9c  >܁bxO:W(hR3 UvHDɴAs|ŕ?X&lNw©N`N#vR9M%fPb( Nlctc23U.Q$\CnFTϟKjhvN U$6J@ 2\$X&0p3$$}6D\nݬ-O` +W)*O2_qo/j)>KE k²<+0n9MŌ[†`$oacP g=KN=hk^sVJuo_ L_ AP4Aہ9āu 7ڡASǭ܁CJ xxC.I;ܡMclךh8+_Te!s0B,U)?0cS Ay@# Yi o4Wn5YɅ|]f A9iUd'T?P4p eى6ϜuIp16fr0IV56.)VRO \fX,Rq7R3VvѧQ߯tI_k\7๘ؽv}Wm_W+`q{]۵GXj+;Bw#1 6-v|!TFT1KW+9hBdBg0)Ϻ2ipcj[ kcW4!+ R&~cC7Rdl\eN2{pͣ jRlx>R|v`ZCڧ'7!11v 8h sYH27BoGV?EU]6#n)<"~ 4v>ׁpr)yb 1VYƗ@QExak#OR5%H6D}!4CAik@k"*uY <Ȉb/^u9j\,ʤ[exC mNi{ޠp̨@M"miҕkxGxfqUiJ;I9v%RCpCDdၘtAmLkXT1=dm0QhJ+:>@*Zŧ%7N@fC~8rc2a%Y` }_ev3v$ŏp (;)O"Su0BWkRG;;2cSR~' 8b&y9Caa%:83z,Z9UkT'Q7CC0 g`A!jk-iwDtv WKvZ +@z@L?GM# S Jw Ыؔ8v{ WbIw E"S*oH)s:gG8h w eKCXVؠe=lJq((u(^zPH`6A_ _W5|qg+gQ"깙{" 7ElO)RIVcbw au;Z>(~CpN }ُI  |s[}s0Xأ gfrtlEQ xH슁1GR;zv-~| Z}nձ*i&Z9-^h E6Z d>Q8K9G1]  гJ|(% I)@rT nwi3+k]5#.a{p y>;ؔ@vrP_@(ՒK ͣlx#A-ȉ,=  uxj`Enz`AOk&{i.2֩hf ɹ"J)B bC7L@̹`vPuvpM0K [/a)>[j KD |ps)3]8Wb(Ƨ;DAW 2$2(Xűpz Xԙr % ь CҼd|KX1H h%&g#o #9a: Ffi>*Jsgt碋Fbw `L6E[ڨ[Z[بϊ .MXjmb"b3KvA5KdK_&;0Q{ n}wƈl7]LsLKc -ȍ,ȶ4/P;$;@ǭ.A"k&(D)BsraAD e ~E|O)0p (2;o̜x*WKu 2аGPJㅦ&v뫮V@Z֎|Xj#bv/*"*]#zX" `*!"!6&J ,&=1j+˜+h@Yd^q"YʲG+'evpР!/ tALLҿ(P%ZqzGF뼔x[J#lM)jI'[+BaZ"1rsq %ԭ; ް FP.O/ O  {tW p!RHcar'%d?ވ caԀ'91J~V~֩kߌ.ҁB5r+ǠNfN kپV+6i Kl\(DA_Xj+2qSϱ +).O/T/vo /_Te7!άYf-k̬Hm RG29⅙A6o>1Q_ ;  2W.D}ϞB롪= 4(XQ;Tʇ8hb+yW]|x!eE7Ŧa9({dg;6#8 !@|8ꀂhH'hp0CȪ!@#Vx VZM3-2\#k$jī";CDt5;b2,>"تAlFC _!qq /"*4X#.1Ӿ^p3xA@ ;hǬBO249 L R*Rk8W[L,.1n;E <-9bY}c/;ˎ0! i  2*8: $΍iEu/`,|EyS3K >ʩ!{ 6` i/&ƍD0`t*c-4dkmH{Ŏػ 2Dmt=MkA|+̦~J^ Xj/l{%3> &Z23@ʀ[8\2ev0ҠnA8Q}la< EPT^Dm&'%y"R$h!C$@#سq}WP^ryL x.S^!Rs ˆ7l7J{FpK$dOLM$JO1W!'D}ڟ~JƔpX/i@+,Ď\VC63Hi_hYsCx,\"@0Zw:D B ̐k>5`ܪK 9F ?f,9+p3O 4ZJ 'cez‹8>$=_ 2dHQor2 P3Na2#yu "\&A@X`Q&|n>4R0a㪉D@P\ƑX&DbҀ9F`Ɯӣ`fDcxDBYLmEZp 5,q)^U'i mĤ柊ʇ6+HB3S@Hk\ܲ?ND A/(g{竷-7 %~{Y;(F$NI8ԣfg1&8Գ)d?8(&mjt5H=Sư<^mL \%<&#\8VxeŢ]𫙾>D3I )dବph`CvШ1=\:S +!((8ss bX>u#PZ,24 @Vڭ!(;>!Dav?{&5K- ,hⰙ'|h%A",`@@ 4cbܒBT@{`2{%( %h4静 7 P4? qp( #`(SFT#-C_A8IYRN'I/˄]DuAIL2 Fړ;A9 Kӷ~Yxt< X{,P;̂Ҙ` #DMT!< E;K $4dL :Oԏ7 58Y,(0pj,Ij q?0r(F dW x-A #NI)$c\I*dFx˛E[9p N@m"TBD6` <e#6㬏:2(Պ)BՂ4+:d L)UA]D,e٣]A8y( rs -Q(5s!Bm`b .ꎿɸ?&;(7ś\Y!  lPi]ZH0A.K!qůx ^h עqmziAȞ">sJ K jd, 0ΰq[ MQQ?,uʨ3mպ .]NPxэq]kVeVm^^:em=ctZp՛n~hRh-/LN^zo` b ˭IN *ćֿrr ptvhҦ%v̀@Ʈ4)!J|""^S0~Ml*WVޚr*(BEk յW!Xge[FWYcYcY\xxٕ}T")iD"+"u*h ?yl>dޅmݜ7OozLx.ُKD5!%D$hnz#yoR֍nr# f:RI" A-b:&~ޟݚ9ԲѴf :$xlb^2]u#OLSlxsfi(H4c%# %+ X0w/Nb ӿToP >GPBj1% _w }QAQ}PxLDPwwavDADh(!`aT5,e!QSIuwYIF/'b1S%$5Eo>4_;)R6%!ؐ)Dڡ_r'k X_fǍ^L[MK1zL\:G>CqJy%g딒4mvUHuS}j52RX+Z |%Z,KPC2O5l92S-N E> - >&^\+-PFT>x KX[IFEv"mc)2EYA,lciRv#"Dq.W]:+}o lbFɜ 99҈D'qњ3gA); mIxc NaXTHwKw3":CIfiKK)*E8%8m)aCCwD/paUعc0j*ǫEgBPJ5q3I"%b} .8WN)T Nm U"384jj&'f1YTҐ^i"xި61,Y.qm"1kܴ`dv_=7LOؓjj}QB,p aR4E ,ɂk4,UmGlب /A8S ia U{[&`;Z uMT F"/JOV 3b-򕑝\-.ٸh^ãcl>z!-w-[8 ȂѱoH(nmR&>tF&OyTevyh Hyaq .\f J G@%HϰًyIb 8| }I[7{_kE؇`} [̗pE,̐R`ԫ sq݀IZXFK0h St |X@٨hҩPuw@2\T Q`B,P؅_L&P^-0D@]mL Q^Ut|޲ u^j69U4[GktEFp ԬeH4GY  S_{Ltvd"B_:C@Pښ$4PN ONbCr|I(_AD yHBdZ0۫Gp1 -Zdain`_hLdQaQ\< 7̬\ Z :DP>~(qSME2%rŢ,a{TfٖyxSQvtwD2ʕtYᚱcɻ8%CeEMeXEH G$ g|a``h 3e>9JdR1 ^ 2HN/]>̙q` oQ=efda/i&`ȶ錄1DU DLBF ΙT LHG9 %=ȁ6EƼ _s\M4 ,ĉ4L@v֞\A@GBF۵!_2j@J&f|-RR*Lҗ XIE0Df~'᝝JP 琣FH(&3]Thًd%M c!JͦfR@Z5NTBtED" )fURم0ڟlIu+]QgΜaQbP]E:)q|ˏFsѱ eVjJFF v$[ДTjıtGz㭥dBȇ1ThyV!!z*$]PqW4 |,u4m4b/8ݜЯrl^%$EԆc,HHf.H&clɑ2hF3MY"x  RunŐ|L HYd\RLԘ{GTGnYkiUŠbfu`Qemcevʦ^l >)!N@bTRKtJMrY 1ɛc iZQBj!SˤjFL /}Y0ʞ=*K"p[$KZU` !n*X25yuFF!cۊ whx V`[k-kyli-LtAF~Y}cfbD tT a!IMAh%h=̑mILΝΝ) o ># [˚F-gD!HĪ+ l ytc}P,ӕD}DR&%gU@*P*aDK̿ yїU@,O{fҧdҴʱtgxҠ{$JHI]~5X_N܎ E%،LOxK>uee3IIdՠ-|aEDlgz|ŨbVgO qF<q(@ Ub BlV>ӮO;G`"tήdkQdoBBi|H5#w j NۤbrY V TwD ɡ.P-"mm-<*eKwLne)ι0j4(,iQTԀ(Br2w1+y R>ISDmBmf@56"ëHIQ$#$[trL/.B[㇥4RHSyO'}h1ԡ O^ycoA3OZ¾o 8KVc/)GᕌE*G1qu"Jp:lϊdB,U52x?3#Y*KrSUAR^0q2֎tIiGgbh E8oΓOz|zo7E8=f %Cs]d'D1`<\i^a\4̈*݉G&օj;NSkPl?W"{Y B`.d8>Ig輆ި5S{.@N};3#EFcO9R9Ķ`GCQ^L; OWEʽ v3NcWJFчdq|(Hi_*h:H5bGp/=cq' 8>}ǴU:lJ^, R ra~X^{K*:%rrqƉgvG3{{f$U$pr!8*BE3M1>sJl9SX;uLDQNC80NkͩrB T3T @ŧo&ţy3lyN*_E[FK~}<{fY"܌sc #&`_Y1k]dK@4X?i&h9VK\:v\0 e{N؃#z_TޑEV@L@lƝmfmlT#AHNV蒅W^$N^:Si):B]ŒP#[h-\rL1N(F\+rP 1&@ck6jG ǛH:mǞ9q*ک+=J63g3NS69ʝ+Q=vݮ`q,Q]ouZcܑ;ϬŎi7ػ~=Ӫsξ3k k7Yw9_׉6,%;FLdv]#l )e6DѰdd5Hl0"t&{;1$?U%jbL~Ʀ؀0:/s SȰr9jơeH8:bHD-QEjć]B' =i!7T)Z/ ƖF1^!!Xp#u}SG,z)B!;"]p15SQi@]؈xHr UTt5f8y2fċtH.\M\%Yk1XP:]S_.)RU P|d+1ofU+HBQkqɂwFtAN0x~ AWS"Gq˼f-m鏠*G9\ p ] ]*YP\F=y*(G@8X(x gLcXd2P&KE3WN.*QhU3QU2"!Jk̃b T55hJULJ%R +aO`nK!IJ$JLBHd LbpMk^l5ia!;.wV]-pe:x!'xhIN[8 БofFSjTNj9 $B8zw(P(8-[kԍuu; y},Ig.>Nu(U7=c,y "83dkZZ. TF{llAK/f@ UEQEf Ezmg1)"0t u1|Ythxd,&߈\W ,h,IT僞]mԚY<++N+VЄ1P +:F=s#ZYX6ۡGDkpӬH_qey!g3 jIb̋SONV!bEh OM%+9ܔr\v.BQ%XX\]^-p&a"]frӦ2‹ mVUʷE"C@ |97A_P<[WsY;orlj#+9>tc"$n$:D Nȅ#GD>xq Q4 d@L\p@SSʭ7r8rõܔ.|DQ; U&n)$uJLVҵwNutf.ʓv]2*kn%K '("6"p"d.nDB PpZM$T"@ލ >zCM]jˏC&]pnfb7N',Ň(Bj$\)6 ЇNYxA 6c6Xg:"31*NpfK@uSe#^.%t0阪H.$j!kkb3hII3LWbt"xvͦ2e*&,4+ho mI,p18.k-0OmD.i. 1X7.1@6H8 vZv.&H'-\$K#׆-^1i/nQyIag"610a_6-pM 8HoAq|b Ǭu<űbd,Zn&tC~]5*o)ʇȭkw0NC A-!h.Rr?G#!#aPR$Yʆo,VF "nˊ'>C, &&BckP̤kdH0 $ +OF:G|(H0Cl6Ieӊ-/I >qb/܇-F;碈J"B-|C(M1og,MtҌMQ1Sp[Q[}.(3)w]WƬ*QW!._H]hyɗޏ ycy'.d/bCf] 1҇$8^ˇֶ%MK?>Y dГ۠' Q.5y b&坖҅* J9 =B=6tg޲|sDe1cLDAI.\tѤH\x5$c3k…8"⌡C~5zŒz3]~$$8q[k47p (\x``GlC1}aiن~(Z""aH#6-ċH2Wa%c_` Af! 9`Ab#=EIZSB哨mi[m^%Y OR Gq &Tp"P?ٹSQs^GYgr(V/.WNI*QO%iB RqZgq:fM*&s>Ő;e#$\7\҅Uv&JsD AdIz9H-9Yml`VݕmknkR&uBM-Wqr&(\ PC'D N7䧗EEht ۽6hz.!L{H1ƬNGo2*7sp \Ǹ#:Z%mE_H4GRQ1I=Ґ+cI,i;ژ w[bf ![Rx^UfSLjCQǗQz7ҸkwV/X1A /W J쫮T)#$Nu-ntAr!WhV+\\dreix=m>6.or?Pr(2N%: CIis^ &CQCB6>[Y A$T DP8`q:1߮åh!PĴ]$O `rp$Ig@6'~HE"Ƥ4)mn{ Dnu( B\Bv(-TC7!zzQG搒 CP1C%o=dROdpwLUuIP.l$tK`E:%X$xuKa%BmPT'򱑎·d^K[VG/}Lb5%`)C{)G1K想}`IuV>-J`Da!ѐfD6KJ#d"?6EUm[R3P,yKq3h4mQMVcu+,i"4ݝR=i.ҟ9#Cm~+%7~j* [ W)xppq.hel ؿ JYId1^7AC\3Umo|4_eF8: נԂfdT9)2` <䗵=r0+ @Փ9SБTP&˭jO=P^]4!!x8/@& 7-0<q JCN ǥD?In~:%:t o ifZZ KW ek%i0[.Ҷ0LtKmW+/Y jnsj.t1X8#Np?|Y7˟تsu!EXXsm(v\9l_NBq*t+ID݁ ^.^6]Z;ZZ-_esC ".\Szi{k9ȈUhSJ/PGg*;9υ^ǂVA:?l h4Q*?Ȇl3i6ֽV7(SVlG5[xyE.%"ޗ4kLQbTl:}팛_7gvط3ժPV,iٮӠRAAuW F(=yZ^i t hsO, ;LAoiM^HI1 /ӂI^Y$3#_kNlO*}Yz<)((`q_Œ+UM7zXɇ#{9F7t\̕u)\7ZXBv%)e!vg"=&hffgKsD`xY^UrC$ӣ #Ӄc؎@xXd_W$l8&M-F'UG#c*z 8 *ҡ Q+7r+vzw;*:{yqeb*GacdbXqI|geK+99t4iUTF}?ie$Ia}#r+P5\.cvs4/Aj d{`KP5'Bmɖ5\n) {ҊZFjxvu2?|2Bq M8\\!!(^s#w/Ce6,7>(;ȃT#鎃!}S!ئhD6Kq, L a'ut^aSobPTi؆/o9o +w`bIzp䓻!ÓK {x%elڇXuӂr!=aQIR>_Hɣ24&  sR؊~aV(Chs~UWB;:׋%P'zWc 5!j ^V-4eER$; gbi)Q<G!`棬6hb&+Vjv8;,+k%dV{bz&U8b10 6 Ɔ+ynd/rb'IUzz4!exGKTpBz%3fb&f)~YYT Sdf#xXt#3q {zg!Z~ sAsPzҘ&ጰBCQtbãAFEa&#dF f=P %3ndBx[V 6{Ot~D#` J W֜*pJIo|䁰C`nƅYA%&pmǙ*}0afjGXA(ʳFl#t5G?AD tx;&ĊC04te &$][|sx?y/&@UN.Aq61D]hg6z%#S?bE =I6ꅤ:Ҕ1SJbF:IM:FlEzTu,&!<2-L%; W,|oGvHgui`*,I Fh95abF2Ar(P B sW "§i(<؆+l1#h#~3Ջ qgcĐk| ,~ q]mŘxPʤY PHHqq=@gT}LעVc-8Ћ y.VU%Mcּt`K(m}5[q!f6c1ꩩ+mKr2˛>e21u=P n ŋ$1a\d @?/bȚܗ JsQ1 S:zLQ5C^dEn٢$]-rA+PSR׹_KzNdF^A)`VnѝW#7ViqNPMq ֳ TON˒D|D o &ضc Et!$2d "$Qp#G (Rɑ' \Y/eAH1E%mD3;>(ѣC"et(Axx{EU7̷زbӈWUQNxm[ov]_.B X3#90 ^cǑ!OveE+,GBC{\:0gR5keϦZմUs}B|+88q궨kCQ!YTb4<ϗ g)dq\yRfPk)VrԦVׄ_jLm'0!Št[/3b[ wG)f)K 7:IGک}z!tFid(͎^#j5}}* 3# ws!6@Fۚ_S&}ikFWw2mhWk:{9s:M"B̺I)a@9; D;$R1:0iʸ,"2ʈܹA07\+q2 aH@ȓA`#2 o6M9 °*k*B2+8H,þ-ÿhc{i"KKTl>!{!#R(“=C6? 1'JYJty: Kaj@\]E0j; A9&jۻK;wÈ}J[QAC6ѓ>f#ݡ ƘBV*8s<otKڈk!†<ʓAB.'kh! =իB 2h!!>HHa DbH9\>9#B;ĸb83pHL 4B1I+@ f|X!/ Q/d:-쐒A;@KQ[ ^HtHoXƱW|GEEC`A#ď#,+HQ '#K]i=4F?-IL'T?@Ύ3I|KJՕٜMt^F:YI= Yڭ^;q:P>xN[:lh04N T]5}? VPF0ެ%# `A00iдLR*⨥KxG|{TuL!{2S7 Ah]`0l+# [} (+ʝ A N4·4X5A^>\1 9l48 ;>{UWd^ .q#4Cɰ^%4!T9 hcR8`ȄQ@$rfؾh`XvY~-c)15X9Q@BBɤ 𣭐/L߲qt&08V\2-X]]fZg~-eg%^ոS%F.X3kE㎥ Q_|Y._;iJT. @W؃j!IИZQ l9 K˨`hKTsˬXV `Yj`#̻ef[0ˢ'{g5ŸenpMW&y0TGcaX``A¯2k .$]¶ATȲbTb븬6h7D0٩=JTP<ŵv@t厵4  HB1#+/T1 Z!Lb:DZ( Y2A3 1*Tګp*g25ӆ]8p25ou>hXCnqF;qֆ4j$44c8ʤq!!W!T/y@3a.OTeJ(,<ť n9T`n`K4neV_Nm88oMZVťmRN&+ ƯTr+)TR9_o7fp~}Dbes+;b-+l,bSGD0w1NFmYh9*7gYw0tuLɰs8DNEam̴.WUhp>NjsPOF&Y62dsZN[5彃 SP^e_>#yf׻}cw !k؃iw[U'!e]H ~*ghxy_4΄vqnNwyXS23ky_qYVmiq%4;hv撡mx9V?2',119s[8No和[y_{ >A} վvC#}* TB%s,BA `RzBf NQ?=6cr6mDp$2uQ {qg}W w{uj;|b-U_r ҿEkHбMw UU ڳxAf2 ˆֹ_'M]w{_ a> $\&9"d J@dY! " b†)Nq!Ŏ<~Qx!G#E F+FXDK0/ܼ#Nǜ(1~tҦBB)jRz5HTҨL=g,a2EKiдbB:ݱNe *վ~ ܦt;yA&2e:/\^L2ׅ2 >XK eBwbҌ);6ٶk㾭;gC-6"} Q֕'%:ޓgzu;76|\bޏիQi.>8бC&_\~5`h7$VEadQF]K%!v5+R(PLUd^cT5.EUy֙]>xVP_ŤWT_ؘUEctiL z9maZnsW'w[egp y>gZgI`t qGGw 1ަWzaWڧCZͶM zXzMMVg(B+8cMA[M48>eQNcUbɗ@IQҜk$z^2$wRծV`6Tbs[әi&O|P%nP_~[!g(6izFSpB僘?#g>Iߪ鉪jDWbZ~믻n]SbTln IvM]%z5wq٤aFLZsߏ#>J|qhSlYJ۫/<Q!P':.[N.u^V@{'O Ƀx5,ʾFާX˪~*PֲFʞCa'mHKԵ,eF~+<|Օk24 OBVsv 0/~Wb:Al+?H$H'z'.OLިS5輢SyG:C$TyzZ6EazX\Er,3DN6~"23/ȁvbR0L_Qf{ d7b?k2 (9#3b˺W$0OS뺧??mB.dD\CM$*W3၍a!"RER5{D9Ymk\AL('P|S혘 HZ*9徜pZ<ʴqقJwGȱDX$)%k@xpoħP BaxraDdҕb}dx CTNeLi_CQ_92փ3MSQ.{ 5].>H{DM.O0T4nBJ8Y$inZK-)ܹy8OP.r${$(V4) 裳Rrr ֪ZM# 2;[tṞĦ0i>+kOLɊ/;^N*:јUJ2'E+pzrJKS*Y=۔Θ#6%Z.Q\i!%J/jIKCs=k>!Gz(_ =ȟi +P-^uy gk5^.^p-'RIM|#JɲԔMvB?FNsp\ZWT|[ {XZH\/ӕVD1|lT6UmɊLR Ǚ[ a,uzz ȹTrqUHspE)({R/y4V怋P `Pm*IۺXBp-vV £izN O'1yHW-li7 tvPyq||X3/䢪N5 W3%^ gݜ\eD&9Lvx_&$I~Qy9}"째X+ c۲Ock>nl8^X3[uY_JM84XȜ{sFRl>Az3FE鋃zj SG\n"( . i0kZ6w$xڽ97prP2d&T;$hktW[wɝf[֊wy#iڶIxYJ6Sb_.=\+?EEE+<e~jI{,16 ze.8`QxJI!ޟL6KEMɱTѺ P9؈!5ݿݖE]1RD(Be\FzDduD%\)^( NU] @")#@."Ӽ[\,_aM,V-(`3X/!Yy7!٭+]KLe`̤DRk Q+6QRKnVD8B9󝣧e$*Eĝ< ;A.K%@v%R׾tCB{eCW_J"^V -b̸E," b$F"4b<ʾlp_p_"l#)PMD[$yaf5VhbJiffU8R&U9$ "q< ]ʵLd IfZP`^ yT'`e@ڥegw֛`8U_9+Zda t םTt/ƍt0$=K$t&<%(OZک%QFhRbZᡗŠI(Cp+&oZ-RN_O̅ԋۼBdH֏[=Lϐp#Z%#Cev _%xbDm ޗ9|+Cb:]$atv['eKDI֙H'fTLɐmYs%P)]R,R֦(η}袎f-z pQkdUJWDĈV6Vlu&!~\B"vj`nwu'yTCLƚQ]]-ߚj+٨9"|x\GUl:!2Qo,g݆$άr,䂞~!"rk$h~fvd8ިMoΡeU1`D;†VF;aJ@IF!U>ds.6]\)V@鞑6[~"^l((ݓueԙzjܯ,,6)PGb|bSV\gRK^RIdg&K)n!J-qQNTm -9lu卪nUG- PD}[\z'$ *qGv+lEV .Ѫ5]g]0Zkbu+j$B،kQ⮂n"#zf+iCpRG0maAt"šD(X ⨎ӶD"@r$iޒ`R]ж,6hi8+ҖC@ \_>k#dUZnvz l^:\7Nm-,UvPaٰQiPp"dFn|(+.b֔jjn+ MjnN+ O^@Rq-/%OrYϸMoXCX[#NTWcb[V/o&q*Y^̂lB>*eOT1cYeX3MA ?՟Uf^ ]"n.}@c--kj \)jn[QAR%EUmYRscIWT<3?=@~XTbI'K/-s|Zi_ќJG$탠rδA꾮N$]ʴu0cq|rQ汉 f2r5,v>nXXF~iL_ 3fhv1Nb'2|c:Uw$6[RaE n:CQ,xZk,EYV;+oWShpϗᶇH ]^+S8=flEGSb)J@et.}T!2XKo:ߗ4caUcԮ9?oU &k _uV[_C[枿)u Ew+,hU8:֘:{(ͼKS9Hvz:SdKa7wGNw 59dsQ]LI%wTۊE=GLf^?絚^uOrSאqCVݫ22{;{lջ_xk=W L Q|{X0 <:`f[c=k=u ݗ<6Y]޶[F?k *_KL,\f"t)wDsu͵{`2'pG36Qq埮 ѣؐfD.$h`ƒ .<ÆBT8 F7Z<ƋCfxҤɁ+Id2YVRseyҫ9eI,tlR4ҔJꅬVwj Wo,{Y3JT$L5[0z!>pĄL Vobʼn œ=<ѷgϞ{%ݟٗ˔I?hp&b '"A$Pْ pA4ID j) ڐX#S4cq[=XU!O FtD @NC[i9D-@kwNq0A uPRP)ظI'\8>t\t*b/Y^LMHv Ɖ`ݳX]9F Vdg}LZr!7c6!m,S_o. Ѷhw^SN>!nj]o<>wC/HZf; [B]h*:_"=0y(uev'61w@h_z v)IYJa6Đ}oo~kҙdU,U3hqCKAg &H9眘qQjK|*GFwQV8hMkqdŅN,쵛*NM)Ě-GCVVTX^{:o;!Yև uZN ;teCK[lA<#.S3SyS1 ^sAclp&$#,+COM/(ږ\Zhh& 8Dot#P'+/3P7;?CPGKOSPW[_cPgkosPw{P P  P  P  Iɰ"0  א0P Pu P -=0%0 0  p1 %CGpEO+%qMaqQoqs1O Ym /1_i=Q!? !q1 Qomquk}1=ב51qU )"[Q#7!+1 /1+ 2"9!$Arq)Q'cQ!Ir%"O2 e2&#2!!k2 =r)?)1(R(]ő7r_QqP 2-{r%]-+ R/{.} s01'+0ES2'3 iR -23S373;3?4CS4G4K4?3 !!,@ (F##T##T##T##T##T##T !TTTT#T$T*T=T#GT#GT#GT#GT#GT$GT)FQ6CH;C?BD&EG GGHHHHHHOHaK[ES8L)K%J%I%D)1;%G%G$G#G#G#F#<#'#$#$#$$$"% '&/)-A'IF%SH$TJ$T]$Tl$Te&T[+TO@THGTHGTHGTHGTHGTIHTJITcHTkGTkHUkHUkHUjJU\YWLiWIkUHkUHkUHkUHlUHlUHlUHlUHlUHmQInNIoLJpHKr@Nu9\t=dqEimOklTklTkkUlkTlkTllUllUqfUZURWJWGWNVZU`ThOkPlLrK|NoTlTlTlTlTlNo>s1w/~6?NTV\|{oZXIIGHGHGHEH>H4H ķ"Q@<.܄Q*vl*£A`YwLpš1(F3 n46=.05yaPPlW z.5WR#$o3"բR=^'+9< s@;h3^@Deҕݸ(/IA܍+R띩̒)|) \bjIœR|Փ1RsU@ˑLV&F{/3ʧGfDDΙ%a%T8\u^6'JeBahX%h0N" {@&$j_D.C$,3&Rw;Q24+bhlۦvDZ/.{QyLJpJǣaH- S A|I4A% X:ɹɡ  wN8lN|JX+IE'CÌrb+oCG iBE7!ߨB٩*@\ U+cakm^,}"HZd# KYKb|4?1 lr 3tnHjjqӁӃ~c'41!6 HB(|8ca%F|9J8$}w Vka~?BA!W@29-g0'Ƌ3R*'E\h: Hա!f|~q  ;eෳ^/#Z*~f~ rc3cPI\LÂw;y\gKNtRJRZ @"?[ w;8J~WrbV2!- @+MJCuJ# yK#ʡ$ʼnYsA W03ubn/BTN~Ҋd; kTL$PEpnl&<{+)MUqlCd8^`z΁] eJ`?w+rV`O {UJًUCX` :xG+VrpRDU@J %m(R XF%-XlQBL5m^1g sq"AhHm>+%^jVhQj"Fl3blBcuBT;rKB4ܺk`VN1i.N>6ؤ+wTqO=\EKZhL64.TZ WREyԩwp߱ZNYR|Ǩvs^e+bgAtevر1;+1Ϟܻunq{ԭh߯dOC=3Ob0ȽcXveW2h @>S/|1G#1Fr&*Ơ)UD)†4lETpn~b柷+bB颓\riK܈D +,,,4[.Tl8?<ȯTA(hL?U94sE0v.&@4&Z%,,$LuL璴3&FU=S#%hhUV!&b .8bU&|]4XFyкvu*li%.@B W[5O$oA[&&ͭgQ~|Q@A||cǚ5Fz +ː6XۯH%4OJ ?ȊIPJl::v+bf_v%]T4RCE]5Jwɍ7^08<1%zzN :;o :AT0ۯ r+my)vHn[#q $ q+rLIqrئ GƠ|)!3EZ\.=S+(fj}4fL4t'Nve1W"sxƆh&afyOO<ӵ3,]I.W+NׇT\@ERɳ&SNcQ̶cZSOC ok>ti@a*VJDž`2TNh% WAH!DI7NWh&PAm8 ?aT f,,NBTm$4E-J^cIfAhE9bц2ưFzѐP5JJMU34"Mpvq o iƌfT^$Ys5tMIȹn dG"ƽMbgs& f͔e89Y0(#2T`Ho,eX'^Xf4m$m9rI(\D\`FJE-GB Z2\EL(a,!8'tCYO8]3Nb(^/SaaxJ_, iMq.0䒆&EJڱjcVA rHR 3:jnx9I JZIEܒb*q p Ӧ+eLal7Ҝpx`]KxcZʹ@bn\2̌jT`EȆi,6Ms m%1hTs?[$aVa+|F\l(-FU x9S$&AZ^d؋3i)i@cަh+y`Ym)x6MvRԈohl&( 0 4/}I>TQuǷLe#cc%, QxAߘ·&zfW":HIX+l" 8gR BшK Iւ8Id0=,rEw% ]IHSRZ,t[~Y4Y: wQh#I]kgdcXL_to@ E@1CD M#XTiExPc6&xQ+2q-Ic.j; /Q' Cˮ} $3k)GPy䁸+7X%0E#30HF\F(u79re39HJ{oEPD1+S3p Q`7 Pm4`ʲ=,"`];RĘ./ \ :ʢ),0^* ^HE.v,Ԕ|HB:yHNpĢ [ɮIv.&WO}rVDv!o[?yEZۉF?$(s]v3LcpmE ƽcB,q-m$/^+{V5oRӋ^X&Oo+̹bР(DBm[]n YgpO7$#7 xT?O~k|ߔC63@ ܻU!=K&Q8VBuU#*/(c>07 y)P~{82C) ;"!@G1*_!g%kq #*:^g &b.!j 7+0`YhҲa(Ԉ *F("!4$1_ (wK Ϋˊ? B q[,˟쒍*@B+0IʬқcسB "1U+ۥ5TR&9銥A hq 3(OL䂌i{XD34U;+>bB"Aő3GpFh(3tT#Pwo8&+X&"*N9U bqC2{ 읃cl/ˏبÝ EѸ"/ˍ48(9#1qb+ _-+! G zK%X(&Í(d&t9s0 5ɩ+L4b rG:syju|oq_s <(V,sbF'|>lJӬ“Dܳ FhqTFK/Xj4pyT_7b@@% '(" |q(1'T@+15BĻ"9Ő8 "ѹ!泒Gq)Pd#iET.Q %Q3į̑q m zB )b+ո1<LT3"S28;p%R "x(7h6hq0s+qOg\ê̺sq:k{ثlu"s;NiȺQ@N"1 a,DSA*> ɶF , 5, Nlի |N< J,-'Q` 5znDZέ5EUXmM,5Z f`4@ݜ>7h⤸CBd+.u8*! a.ͳ$ ݘκ%<ִ >Y.۹ {gL #h |Y庯hK%""fKUA~ ujH!#1?qHJԙQsV9Kÿ~S\h]2LUV#/-# Ƹ`aJӬ;#0<_@bWE!ؘE[fR?йG 78;;"8EuD{|16?87>7hb|W3vc9.?; =tUոC ܬ 9-3Y<4$H#\B2 % iZP"-N<ԞBlH Uu@(K\VNS N֬s-2o_NE:+EҮ"B in^LA*bHFL KXic n^O[^D:EַTtg_POJ NcTzJӱB։Kx9ߌH*Җ._$$$>+5(!{8@Lk+ ,i-?P7/ds31E0+ t$՛268JIy*vEL._9v둼kp^A^n x Ѫ`' bc"?':cY :&h53d9~^'{mq?.?9zc|W76d`OoAK5ۨVFDg O ǽm)Z䔌(49gAֲ WJ2 ptfڝZgwT@n%UpZRNbT"ox3 Yn/R]hTbE304Jh>HZ xk33u祊m6+ۜ @0sF j;/h]FW4STʨFj_\qUr44  ѡϮtH`ldAJSe r n$.8naaa2S$8T's?zq*$ů}ut\<]x'i@%jOxS RڍfyN%|J\Ƴ"Q |m pTMPʘZGmn+mW'<u%.vb0{Bo6QeH!r$:ҧ ՜J}qz]+x(ox&RY`lxdWLR4% "2!ĂKAe†6.cŠÐ)ZAc kõ`Ҽ NhFpٿI XXbDMZBAZٱTD&q55ԩ ${ШYi'~.f)n%v#[La(xa6IƏjHNj,Ź'tb¤]-SuP3SJ܊㚄 fj؈)屢ۮp2aIwT`Ɉ?F4qHLykl[4K(!1\ߺmP}ƳgrZPp w&]V2]![؁g1G *.vNBj \H%tD"xB)9$,A*3>HTu$@Aq4(#w+gGQyTyt"]ˈ ݱ#"EY,RwGJ$FA'A 7*eX5S&i펕gfuKCeHQuB9ew5Iy Pqyҋ#J1t&V,6sֱoy8e)a$uul?䥗Ҩ|(NDzj>uB?M$nYJwQM1lB Kֳ+[`EKVxřDq $C7I0mIAnQ6+b$U!*GiR. ! f`jUr]ۊNW7VCf%DpƯ31[\R}T)l4ȇ T!h+VИ1+9Vbɨ 1drOZR *It#&*nG$ $ !)tb lK:QؖVi&M-oB&/D:z]7G 4rĜv'G쌒ĖD1"erߪUm_\"ff+ֿ+|AF $jYY䊖ĚVnzV3C܉P퐔5^dnl1[C2e^hAi>G phP_8Pԫa$|#%D `XX~Xin+G=*b6eDh LA$ /mD_K0jRO3b[ 􅨅,QDF (JWOɬ\)_fٔae~Ќ^s2Ny9~2ØʢBU\ l ;Ü$]KbcD=W/9DW Jy/U|TFWU^Ͱʼ`DJh%:WAHu\ H. AX}ȏ)QaJxpYK  &um `}/u#}Hz}}lh|װ[KNJ(eW٭ƌ}!bɤmQ9t%$EЄ 6܌'I^JVT^aFC l. SfVƹHFwH\ڹ՞EFr! LFݐNptq_zYQ}̴"!LD6MKܣ_:Mh Oԅ81ASB2Dq`;=Q Zj`;|GbXH^SuʏhWH @(e1 LiW$JB ܒ| v`="A3[Zq$XWqd5XQZ-8 3\M`%]I1đ8Z]=T0Q/ɤE S|кH"5cPbVHu&_UQhYAP4Ƞd qAD\ -/ai]ٍ͐Ś9Y'8Y3ղ) *ye>7VqT=Jg^\F\Q HY'RH 1ɘ@%ecg\Ok4NEsQry PFhC9nӉCW & wNDt cF~G ET%F$ȅ\ oX-]YXg_2xi Uw4 ˏydIִܨqy|̡9Ss"М(V m֚daZՑD ZŅȅ/:`@a$ YUu^]&=Pd`5ʙNIdDC"(:FB]BfYcre|%HUQ_z dP ?H8.\j_q׷ߝj!! 4f,D^B}ND* Đ%I.偕 \fC2hֱTB),t FQYiF vP:wyEdyǷ.ߎܪu&莺|퉯[RAm5冸2A &ƅL\UQԎ+=qK`^o X [eOL)P#bѣ^\9jdOUXҀD,FQ]-~ ǣdV}^O1:uI)RUIJ>c?f`s!E7mH~0Ʌn(~nMhJD_RBtLCea;Ci0B!GHipwEjGj7e΍WS3!OJ[>h~cծ^شB+UT++ש@@ wqvgX!)+MuULPU^XL(-Wm2R^ZƩ;r8:5&uO;*5qT_i" O`ZJ a5!L}Go''5|Ln5%|u>3NʛIBA9IdІr9I22'v(4ih8 LC13繗ZAcUam0%\8Mȋse~~SLӚ*hQPB$f- AmGR;\É{o4w ~Z7@24ݾ&=*iA٨ԯt؅o#b0vS3k_; ;t1#P5u"rbp%LaDJ cMWM}'(y_d MI1.xCIhp}Zf6|S:c/cs.GdckFH6bILNƧ97mG!lv 7TLeSr|#}vbcL}#No`PUB'vwc/r4^#}7F c$Nغ:6Sdcj_*"ty[8fFGXfeKc.e?uWwx #u4M >-x5ӱ7=l/ܑed>Fs;{'C3ZQ 6(X\ vAGIt ;\yFldO sEb?IyollvXu H,Wkl'3S4 @E՝\Ჲ D&(cKLШ 4+$A@qĊ ?Ɣ9&͂ĵX?Evc檧"\F ~ĄfSO>QEi®ZdpJ,Þ%+դ-!R0,Vnmi ;Rt8v/̘h&F T6x!dǗgƼXsgA9'~pg?lJe_k~խވ2)>1!ߊ ؁s4+Z_d͹\h|I3-Ϸ$33DPSdXq +dOĪ1Tp˯A"0:H0,*c4N?2jNZȻ쪫 &SϽdJO;"P%[BWvrځ ~o/?E+S"+45D3#?8 ٘übjK%C k"Z +@גІV,i4I(b-SQ-ɱ?aӿdDOD%E&`R0Ia b, @o|Ln$Ӷ<+3rA ^k׵wmV7V.WI8*qRB .;"4 ; $c?^S\(0D4 ed3dL 1;d?+van; KVp!P|C'*ɋh MH&ɓ4)XR|#4l˔{PJ 77;q)r9h?|q+k+ UHܥs%}ÕzNMtj2SLV3/L, w#cbXEQd5];ъIѢŒPo`J>3wBk_Br7[]Q)Nub79Uj 4n 7|gTA͝ds1l@j!F19ld"3Ӝ3KQۛuEf5ԙ*x400l$C!ƒhV=i` O<nҶI!0exR:#*Ԉ<{}cSƉ8` C#g>!]?v.LAC<(M)% I%2e)3tԑrHd w3Wśp'3jB K^İюb,S1IUe.H4Fb%$w^Fw1LjhI*_:vNL2f~ #?2[H'chfO E_6&-D| } A X,v:iD0!,VBpABve>!,( :sjSâӖT%eY!&IH $[)Nӑ~弲% S6K1Eucc> I#bYˆ(8QE$HBWD1ti׹3{j)dKVJm](p+ T%N#kj5; y|F1 啰dW>'b8ڰ0$Jщ|ÈYg I)7<d.zhFb <6zP3gلjXYfvT/uVSܓ  %>div0OOv'`aaQ[FɥM5ۜAɰ?AA#̍z^G uws.6;-H4 7kipѱ;Mp':؃қ]l$ ls)1w15X.VB Nr+(?vҖ>0u{Kh6~pDWD'T3pv?tJ4]"LZUs %cu i0.&l|#w@ 4Ewh,'G$[ 0BޞN0$#lm xbcHh#X$<&aJ~l)DbBD.%lg @-55!˾ےa/dX Od#XFݞ/D %ڦp].TdcjOg`ANR 6>%T.oclMlj< pap*#JED$f<&B fd/B*W,ZJNP`_>Ul3 يGUl[("z̍aT6e Bt>hB"&%  )~"LBF^   RuB%~[!9c $rR_$%")1A KGc 04B #0;>dut h=GlӒШ'(K%evBeƎ 񰞖? }'*)jLC~:0(ieKfoJ% ~6Xrz"o..#//2e\l88ώ,+4-lPCZVJ=&\҆&ƒ:zOU%e4kq3>F r"܃V·BՎ1,0D: 8Dc4Zj<R8L 13(P>~F" m] J qE#/T0.00 :1 )#:$ awhlm&eiLOD0s4,,׾` A8I+ z1$Cr6.]8O Tj8wBX?ìڬ!^#~sV0Pa3= ȳWW'!U!&rv5"m!.3d*j8,J4bD$tF#l")ˢA7B.T"#GUh236O16ɒ5ÌbCE Z'R*|8MXlKUG#!> \m|nd8YFYXc;,iB..QK ef2߶%g}.1Ix*!)?@c3=" B$"PMs,6`2ESeD@R-P#.aq7nrsD3VG'e'b&|"R6ZFuVr^Eͳ= XwKPsA2SUY"GmL"c6FU#>BMDR^5&.0tR(G.p\%,tD4(Ն ue*'tT$".PeQ^C!0nXbvbnDBj+rG':pŘGod6WKfҁ533JnڦBoGjJ'!\!zW3bA5I^OFx%d"Ngu+q": " njoO1nB8VphLn'oxo9Ŷ3n͇9Oj`]w XX#׌-rX=3Au\$ltɰpF& )%v1\~;n75^eFuGD8qy7LuDB9dCPyU/7efD dB*|klYb-vDwTB h',WYRaJ9ff16f2XgxXqb,Xn G(1. +4J /fP2W~aJSؿ)~RDlC n("qKးu _~{%h S['CT8F8(B`%ܮW=aWrc:ri7*aoHHqL*?iL&BBj/'2"&)j"OB6-kDk%xKlz8 t0RQr%VpXsLV(t]"zsX;W' r%\) x VÎ G(2z#2+y#z]'vc|NdB5;_1ƓX˰.{E_/O,I5JٯNG;J÷:`/q츔f!: w6Xq,ybO :H/6;Q @ZE9l ƥ[ r;ɘSb⊎ GMb/vл9S*YYض߼7_ac};s2"L–\'B)!T[N?o:Bf":<ƖHNu_bA]"BXD?T_);qML<BLInDGQԇ*+{Qe Xʷ3y EǷK;\B?زװU{uyq%%9y1QEX|Z@iDPyC_qc]kҭ{S]Tq<~&!\ Nx/b߻3Ue=uXkz J;?5\tyz \~|*u8\N^ưcy!y0ƙ?FmH. ~ Qf}ꑍd#ȥ2!v pebZ>ݯ.";-ǛA Y*Uۮƞ[w &˂"|$Du6ݹ$qGʇ^׸%q{'(7h#"B48LBJߛ ~ !A5Ĉ'Zƌ BȐ` r$ȓ*M< eL2kδRWp2P\P)JK'Xq ԨTZ-!kU+Jv d5Y4aς5.ܹrEK7oݯ|dpa׮ċ#V qd%.l!1y@mɪJZ +bhۮ]{͵E3[İbr -c?n=c퍻_~DJrZۏ}ڱwo_…fQ_bAZW0*a %Lre!aU"HK\ DaՊ.H^o͘"<AeFYXD`3dDJDА$ =I#sU@naF\g<#"L *%(&C9n#v'GyJ4.wޓSJפּXt6SDfq,K<}ZT-j ꖲƗ{ݵWzk&H&Vf$X% m?nBYGg ee^Hjypч.[oROeGYV ]{] 쿮G1qh|GĔu{O,GEH,uAFXa Z.Or!,35z<"0ky c م"#L܁A]HJTB(K'b^3&m:aLR8Nˉ'(HU&) I]k$b'H\P46TRdMLD;)pFr<Lc?$btb.6nMJcjMRArSNLH2d*bҺ]h\#z]Tz,\nq *\ D/<+1n峈'kz a2%mmes.& 4*)qРlK0Jt9a2~u vJ%qsޯ 3B>@1O&@M+Jah63 g2,b$Fu/]nX#즦A"ODDrHA (٩Oٸ5~*D]LDi EfP<]IH$i*WB@"!rnjW.)K" @HP S5*Y0 ],WXJPkh:_3b^L!̀L`vESzem׉ہq~tt#*?+1h m*H87 eB]0h\p ;"(.1 uşa}+"4&#CnG!-P6H9qI=]RJ6jT)J@eA .8;)pIR΁խOJlq_`~kg=ȘXꑒOM* NYJ @43,(hbM:4D6-`:Ua_dg23Zk~8qr+WCrxD& 0vJZ;Fv ;b\-F?/v$#ԯNG_+_~Nj"aFiN~&Kj0mMtA\ 6]!R%v*w7R+39t_2_Ybw$'.U&yb(<hĄUmW7 ,mʹ#H!İn656EUd(GT' oInEp—|ds0q(dTGQ3}}ߗ}|qq2߇;x2r#4sdcc@L$rbt|gJFm1rrjtg (g[ա,OXGiU&|e'vSqdL=-H!4sw(d3G`cI{06y8Aa"VM||w9r| 3#:-yeH_w}~JkC~h/bN~KO%@2sh h` x$_rPtX'"ygPӓ%v1.(߂,].ؗzH2JQ:xRR(+hCփDp䎝A1*Kq(*A,Sd[](<#oUVOl@rx16)5І$hGmAQ e5tS7Il}n3P}.yqq5.g R!XgW=a]!G&&pF'u%=jK O_ `iiH˃Nf{VH@s*$ w#BFEp*CcwQq踢2( ŬpbvUFqjƅ8Boar3D$(nc# 72Nh$v { DZ:cQF}4RWD|ivV)J`Kc2!g\ 鱈ɝ;yvU5G/z0MK?B\.tn1H*hQ-M8:a9ۡ,vO[Sn$$sin/mEdzjsy]cШ3iapG%B:Q"rL^ڍC)֢^_9o4G5y  :oѱbzKauM#˄#U($gzG|tZʺY@:Y 'e_p@6d k!drj="$3cdhW7#;8)vq=LZ[f˅1ʨ,d-Aβ ʿ J+q-ҔL19/({4p9w)A[E2'%-"R)Z'_;&4䨘:+@5֚jg]Ap%(ҙr3ԅ-y㵷$bk^$xQB2,FEjb$ve(ʉ."TF%>J쨭i+ܺWJE9S caMR,EWGQ%4m)1p'ɋXFYVhB}Zֻ}Z&Kѹ-ʔ-v(v7W\ *Pt&`  -w$5ؿL+ۿJK]9ʓO@K.I:Npd6&(!{"ScV"w{â0 Ωa$3¾JmA×AoJeHgGMp&Ɇ;*oCؐM!R3ppne-Wo%~$:hV0$e},ǁ~LrTKa:vA[Yg1 q~ #ɀGJվe.mA6G,cFֶJC1ŬwD02!Ṭv-})SJ'Djh.Na_sw"c9-/[5k8ZW FDo(!'aMA^QG^_f%z˗ I&Bo)Mޒ_Й1S6e'm|Q1ұ44 ӶQvS9N)G1V,WW0RIkUݴWgdK" yX])( wi:fO]{]QKL1H,;',>mi9h$HZ=έC}@ϾIZlAlWܭ߮XDĀ=ZHq)dB7=9e#q#J~~\6W.,pD',5\d QģKqF%@ ASz}թ  3!}VԱC ]*hWs.J43BΌܷ(+lۢ>c䤥4$q2%d*az,ġ=M 1`Z|VSϕѦ2)=ad_~=`;/j~rWP1q=?wѽ罃ZԔU\3Z1_?-?gӑ!رh$iND1{E/w`;d NA :;jWa^v}d$%$8Р &dC[,XaA3",D L뇭&>ZQÄ [6 s]wo࿅7X[qNj/W<ȑSzF=n؝(1b+ќoJ43>ޭ<_u_~+ B;?"tH$}tG$t?"T(l-J,'-}rs3K8#bt! Z(O:ю){Ъ)Jƕl$fS) .R=%sI&P)itek׺Wz5ѽtz쨎,ʕCYtqL{>l[v=[ZN g`׺|MK &Ѐzӗ}_阻nt`naq#osxE#cH& / PDL@]ḃC H5\Ny]g Dw>1ƾ<GfZu4T>Lܶ m"|0 "S#AVæ $mha [QQLE+IH AsZJF.4DQI&kI՝.wFrc>%#etǫ&j-(e`f˗V9`*;M3̸M`/l !N5~9 GbD;h@(i^ӈ JԃQyX1T qJ; z & 5(C))!L$ycCg;ZJ:1HPC&ha[KbJ6"imɢ87naKP pCQFBzHJp@=Na*Hڅc⩆HҢɚ$U\ed+(AIh/|Q:w3Q aM/<ҥ"wh5bUZX5G037rf4)kw6l7/E9Pyr֜{X?D`{$%'sc3ۓ~ "~ 'b[[0I pB F*EonۗAJ-8m^-EDJ q-r)4 #şJɧ.#v9IC b6v, zKQh&[jN{z\ !ڞcvol1ց{ԈRmvڔ^H LA.E Q8o5 kGQCϵ)^mؖ+ ]io[M5"GȜSbA=E6 J*U~Cʂ'/hhIUBA\Lb'>Hu%IV Sŏ}^|0[`8EM}/_6|)g`hHbdu鿒y[U,\C5(:!Lp F IB VíA$#1Y(5aAe36kJ,Ȫ G)ʫ̰F #HI̎K?@O,KcKD. a2Jg+̫$L4ZFbO-{.GIL3K,>9ڴ́iP:ZPKB z˷\! H Q?F}Q-̩[FE PPAj;P}23),Zڠ]/۞Mt (iǶ{0a1Q#;S3l96ͻӚ#%ެ5S6U3A@16T *Hj0{ P؅LbTAս7tH7ڪSo[q42+h&7E؅ͪ \q*%Jcm3[H4;ˌlVֿ`ȥ$ KmK؅3P==̋ ŕ&& (ݬ(\p9DP:{S-m/:5ZBA֑XI(Ǹ#^B20)PEPcMT(:C[ju3yPd$퉑YQVtP˶W yFC:\H\t=W)F;@݂M4MX\ 4Lq*?E :MRRڥk]z3R@8;25EZ?ǎ͍UNN^l;#TIݽ0'T@Z+I%$*_M_R*7KeΛX&R \0!4Qm);JK,*Va-[6[eV[g`[ւ0A Zpܹ4脜)a3~K@/#:aU"ؘa(yu` ;PyUּ5:78;ЏPTE0gT(L^iB>6_-_5EށMJ&+{ފ?UUUBJGR$[w~֦=[SS\{, V-  Er= H…*QB~QbPRg( fV+)&?X?pA F-D :Glb+ٕu;]3#8#-S Bg-6;S?)0}0SBb\CEi56>ɳə_=6) 1ۼ_1]d9=??i?X:ıɅJFJ6b5P3+9Z>eVe>KiM? #@ *.5W?&|ٻ+;Mi,}ݘ]ՑIE?难ѝ9g^|(b))]<0VXޜuMK(#ɹTCfmM:#ށ^6/"I\X.\#lBeF FeVdE֦0[v :W)==m,Fi"3?M,˥f ($M@}HTguPk纩; ޭgpB9b>^m- U,fqѾ]sdKC";kIZƠ\dW gʣڢmM>+5=˦grJL㧎3's4bB%9 s 1@i\juRj{р4Ǽq }gus?ώƮtaݩbg=0>3IM$6S Wu; GqAu@B&G ֟uNuPjZ :ovlN m0+tjΔ| fr\xۂ ӺKxzpg0"Ow/6yUb!FvZ*q6.'uUt q;¯,*s-wv. h']#۳]U>sйv5Oseɍ7Ci2c'?jE .xt)/z0`wvt^]{L5;)m_cx{gS7 &‹m7OΫ{_|46g0R͞ھߦyR!?kۢ3f:)wjoV{ztPk$_:'xuoud%ɾ1ky,>w-wlxn~1]*o ݊zBp͐B7>jv#TGy&<2'qQyE>Dl;ܾ" 2H"he!ÆVJ8(!ąNh1Ǝ?z rȐ%& uԪTYbr ծWer}v(؆F {W\߂-WӛKtP0 v)l[q^/ŀ5BfFg2>ÎLre,a8u֮R*k/z55݄FuZ5kܼc:|9s2K@Ƀp M流6+&*,~hL^*gM/!;h&En{ҷ[^@YG}JXuZRhb"d^GJ9P@ ьYG 1PiYA]f%C i\QT`>B~åCЁw*wVwMfġ_hܘw2BzZgCcƧLB Tt ux[yQ:މzr*|qT_'*[htU1օm+]s+f+Zk[IXcAeDZ`Hf#T_ypw:.Z楺ۚ[2TtUeZکO-8Uß'n!La+栨^!uTXK,+w^M`}IXʫe1@:yٓ84?Z;MQ}[ I90kƤmW R¦gU[VܩŽDuyp=i5Dxɝnk53N4^ 5x|ŮWQ(B$ w [:-XzaJ.acUK]F1mGŏDѳZ/ O9i]vQ_}ecoƙVo UnpH 4iּ/ș{oWYNو@D`~bƺ[e2xAMs U1)ikV-iբ{'#Ֆt% @C\X=m" Z"D=lk`絹nZ\Π,񋃲H\'?J)~o,zEFIGAVOx=x*-X[$d`l0jTA>("!MhEɟ2=6+)2IqD&R͑ ꄾ_S9)'c[jPKjGRƏqT"VB B\إ]3AJ"MQpDX5xwZ=.҂= H9Gn4J;ZfTRCV͈gLbӌT(\$P,khesҾ 9}SZ EbATH>l˗9"=J\R?;LR'T+@V;Yʐ; 7ֱH֎U|e&o`? "P!H(L*66eL&c K/m,ew0MU׽ )?a\Kˌ]0K rc4(p>̚_TN *ⳭN׹C_S%eLȜ-Uתf-'QD?J/1&Z;Te ^THKF$9Ýle?{mk1ERg+) `Fwdmp`©l8'E Ӗ%.&61JUƬQ.v - :C/gr ],tq$d#u0܊ \5Z/KL;@Ms6IUw4,Rc#ei-մ|-]۰C 97Ef7k@Y++NKbftw^&x?aW%ŚRbOU#NR7d\mI{ [-81,˭9]* T1?][x4HaCr;q$†C_Jꐾtz Aa3o;bLW )4Slm.=ب+* MZs ^jod8jp9KsFU )ɹ]1w&|튜.y9yDNj"[4qqogF(WDTܜض}rLtٔ;j''G}HqwK1$ dk̩S|i]Son?%"l0L4<.vhV٠;OSU ]WnT=HsKI=Nq? }hZHHtޠ7VCp NZ'~ ^~a϶ܖ G{y{osݣ$wn)A;Lq?A ?\.}!LByTIޱ=Ht ۮ\ϑ`] *5]=䡙d|FT` 1N+ED} UHIdXuҼ_Za ni A BryEbQP=PP޲^aqL6) 1"땞D^o3W vއf<ǡ<|TbtPGItGl !{"Op[.[I)[ 0FJI5قAEhDxY:SUR]0v_ @Fd#Sݣu qw͠ .)BcTC|IwDEtȋ,V5D%#A $3Aj:#M"p!]i`qclHz,UOl) !VY "=Z!b: V#6!,M=&jYeBj ܥ{&HIƨbt(I.2홶AT"+Jf1/f~#y̤M2hqX&~E\"di%.S,hLRLBQHkI9ke= Zpx,}E0b "uUt]B&0Ye]*3M} ..JA.LpTҐeHZ [/>eeؕ恺ݡ85Z9he.uj}ވOnJt9B`K,ǘW):^^(Wըaf$iHxXeA }'D&:=\5itF4}G_PQ:e aYbswB#tf$#L`3==Z _P*=֙]j䘕"5P#hh.} #YLd!SzЭ gg} UΙD*јc-a:RR*BI5b#ӉxUhO~W2p)9d\"jlUȹ꼞Zj%ޫQVLehias rC~m)*aԤ*KfYDFɛgB~&dj?˨jf00uVa&"Ɔ[ub=7 eYa5I\݈jrc Q%z#+,IwJ,9\x ^ $IplN`=  ,&SYFtFk4NX:_vxenk:-u*J9X%k+bmlJO|k.\ެ5ՄknY.X!ʢ\~dbTs,u߮bmLΟX:"؜KM\>9nCD-po =ߥ'ffڻ.Lj8pyzj)Kn*$VþN(1KBꐠdafnTpIXdoUH(d,gC жll]oifrBcmIq[LXz8NEnFen.. ez%+a 3/pifXdtd$ |pzQ20ei1(,$rX**c겥qD0 5W/+eYsY;+;[8YU/w*b j(Y)d(aԞ-)AYs1OGh4i4OδV1GJ;?1/,,ZOc.(p?MNeħ s.Z^IKI[UȹZ ,?⣆Tgrėz9 v our1{)|;7.GEݟBi%{ Bn&O]f24RP&j:5$;FUu aes#nE(H:>sbG%v[k-]391 ~԰&muH_>hF+m>;6&!WS ٹo5F1@S6P7p]_Jgf8׮Et;VO 3)Uf%K Gڮr!{aMR!b7Z)+>b_FYvD? M Ph)k[Xӳ,FM5zfYqp3V| TCū/I8].xe7/Kx؛P3smn:nЄߦaRIfdi} yq+UeEn BJ ewL6oopSM uPG`px4=ИR0]u1w#J04ϚwyO=McxcSÄ$Ў"AMugB7,b8 (5)cP-sO0$uJZmG5-( ^p1Up/тcx[CŶ<ʽ _+W)Bp9Ahk|;3~v+˻7!vx;S!UZIt-AUK= -{]Kې>wr}F\S}yYD +h B%РBc0J8QbE9n<dH#I ʎ MLG(hs :yJ쉰5ZQI.PiSQ&:kUYnڕ@b5f4[Yi٪}fѳ[m{wm^wݫ޾H~Jdbv$fqcOx1e5C3eў6.Wf;j1 Uؿ[xH`J{ޕ7'ܥs..;B`w{xߢpn~kMtnh寯}  (@KP?Փ˿ϫj1Ćб+1 0C6C GDCѴf_(uq?2Ίƫ)!ɣTZ2&dIZȢ,˺)dr0ER@({#3%i©|z(8kˊJ<'S> P!s;;/ MH $jP>бNM2J%F,4X5e2^O0xB%m*Lw}_O>_ǣQ-g8T38KI*dȒ|e8k0X4kUzBv="xIKղ`kƹIHpz5j3 5ཐl[;8Rk^;wK0k^fi|a[ qFP#}DpcՋv?jp{(-1 ~Eq!x,*-9mtL9dA۴2&YcHBv+v7'"qBZc֒JyF^&eؽ;(6D#%XYU^2* ǾoClyYo~'ßB#A.iՆ3[hAI>QR (3E}CNsZs$ 2K&ĜլH PD/-m1ꓷ#8hJ Qoc6[K\<; I0^TNF .nO $VPXpoT! 7rcOAtZ]0{gO <'$%"y .uհfEHDJhW[UXʇ[O#IT򗿴_*S?U wERK?r^kT7i2eҍCH\uA8֩i'h6b ^Xdd<[SɕUC[}S^WS2uQiL /6i*fpbK/FNMA0AZ¡)"p$iiZu@=0h.؎5e(ȑeퟮQI7Fѧr.~ W(]+Zc kjzƞ%a90V֦b &cư* &U: 6ұe q$52 >&`Ҟn~Z"k0T]6xfFVx{K+VSH̅d>!`Suf9MDN{yKԩ._ZUѬ6o2~YgsLrC.xK(Rٳ;d\D V,U:<ϣYvBn Z҉tbӖ7v1+E+'U?Լ3 Wp?)^q_9q!I^r)WYr1i^s9ysAЉ^tIWҙt?Qԩ^u_Y׺{]7ve7v>ӝ;}끏}7Gz}!G~Ͻcgxg/|'oG7>Y{^;qއz];c>7=O}?گH/OO+oO"o/ o-05Ws0<0CpP XppP_p03oQ/*RpP oQ  Ԑo q6%y0 P9Pq\ '+/3Q7;?31 !!,@     # #%#$#$$$$$$$$$$$$+$=$F$G$G$G$G%G%G1;@.J&O*T1ODHGHGHGHHJQP` _3iOkTlTlTnJs6v/}3@NSQ|NrOnRlUqmZllUllUllUllUkkUkkUkkUjjVijWfiWLjWIkUHkUHkUGkUGkUGkUGkUGkU-QU$HU$HT#GT#GT#GT#GT;T ,T#TTTTTTU#U#U#U$!U$#U$#U$#U$$U$$U%$UE$TG$TF%RB-J<9>??BBBHFFQGGTGGTHGTHHTJIThHTkGTkGTkETl:Tl/To2T4T9T?TAT=W>cAoFkGaGLGHGHGHGGGGGGGGGAH7JBcGkGkGkGpHlHlRlklllllml{llmupsnlllllllnéө֩ѩƢѝͪ˳ɰѯ֫תתתתתװظ'H*T%Мsu9qbSiq'Ǐ<9r%+tAiD+PJ t )Ljbe@1IdԎZ6QК+osX y)S6LКjfUB~r@4zW^~S~Hx[;tĄ){ʬ*gw]ڣEaGS&^.qZvky >qױM УKN?0&;)4cGsxW? wuqsʝOjG@rUJI\قfRSO<[I!BVa5GetY4"*Eo+'\be4 6#_ҕaD-8"Z'3V` ,df} ^R R -\veFc RE GnX7d%]p$X,a'v쁄+Hr[K(Ygpt1FQswU1}K!r դfYMYlڹGOIStޮV`۰z a&F_:Vfee^[ %@JElkb( sQ%,Ģ;䢋/KšC8\5[ӇޙI4 M#MWOz)4 ͗BͧkP|IWcJHaV;MJI"f[d2n!W| Ua5|Ƥ^ |h&~ 1w"횛3}bX tGa1]knsFVD?c8Zh䒖r=MoqoO %N=D4T KZVC}ڃC_eyL"ؐ X}Щ^쌁ɀ-3}aEe@av3Rn6*lv;]Fo(uprmb9<-á\a`\g00pqv82ˀ ?$ef3)X'!#YO ,6& 8W"$lyIw6$p!24D%Y4hIMj7Q/&t5  C5#_j#)E59Q-N4,?RX9 qnyCZ$ uTH6ՉtBQ> O9`_ XwnSHdEKjR:ZBS s2:;qvqI 5+)'rH+4e7c+Z#ܣZ,F1tx: g/T$8HϙyװĀq%G@Q(+B?ѝ8@B! & uK3P#3 .x?ԊlrWͥY.JM4A Ԩ(e*5'#DG9ڶPNC9͆M;S "H&SfjUJFOt*sC («h^ 3i&6J!@"킏,mYu2OeҜ0%f`z!3%SnZ(s@Bq8Q $+[!.)0cb̈3+]fpf)kXbiʳJYcm/~9QWqFAwD2A$ 2כHv3IB! q)Y减iZY*ÇT"!0f RgDGf$s/N2d6DZꊾۢU%ʕ{b]TW/ Ď'pk>jM!Na:6F$rّ4D(H5*e,doYӯ GrN !SqVVzٌ5r!K1{dukZ'Xw|(}ͷ8WMXO`~6}׀׶±_h~܌hUu0m̀d[B|LNG1<]$C\68ϱ(O.oqfПx8ғ ZA-F0 G >V1v~g{\Fts&qeC'?sf' RaD0d{~n{y*7XuJh5X9,+}7jg!qFH%9Lwoi:4ޡ'4o r2̅J҅r~q0B@ 0`u0//v~$6YNl6zhKO zp '{8(x(GE6߁Cְu 4{X&0sn>XoB1ņ oP*hKD0p7d~NFt &ID5%y ` &w@ yG`8nhp1&AGMc"(˱6mCqGA1m5 XEYؑ `t)?v5q XVʁV|bgSj^>]&Q:(qqGыA-7hS[s;3A*A;C>M011] pQF븇9a4dW#"e%MYtԈz1ldBz<0A0x66py#P5Ph6^Kav[ 0"{v,7G&?eIQxtae7Uuff,Ut z1 |YdžuO7!j};n(]3]I4Mp g9o7X*!ڣCv Q#GA]Se4lQYV:m_$oCz<7lmutjyz`00 >0P08a1GCs}zs&Ph$ nceک6Tj?D`6P0pXyXffLs!%HH8ͨ O5 R6544;Yz!DQxx`Y^-4UWуW8H"o'm&"V~R0сIz 0 ڧJOE(¥|PTYBn)-¤>2(() Fuh (&Og[5yzt[j!-w<ٝ xqJaj( awp9y] Rr;NV0w.dBz.^@[;+zXzz~W6`0`>!r A}ÀLEy׹CG;KhG&˘d<-d9!{ b Ѡk۲԰V@'LcoKۊ*7ixNaQ㑓ѽJQ:pUڵ[sPL FI3e ,ncA`d|E'VG΁H & K kE]95_`?s1hǑRYcFuzBʳ|v Q-E+k e0K * F¹(]ˑq(TGc)iuh 8MNۇjՊg]˵4!e@A4Dp]K-KJ!,dն @VmSK&wɚ|_lmjAR Pg *r8 hQQ8e B68 '󩛡5בE)7L) $`0`ݜ8 V'EIt&e_VW1&s"p 7~(0la w`*;s̆`:Ay0@{[r54""l)91+m!ӬHn%LC9ʄ : J3 7-GjQqD]h+@B`x5IÔiBi ֮Z, 砍Gw<5&bcdzCzdl[r@jhϽӰ?5ֺ +[M۴ {|Xk.`phC4JpxG]e (P"g1q5+ZJ h j/s`_q d>u' A;꧗ӁU:F/ ĽRų"r- dv gθ l0@Dۀ"(7q;3ȚAɼ<36G-ѰִZF㽩QZ:s{s&ͭ-}3HqS3]ƀiq7d̶vhs$QIR[`Nd>i^bL&RX`=l  F ^AgDG@Pr߱7/K\0uթ=;ʳ>*`p:i:yƎ[CYD͆|hmӭn1"4m!q'FB q*#X3,aTHU+@sVl +dɒq*mSz1c▙1foU@LL4t9q@IҩKL*uhSH1*$G$}Fm$FB_l+I[va{ ;pL$rY1[ϭX.k4ɨ#xG;$*Ϟw{4/ "p[By<b>UBģU>3 #z/sCsa)  |R)jH1%3v;zKc芇I!1h%̲Ͳ@.y$)IB(B$mjH9j#6C m͔0Z!|mj#n)İ; [uHI׃!EljRa@ ѧqaԵ2kQG?݌.#P儨(k1t;1e%+PHd+05NVUO*`0 Ґ4QRD^^i*Ř4 , ӘY+IT#2L ,1ZBRYE$%J9+Yɚ]VG= xŞL7A -Rql:O[c"MaYK/hx9fC2:&@gbcά!_4x;%)[ N0TaΗl$oӉ|CscgJ,N%1G/T{_ c)G cWr!\qǬTt'%PJԉ N>8"{'sV5ЙH-@>Ju fXiSۓY7jTe|4ZUT>S5x$%f*@[N⹥x?58SN _ Zi3`V iex݇8!H#CI\! Â}LV&))k >MIX$D_2O!C*@(:c_Z 舲A2x{Ժc?N{[ Q:9uLl l#0>I$EnM%d5Al#"s&6<\!YDMb*.Gs ovm_I.k\D֔L63Ugqo1䋃ĹNd* dj c!  ~;*$,ϒv`ex"C&ڎZlG(XeScc: ij2VV6}1{mͤ$xҝ*09,pRB*}ZPbBX6% J6h`!0'Z. F㶆I . pKJXc&+aq$I M.Z-(;B)!V`RI3j#YsRC/R;-9qXMăiSӶzHejQWI[Hv ER%tE!tue"j1 [1bb]J6zuovT6v{tv75ƴaZۘ9ЉN*97wbEu/5yۜ?; %eq]JQN KRL?݃H *˜kg6P[r;J-VG/}AxIr υ;2wl)hށ&C~s#| Wlu-N+v.-dɫOж*` IvjBWJ`=!W1uqIykJ Qf8b6reDIX22~L(}dAecbT&C1\gմGo vI ;ǭ湛Eذ82bc !h||]E͹?Y5o鵅(Y Àg|ڃka4C+8:[Iӹ@f*B Aٌ Z#@ay:fi.1![¨۩ư #3 6mB/#4pEU $=)0hXq2Ÿc9P 2I cGƳmB ږq$fI1Ay  . )b2*c42=lK&jB8U1/9$`3Q/ 'pH.& PC?cʘ;0 #0S7`Rs 8C1obCgg*%68{  ŕ%B1( Դ 7I@:y$2:qJII'y@Cڈ@_A3By9tRAFw| :~nrݛ>nSæp;Ha{c\H -MLj"!0)0qWLs up_ Eq)1+<:x S`x0+ut_*5ČoDI ӫ9GKR5D[DD%?,Oa44NE (doS+p .Cl{0蒺ܖ$ RȟKh<)R  d!T,€R HL/q 0p`x ')L1jj+ hDcs5GQ22nVE;YЎY#Tĭp8*? MBCNGL0w<Qh%MĶ8LYGVg֋CҜ) PC+( X, ؃*) \ PqNQ E*ř2階ßH!^(<#r N+pϸY[Fz(^նꌪAe8rJ]h!0nګ?! f`ܶ8#p @0hDJ$3(|]\ET.7 p.UQ ppQ PFڞ06qPm׾聱P)PeԛOfMฒw@U 9@`P؁ŰՒ=e^f1/u=-z>ENJ +pŶ+ f2ksލ_s5^vcȚ ^`ԅ`L1֛pFH2$[>Æf&l 9 `0iئk0 5i@0 UqؑFq Q==Hmi܃gC))YAq&kuڊꅞ̢Q}7>]M *f1c S30`Ta-/jf@ QAj(Fʟ"-=6LYYIAbDP)ۀ.+]c2+ga"2T ې}u@'4SB"dC` @H&ePdCؓdOdNMXedjvS Ca3yhV<+@HhJ}_c6VNFkR}~w{&=29.1T,#}e3ܲ/7:l x+1(uwv ^֊꣡>Ugv[ (*Ch͵zO\z8NHiܦ/–a>-5o6=Y\8^$Y4{$t #ly²nBeJR?XjcM7|JkINY: Yz^ÙXFdݴ؁Y? ߁y:z/96#*+(*S'bNcTb\{ %TZXJY~҃4_B9ѣ pR~:Z>ϧIkn`ppg:Z2Z#uW7>otZVX$vY!ÇHh˜^۩^! )c3FpNZbҥ)+Xq"Ơ0BJ']ExaCtj󧱖-{#R\i,+&SƸA0 '}.Ty>A.K }S):)wܝu> %^&\φgsKCجg϶"6U uN<炞Cf#Rx9@BcOL I|J.4}k`Ϟ-7csYSs< tEx36l1F_CG0 y)'a/TCy9]Q gŽ6m<5L"gM5v fPu\mt OLl41rQP!V]%z$UTRJu %EBFQb9f;eB0B1SCUX1kfbU!dC"$")ѤBYBMXkI)vO0dsSUL"M/qӅuiT$J4ꧠ~wЬCe-tL:Yѫ-V:5pe(A'2LKk&X񆥒K= ȕ>nQ^JV_ Wk}-VD/XC<1ON8QaBBNxn.؝vtS% #F֌QjW#WEgC] in&Xx:Fq:I̺4駙f؂Z>''LN"USnP P`>Mh~{AWmS+GǮ+Dz:ԟUt]{ 5-$=3AH-nN RP=& D/:A$ RIJg*@%<; .sU$Y𕕮HZY٠xB *. !E|8-Sc}IӱZ4B<})Gl фFbjhr(Cg^bzR 'n9 ! .[pjr>N#'FG%[}jel 1 $8GsZ& ¨o-rKD(.BIdh2 SDL6MtQ E Pv-c 1TL:ԑsd:ǭ,%c(e.*SyP8<\Uy40$ wQI޻n>Qpds2E< I>$#(R%}X)q m*TD[h$j1OBp.k@*NANl&inhLӥU8S"J曛% m$V11xX"4 lj( 7)nأ-œ4ŊVjO6>kLH, XMwį PCJnוP0 x'3md̸1QcYdD/w"^5>M%[p]S,Z̳!/LNeR7X%i)] Lj=$=5c!G{JSXƨ%(mvt5~ c/KTlƒ> &E6,{4;U?c۞^!Ɉ}ţv VNs8D ʙ]Rw!TC3GGPiќ&$}If5IdlI}x/& pBUFaQ߼ Xmt%L\J5Gܬ&ϤI("\r۫\H9"cFDٺN4U($m0KZUT=ćU%YA? p}vљD)HeԥR:IA| !aI|vgsC*VkcrbN!@dIp>]$tlZc &p l`^>3ѢD ik ȏI}.fI JW|M+ŸyMѩC1+Zj->œ9C5#h8mtÙDDe602k:J#}9k̖J?e?Tʬڡ[ a^y@-U4QJ̏hV 7hDMHz׵SCK :m\WŔxl]p X$A d]Jȇi:M|H~Y켘RS1ԣHՆR"LADMF iA|ޖRRETPxZ|8ݡHل~HᗜSTϫsѠ5bPCt+ $%:9{D@~hiVKHΥ =Aԅzv-qyI*'0GP_T M9`^_:j}X1fyӘM)qQ ('dTx$U]IPv5B]RyH"'7}ĚTN% :>J`,&THbDKPyd ~NISz ͑d>fa5 uQu^\O,TUV%Ġ4*cU\X$DS!Z*g\{ Du-h&k}RϏ=7bmT E{LE. rQp%n9cVrAL#!](>G45>|E{g(*^`~)G&ҧ|g ZDnTȞD`MH h ERfVt^iMiO PiJkM蕪ܮ4y Ru/&qNհ{c zjnr妈$"KJxfpPfYOJmSx ЈQ*}~) ZtHk`Y!m_at/pQnƅg~dw c fT~1nK\+xP *kE#*i1fD" y҉2iY^h L-b.i5Qr oN ow? Z~ZǞqToRj^4V ^0Y/tNĂ^>3(sHet-?ݐWHrmF2FIˆVD쳩BID(" 0xܫvq׵b:%.JAD~gw1C풪23EjtY5Z.dxnR 3Q@O9N z|_BiOPWQ["(ShF45,q_5R8nL[Z֥ ZCY۵15O%rD`kՁҚIe9W98 Hni=$GĠ!wڂC66,*Lͬ7vͨH=F5 0&VA:t4hHl.`M@7uPtsKYnn<曬aM.߃olf@dx#W'6.:!f'{_Ui!GLnx9b-@ckex~8x{Z4EQYK.ͷ.m^88EvUIٽ,/H9Lv+x+TRl E ÓG)IF%Y=fzaj@̒1wM7 ҚV;KXO=yOQweD4tmc D*ܲbˊShxv D8"s)jq@tΠE Mn!{x:Nေ+(nX`=^3XccjvUnϾEЊU.|n^&o衅Nk" ct=<`SqGƪVҝ~4JKcH- ) \7~6w[R"+Fl+6+</+ Wxp߆t6UEeRT<7S6nbK9>- Yf`u9:M".y=.gX"oʂܑo>RK߸f[qyژz-H,"s "+a:wvH2hxU=6#` =Sf@=$$(;,>J~w2a#}R^$*2Cj!VV!pM4)AڙДA(F3Hi34;NkSq$JA'ōxSN@0EaQ"d(E$Lڗ*(bd/9-n&iC?=Uګd1Rͤ QD4P\՜f06Fխm&\x癡tk^ xs*I*nE`lXr5ՎEe8ԅ2D;+d6S[/J.6uiakFDNn\T%:8ة#>Kݥ"i;1I֖@"-X~SwXX5g bzR3.f-b =Ѓ%"cУpn.N=CK(ȟ$t#Dd9B&g+J!:2T,kNG=|`^*rGȜ#NeL^ڃvcHb $:eEp?` Jvn7*+px fVnbȉϲ<$DPnQ<4 )JS#2 ;b)oDnRiǏ|nv(j&$`fMbM\m&@dKNoـlmx %;.K$C+)B`*-$g,/7LvZxq)G2fL^kY2{ Ȯ@$c#bpl$`o?j [2$BK"4M| %ke7BBb )M@**ƑF,b Hi,ɒ,s2-ݮ<ة.t.p!:Hs;BB3BDB0ccZT+eMK1K MK1NM?"0sG;3X'8E@D$،BM܄WZl6~jLdR ifl$u3S7ZUs* ſ@9ݑ912#/ȣVClB";ʰRU4:(.<]*#+YSpsZo?-&>r$5$?tZ8L3 v$$4%Cu+p ;U`RU^f˘*68hInMJFG@1oP6sW(I$l͟jB{%XH6-#EnH0]SȒ%NMlVM!!4j3;td9IHjoduT?8%zdkPWG.gb(zۨS+ZSZ:ޡ:'ER\5Y!vw5ueYVvcI_Vz_ya9,-naKiFaPQ}YS Ր闙;ZEF!"ZZ$~۲xW-͟mV%"b'ȗVi[hc;yՌ b BUj6O)CqM|nP:SqGխ6%(pTqn):Zĸ? XR(30W.cupzWKKο{E &SԻH3בSlŸB w T;8(WyÖꈣ#Mſ*JhQG3|tGxjKXF1؃=ɃQ$X$d*;JYFr:7S)" 0vZ_%sjGDP.P7-wl(Xj;Ps]i&y#3w\u79>b qA1:#H| a]Ɩ/w␖FT (睝'|7J- 023s{iiH"P:%a8K$7(-->%ѹ_4n_&=P5Ӓ@u^PjEF)ΊXX/c"hL OY!cB ] 5&$x#3ʔ,Wl J}H=iTB+]n^3ϡV-ҤVt!S;j bT %,9Ț-ڴl׮ n`6KgSxu.;#|u`S'` ~{Y)dlXUDV?}!@V$`Y$X"` tH#\XcRX##dB>cdCcsRINzKtJUt%7YteV Ai ?5H~MUT{XuqDY&BI98QEEwPw%q)LSJh-=ҔSK'UeI$M?*R6AŔSDzBUA %aETUYVY.Kl[6Wpx "XM+m^kmZbzyFngvnZKߥc\9WL%_=֠r{meG@-WB"qegqxDZig^{1Y/ӥ}O!.貚0r4ʄ;\VC50FÁb(b=N=5;R$Xk]$\IUV]< S+e)BVY(E=C+\VMgV+ffU\&36ZLZ'AR2TLHY_eŃOrs < nlֵ=5l^ 2a?OmbK}?ݹܝg!{1VtBq_Y[m`}5G/ ΄s컫bI-f?'3,=`{̃A\3B-AnYf$LyKbzL 8RBDE<ዲ y-MpxD ESD Xw.Ì 81O*E.+' \ %-GdE@rcۜ.D'\j0ct3 vH29MJ?v49S-" b 4p-+K-u+h6tMoS 1,~%*c#.hk4g1{ lӧ@)N[) n dS7cK1H3 mVS{+9&5JrHB^A-!1W$5TBRuRusk:}(RKsX*a;~a.COQv{1tc?!vk{ wyE-lT9m(3, "ۢ w#@3HZG!%+J< |ihҮ #B·~VP/%m0. DD(HIS퐜'$%Eү9f!ޚ6E2I(ӄoL~<#V`U&,xƛd;jE.^$&%^ 3Qv>s"9 D'DIUG%V+TU2S9 G{`!kY]e|V>`I(;OȥҚy&5&;gn?R/.p 7lboSC,rep$i&DP <{+#QaE{8&_mp6 8MY-iM;#S=&lhES!s Ԯ'?zv;$9DL$.6*k$w[od$ى815ֵ̓Q= qXvd㻥E#?TYsL`Ւl]^=3aƬ'<+ ۾Ŗd0  7"o%JRz-hjKX[HnKc䖰JHVfJ'%dTe\9k(K"ۧBr]*{\}PN΀^_j StLM/7RT|MO[Gci^WiāUu1e1)!^vGQ悹], *|wVxW#S+~!DЦ5Txqpf@qL V5(R>FnVHzVaWnZ(]SJEd24;o6ck{kolwVc)a 26ydwJRJ82F*:VdF;GDs4&fsr%~~6D @ttEP?AD Qߔ)~u>'9>X7p!uUAvib7ZDZii!lBv3sLQxQs^:$R#KS!l;Cw_5#p?DDْզ%F0+\E>5Аb%h(cezrTX%9SV{TE {6V*9<%2|xmg@A7`yq0٧J֗}K_4pB~ѣW-rdCiڄ@s 7ZW+89~$AZY;Ywgʘx)>y zyt . .L5w8w1k",R(^UsxxxuFelJG6ͤpsy+a)( Ԇh3SVMUőq]ߖ{jT'IV 醒crmuX*#P 4A1^wkr$vhE4P_H0"L#3y$G3?JeV^tE/t(Va`2SZ2y&8Xaz&BTˉ-ɒ2&٦Dn&g'! gdabx+YD}CqB=)[CG)fTiԔUi=GZh7{x"8!Qi7s^ت٤OcwɊ~^2j)4JU'FQ݈k2'RAQ&C 5*m (%jh@U% i3Xz0U/-n{oȰgV b9{@d#"d!VF rP  ;LYw+*'1RC{ B_4j=<_=@BڙV9PFn+oVb2cVtm|p"8$`$1Elں)95 b `)L &*;ZJs*Hؗz-&{- 8LaXMQIw8b)&vg Zg!'&>!t6 赺7 d;)ܡM0-$,SQn;$x8SMjlJQTf'pț7) yfumI;⼿oѻ*q˜Q Tic+%Y |#y+e`u k\ñ)'q42rfAr(sȽT)[Ãrqr|_ZD5k6.s,t8HW1!#Pk1ؗC]+ܫEAZ15$/w']++zD"^P3x##&#t,`Ȇ;t fnh{zWHkŏ;GpN%4ng@$+ oqJ(#&3‹Ƅ*'87{u=2'[~3k~C۔ݴ3ki҈BAs{ɵy vOQZiRCb4!VMlK*ٵ*Ӛk8Ŗ4 9—x.53D ~r"-ű)1{/[*28T ?9ʹoFQrf !a F'ŴY6g ۹p%H*|QH\QoE}/ߥ~w*iM+bF"+P ,z!@{@$ L[јjq.!2ہAI1D rF"E,2O|jŭ$<(QZvSD1$1%T5RSõRд31h1)?K4PBU\"*џ`RQH4Ҡ*^A-+NӋ+cT^zȸR ҫOŠw(GQu̚*62R6eu/cDl#izKMUKoL6t-M]Ts7յCnw O"N|W'[>6=Vxa/Λt3FjKyA!´3'2ÆbX]TW qKMG>蛁z&˽P2'2V,A֒v8˂̇.YMvͲ4L΄/)ϓ#? -t@ډRDi'ꩥF)x4/JFE0.ɹ o U [*TJW++~nY͈/5w(LלtbB[ČE)Bm+aM6ew]`bzmik]}|;9N.`Ү;aT~ $? t -s}zI-5fЖ 6OXr%fp+ᆾ&&PRhTSPLGALHفRRԁq@!K25:N\N#BEO'5R fU 44$e&jԢR"h\bFrRcL;yQV-X|3-Q> K2+Q?]?#ѹIY@A[@ \:B:֫b,G+e8d. H4 a5F,*'۷rꂥw@x*C?R7摞tLNaILt1ͩ11;J͑1#,:2&72l1D2 T28KY3x00õU삻R/YL2?"U?]Eժ!<C41e|F#@pFx# nyz!H3DžbIZ"0´* xR+%\5{QLX)!('qI294S@юB9bɕ-L* 7Bîa7<.LC:I 8DĜ&KTJ J#1$ı#+K]Ѝ{6+KC\Ѩ:+"9}鿟+Qa-pb:nb|Qs"5a]:ŤƠQq {%٠L4$-R9äд@ ь:ٌ@(})*H. /O #:D/|:lU@0園ఔLokN D7A}Cm*TJ̾˽G˳^J@>ME$CTQʞ"7DTK12&I(EtB( а6E[-Mc=\L|FjK;g m-=ydM #a.icP L \,Gq=uMםG++Qdݴ"/1XUFX5!rV+ Aٰ>2C>DI u#㣵/lOlYt.gxkYԖT į4Վ51ُ].x)R˶8aBک sP_ ^ZF-b<ќcչKfFM8s2&DPQ,4UV jMoVp5!!RcGI4кY.IŒ((dgSbgT E!b棛bjT.xUAr+rv1˚J eE{KҙX8FU{Ni>_cC_ 󼹼)@>^"U<93S[rj=ft N~[)KtP4,1L+rk|[IP`jad&Әc]*$#NhbQ@hBmj=+j\w+SÁ,:)hg=i)?1Ikc06Xk"hZZ󹾆&[K&3HNQ3EP[Qa`kDHѻ~ԒZC^#8U2FmF6ݒ][I- 憅ѸQã]>M #kldfj!YTjHDR08ײF~?y c66F&d9F}Ɔi&B;.el {YVn 5?/ w@iG Gg^qBjUbqxq~q{1N7k!_lkcN6n6mŻ˽rCNdCV1O9=di[vh>qzvbl:lf.5VlppenD_FqGistfFnKOMN:_7Ntj5o=PQCk%UmCI[Ž7Evm*a?a7s/dmrpIIuin0gSjlWΛnGtrh&ΥؚVNCff*Y$_*+?r7i1dʈ:ڮl"Gv8Zv_6o_]lw%(Onsh7?z]f-pOKO OnX'^]Gx"¦]˯O!u؎sM&lʦ9{B0Tot*g7g0β#zVymV:?zW vhfHj~zgw7yq)1 R<Yt+ Wvxr}\_w_*Q/sg~xj~xIuAs6wsI|eވB`lVѓ]sr_l]z\ChfrgqȊ9 ,:A /2̈qƎ20GG6 d` &Xaq&ǍS֤3'O-c sN+]Lf4PѤNLRȁ3b}$˕+ZG4朘s6Zh߲},]m~HdHT6{SNx1Ǝbc ylH+//iȹ2ҦONRM5o΍ț,*r8o""󡣟 \tO{ח}S$R|6}D_S7Ut EZ5\>aERxYT^Hb]|Hx tXy)fea'5A)'a֣٤OЌMP]HuXcd[iW&]po]xXTsZRkG6G`Irğu')KuebѹQ]s%qEn=(haF'nfaQ咍;viAZǒ#ȂgtwfpeZwu'NYtz'_E%Juy:W^`D')} y٫ӑ{VB%Fn:Gb{T8HoV^P]G64*iZ'sQT4 wAV6}aô$} &j6 K`&&Pll6m͇<׊T|6vkKcT00 yQjo{OF:~Y8'!`%uHcױPr#_ OK Yz.!IJD#:2tL/zŚh䣧On7 _B'8^aS:&}0#X>ivc-qa =Fc (f1Bsy hAI(#%zRޞ4Зd2iJk$*3,T*dl^t;a,rHm\̡Yr W֤^Μj0b/n3SjL^b6m*b}_E4%E~ҟ:[s#3yXBZGNC #YtӒ2$t)G (7X$Ʈ Q<.kNh8Ozkrݻ9IR:r.IkIܟ0u֍W>"& I(GYݪ2 ~"ÚF}>bbRȖ"*"&3Yot$n*ʤr8+Mif"bĞj`P&5fnBS 9j@җ|_>q0܏>Ό ]֨NZz'EJl"YIDE ł} bg~gEbYtme{)Ud$(Ff tXW)hlHƩh%䡔]6*Q˛lNZիҝ%fVf .bb-ݎ<A3ݧBl(2D q"K5V QTBԝ}if"n,!\ xTLH cjڨ4fv1+mTVcz*c%\%ng\Bp<~ u*vzEbD\ dJ B6R&2Fi eW:\nʚ̒DYLDGQncnm~n9&0L^$]桡~䥜@-k^= v\@,6Y ((p&L.TOTo%kDFf΢,1/y!.qh0jNمR G^Ӝ`lrhR`S)|f7r`lpV1K-EtIۿjmeA Fs6gHcBْp82/Z NpX$:rᗄj2G1?.*iGSE&"djjC4mSt+R./>_Da0NC0^M@ƎJD.TZL+>Ym}"{KQwC]5 I h"nr/WXV&X + ",/lR`^GL: aWF֦* w8/i93,m%F 3 jv[bo5MYͣRj6ekE4D l#u2Y2X #_G@ S5D 2.Ig4H f7 Zox9 i8)4r%hw1#ub*ؕD *Q7sYIkk0,BE?5mA/u5FSx%,+s_=uT@VIy)~wk?U wIvZ f۪{ > x2'6oWtmLlNNuLGw:s Ǘumk[[h.yS5Eѹ8-o1utjv_JxpP2Bbxz',uyO,Y i5\ !Lv]_s1UiI0+A\bny(]5V;>Hd_ӗP`x̅xxb/vB' c3q>F:&i ҳL;{*ښhk#g{4^Az/öGxtQ/Dg(zj7/Fq#H]E{z|h|uVϜfؐC9\*f_3Kx{Nз>l< 4vw]C;:NqwX6S܄f, ^CqZxaa߻JKo7Ɲ󐯆QnHk_g3Oc#cDj; xs~-o?|b_h8[4pS8UMCäyyn[رUU_ b{x۟{4߱D^Mnнwj]OյwN - *+j*r 8K-·T /@0jTLk14em< i@ 0Mp$I%q7'\IM,#.2K*;22::3C(2#гs%yp#X 0Ubx 0ňCIܠH< Z `r(3$+h1f8a׺ ~;iG."׺x'<ĩ\2$.נwߡWV{!y"4rjh& т(jڢ)nt"2DFTal~B-IkF$.TUH[}ܜ7H$s2ȉ2atg_>\zO1-z'0*#dU[`Mry$#UEfjWoS;MHhOz!t!ݡd_[XX,+k(E_59~#RP^ƕ([O^Gy)=qO _ן'{[>/~OޮOow.O;/~N|NJo!j)7/>"n[N0P/mpޯ$gvN).  P  P !!,@    !""##$#$#$#$#%#3#F#G$G$G%G&F4<>0K&L-O6TAWGMGHGHHHHJJRVWg cn$w-{7HSTTmUlUlUlVmq]mmYllUkkUkkUkkUjjVlkUpjV{jVjUfUaURUEUDUEUxGUlGUlGUlGUlGUk?Ui4Ud)UV%UK$TH$TG$TF%RA*I;3>>;A@?CCBGFFQGGTHGTHGTHHTHHTIJTHiTHkTHkTHkTHkTHkTHkTHkTHkTHkTGkTGkTEiT$HT$HT$HT$HT$GT$GT$GT$GT$GT#GTAT*T#TTTTT#T##T##T##T##T##T##T$$T$$T//qGGGGGGGGGGGGFG@G:G3G9M>]CgGkGkGkGkGkHkOkekkak]lilklklkmk}kmox|nllilmÍīԬתששששתתת̎苴'H*Tnjq0_ߗ9b-C W ּO ES ne*jYG]+&90xjEL3A֙3K$xyqH.&py|l'jd@"W~:d=mVvLEtUCʔhi-`~߉6nn }~C=t+DK%M/ݛ_J;b 1iO\ݱM~ǥ!*Z4ݐ5q+.#ɨEQS#1HFV̎\4_" ,*눈PkڮDG]-KB ttH.s[ v%A-LdӈuȢ%O?^LجuB"`oF*`}P,E[|r)ҵTVSP|LBØZx&*ъNP I:L'p}Բvx>(j֕׬UXAX "J\7CY`FE&?L`<ѽ3a!cjnTBBbe[i!Lr(0+/Z,B0$qZ F)gRSR (=o"J;4e^ugGRQ>18c0T5CƪxI`vWpoJH+qDUk5f4{sp`ghKL( xFT"폨dNXVye/}LӘ6Y % ;&tFL) J0)A'ˆ"y<)MLղE,9+񿑏- @#uG&Xy[#W/KhɯIƋOU&;A'\TX63kIC^Gs56`TV+} 63G"H40zwX6Yu,/(59 IPqh0(tB#y'Y%mRi?Q"dM*"?rW'+Di֡DJTM"ǒU 6 0 U%%M MON9TQO J.P[|qH&?l#OO8jUgTgЁ぀bfp2!:'X2y$tC7;>GeGC33.9R;f>!|2!p;A7*Gs:S4Fz1'"2#f4@pP fp*dpnfya/a%2OsdtX8jqcB6@vx9$MX05jJ%,[( dOW(r J hJvxut;!/-Jd֖w*]\A0#H10q6209%P\HwJq!C{+U.|" 4%ߗs;aVMOGHHq!rdA4%"ptSPs"Bc6ٲ*&ge,(%T`8ٍQSA+& W%/]jWA3V3iz0Ɂ4P5pIEg*92*!y&$%6=yu4%R$ 1exJ`f!a:Vgp@Nl9JlGvit9`8J) '`Mph!1x(ű f4}+Abjʖl P(9 50@tPۡ2& 1%%TS&z?V8 ObuـtVipdsDMSh"{>{WWQ >K*%HKEg@냸f@cS\+;!A)8ݺފwḿiq ZYʶ*Yv@N L/ID[Jyȉ'@w.AK.q?3lWK (\hP*Z%SbEWOWLAyH[)p ۻO % ,Aa1f@[<XEx Z^gjGD/r5 59Iz+7(wԅ*P-G ;O ΐ'dHsRR b*iM3 =C0P0gD{OPuY6vCVbcuYDÇ$&;QڛA6iTPJлȬ8WW@8hĉ"1"Ӱ g̔7{[QPbqg&i%< if'!*xDaoB9ŗ\v:ɑPS 9-q<qhTphn b3:@i=9G%/2R}OK.AoW.Wh5h'k.ZyO!-c-!==W hɌΕ I[*?D ʼn Pո\rI&]P a-c $ZSC2!A ]IYMXȅ$aȄk4u!(AȦr 1z++ qq-ǀΚC= pJD~KZ  Xq <ČF%|ω1)"˙nA E 2F!mjFRf\踆gK{A؜zZS$Oc8rաc"3f98ѫ][WM0qſ嫇r"'a&q4\'|EٶyʁW 8u[-9$yuQJ% $/Rfp;R9"$P]X ŜBga ow5 e;e>d;!5qL{A{Ӱ;1N- *7HALfrI ? ړ{ P:po K ܙ{[r.=kfsCR,~;>jKZλQ,1%;3Hg%FC&=a..`=IXZx}i%}&8ff%0 啬sNA9$TTNxǑB2Elu7%)"TRӘ(P\:>6gNK>9JhH茾uc˵av!ev̲ ݻ[SHDѐ%ZFsڮa c_e.X[.Cw<+֠C2կ]_Z f)M(m@_L.5h@@` !xX8DC-^`ƑF3y:~4'dQVX+.gpr:v1g1Gu('G3fLbJNc8{jIU$MDVAVy]5*ȩ$C)[0~)1RذJ޵k7Qp,ёjY8N#RiO9F "VΛ7GI-TL_yBE jTRB%viTJz-YZj樳NG" L2. ̘16E6Mۥ'c1:ϺZŤURJ2_'ʕ cdJc-#w2.[KפD`_܍벋 Pڼys/8㴸Ͼ6hUښgٮ)|PݎlDji p+ *@OL4AZtsNÐΓ8|"rws@7w$Vq9x2,ʍqʎCʒaujE¾9:vz=0CJU bJ\.gӦM<VŦ-=ߗ-JhOa3 _`k6ŪWtr,>F`F*!"E H 8T '$!B&ЃAZe&*P$$[1]dQM1L%P21g_MT601%RWIx)W*V0c| &d_ٌ2E8$HTIǂ E3/h` >|':ױ[ȼéϺ'Q4'I<2:4 ڮ6OsV jve^ (.*vH;R_:V $2-Y0B$A,Q6w1 3IBޔR #* tS\ NTgI3t"qF+ze az֫L'"WG+ V@'Uc#J|dҔ4oh,tYYVlJ*tކ|E0_D'۬ׯiJK x`IZ艇}E֭]Bh"Fd&,A1s7BcQMb,tW VX M69($Ţ, F;PBM gfrI-DJ:%M3Tbɛ~fuJSɊB~bXui%Ξ ~ّO!LjdD2tiC+/8}E SW<&2r<{\a *6CUbUXu0VȰ edpȪRVl#>FO3ZȪD_u "(^3yǚHzH 9eLp2┋]Nlbخ^km+T+^=Ij֗@yq6V\LЅkΑySNRA`gAN&WubF]푍)$x);Of;U^ ܊ ;AOD*+{ y5`|I*ҌBO9jy= t'IANEϝ:S܆)$q}=Skz})sVOݨ' q20i"E'udb>,ubpNaf +ptKX ǧ78t5˦3JL$?U]̯mӚ =O0bIe0Cم~n#j9E 8b|SÙ'!ge[%=r  GgH(6iSDz¨`;!ьm Pȸ͘H }C:ȫs80 ~:kWD  ȀzIZ!3?;"b{Ls:pwYRLˉ"/QY'Ā  0jrE3 X93:D8qZ. :lba/{s };t5; PN;KɉmޝpSe@a `jAXݜve0au9QRZ% ; B5Y[:šLldzq\a)iꡯ %dr2\,AƐ8!n$]-R8k(UKA0>qj2F303 ^*w5736fc8v㌘q3 ܬ̸ ;0!^3`(ZZL"Ա; imQvܟ(5ZWV7#PMֶLe.DALB؞eռ -6lĢ\F3K /&:sV˥E7`$ZBRŠhP``R^J-ć[3c}Ahg~ - G}6X`S7byd }U|K] sz@ҞN& 7v99#w!$VKcOk0ikW/J i:%ƪ*`ZWuګu@?bZ?AWt"؍U5FR|<@U"p&5|45ShhX0Sj-J(3J~nw-,+DޝMe'E5qTj\6kH GPޞ]HQ;<-1dQBR]k \W\ͼOCkXT&ލ  xCVTQT:j3=m4%"i;ܾ80BUH]Թ MgGp`.hgm-,l;3{c}}}B3m*0@3eM㟾.Yuk_u ηe Rt$HB /ra` DyAl`bކ%j ܅|0͘ڀ*ЄƝϱL$Dمy{:=&D@% މˑ3AG>x*H[/{rr6cSc?;ƾr8nt5qs]G[w>RG 4D~MO=BN^f-\hG 4VTMkfֽ(m \|8ZxJ/j fc5N]6 i2.kLg."(Z`|ӭH<ɼ>p0dN gb^L޽m>Ey Þ Ir j̇Z|+rt0 Y݈" m ~} $ nc18u״SV3z\/ZJ&䉙- zŧ ЄDQOuE^zܔGyqaKf !']KjD!$R"asx!4ldvt7)M0AC? i@cNvC$.V8+˺|ۿo 1o۪?qR=M|,7Y#8 =y 3Ӆ/<8ٷK6cUkTQ jXaZp婸1s=1c&G>(dEQ~BeK3'XQGpVyٳ'_DbdfSR%QAv94 rjj1#OilǸnkeLәN x9Z54gB9v; \x0cΥ} 겙QfV8K893XKpԨ tz-ftpWd_KqM=WΉF]c]M? by(twdMuy6OkJu;ߣcƵYd?FVP]_X%lK !#MhF(HWQEZX!#HbQG[ 7UC!<G2!=biyt"Kd9r&R-dLDUd2Ui-rDdgFbt55=TdC$1!gJ4J-I#A7h\ʉgX989P闃hOHH^5PVPEG5vM4s8`1qp8֬?QӓfX%aQHxxZ#)E(T#6!iLcwȶDq¤TFڰ1A(L]ԗyS:hv$R.SU4(zTG.ֳn-}fPqJZ(`DVlւ.ٳ9;o@d.rT nOmbDU6Jäl;]KeGA.x6QkpY:D:±5T]Zc 4bxs=b]*Sّ@TzC7&vu^ *f[ji 6hhRWECiaԔ-8O.w,-zV=`VWS5 ݰ"lͤ'±<6=Dt)`D)I.V#~}A%d3XN.5L(1(pD=8 $ׄŠё@M9mpo`FjB@qLʓa,szT)CcYG"$p8?j F<)ɭD(V~ɋVU?='2z$gF*Ƙ7߽\s$g>Dtl>VrBrp#8os'&2x1lv0߈鼸HHdc4#ð-{ey$"~G,F:ЕJ}g9R(@g&X(Wй\ Om>[#F@]*\u8^Vv 5 9yPMk"6#,LFl/!cv+I$>X†*`G9K6T3C X/.Jr31}u*5bw孕$u}bS4 4H/ZpB![3[%%@!V&qo^ɯ-!(¬| fJ$olzۻӕo匓EF6 |39B%8#IFAKcIE- (mboY.:7vKBN:5B(&Evd uƌR4Q@ tg :Wy~ >eQ\Fj\~i\/톢 Aqmbۑ'ԠSE8@_Xc=1ñajצ r SjTU-e5de`kHCq\ytcV)bZy9hS;1wa0 LiP,ɁЙ8lx`Am$\ߴ\ԠD2k|0I쒖]MH<לA_܊"՟(Ma 9(OTޖZDcH~J:a!(աݛcH1o` KJ =W%uWȔZfċkba9Z=IPDȉDGEN^QM4F$ItTLJĈx ZYc=*^aXlG rWZVGZMK3 E=>N*KpzYE|@O=+G%0 Fﬡp<:8ɒq,] Hf(1?q4JFИ~厘NQ6D6a1+%XdTHE ~jBMkTEW>]B@"VjwVS Mʑу9JG*1"ɳȄ5 gpVD#-Yc&nPO_^ HtF]MM'4EjbZ@[If%Rb#{4L^b"DnNĘbv>v=vݘ`UVc iil4lLecuXaQ_` 05Ͱ~k{=Ď|c2"Hl!dV ;iHxA18  hglZfT|\(!H|HaPkbdd$RiF5(5?hUNVc,O@k^X\h`FTuOIď}Q:eU.URaLܑ+VkW̩ju";^PFhdu &R`&R LbޒWXwPig1ְfpj a)+ERi;2E}uCuXןnf!ODx_PZ2ڣGW -ed`fE{J':E7Pꪮٮn'L8. m #FKNVi6[ P9=%ġa"ܦX/HѤB/"JdD> 1HTg~/-n Ex-פ WИTaolJRTd%F WKƪ`I=DJ0Ϊc\³Y>ʎh;(0sHYdŀʪU[@_myO9?Tl@uN83R?2el&2])F<.&f_SífbgPh$*WFI&@Gq % q 06x:G<>+(mאψ| \\MT3ElՂX:nev)W3< ~Tv]s}V(/ɖjdڄ`sxATCGtR%ծ5S],q'Khp 2EEEc?vI}E$\fM|#|LK7Jt }Fk\O3n8D}gk rN4a1#בlYu;{xS'g`:F[/7ѐr Mdry75MHD1LCT%%;"6o8vQ 2sok\ G@#P8T 43%8v:V+HZzPcƑGyPTiґ-|a#yraQ#):q$Pf: Ψ 3:rnWZT:lYg<Ut.Q&}4dADJ3{&h5*V-cY%cřVyh<jp((: +Fe6R3F5oIs-Pn-ѾEݜb(8ྫྷLySmVY9eV03}HnT5PB2 AXb#AX ,ӍvK!avKcN!eή6d3?8.ðQv"hLL6DrJ)8̩,{R,*L;ljC-23ì/Q3O("5W;힣-]0?D %nʕP s>\/F)SB),c.-Uq] >6(^ zK%wIZF<3:F[^ hcx5yׅM6uJ}jɒ6ێ^2&},:9r6}Q -*BPl# XZB(ID1聑z,2$BZ\ffm?JQ&Iw Qnd]@ȠIih)l*grS3Z`-!N2$EI@`;8zRǔ-n#mF% RjAԡuiey B%%gOS5'ɓD%6Y-,A DϭR&1+5A*E䌵vƘr :Ax&rEF%/@,b.m$o>ԣ@%fA>QDZ'6yx92%s# "mZ?paVF?&2Q׾Qrgh-`>m= [.PD ̠ ؘ615%8 Zc](h $!f8tri)paUE e}(J&XH.BOX!9#pW)_>I rM9T7$V;ZbsF٬b, 6q X%z8udN6򕄹>ìm*%6:HuBE.Xbv$ gP0jcNfI 1Ȇwk"rv:ՖZeaS~1 ( yM0<9%t1mZ6LRa:&ho6dg@  h@w]׸PNT9SC 19)!F?}OU-Zךj3!N9; '`b&1a3M/5P5B%K gV$x1cdgBĺcыES-F"GדldGAY:m|4Mi26 ԋ3LS],#jͳ\\txʭ(Ҷ%qldE.ycAOՕ/lf'X3wX^@u/4mY5 έ$4(N4$be~AU*L26ME;]S f99Es$qasB7lm/:dU-}gG5ĦvOe*pD4&y")hqW1]!"a_"dʜDž,fEc.!FV)iTGhƈ | VɴL*&O!evnΤKp#P#. hS@ci^+ddFij@-$$($a .E*d+op kT6")&,iI8DA6 _8i1KJ$FJ 2*FG dj!Ně(E/G$R٣Ƃ],l~Ø-N>"fv&7ԍ.0M"T؎&gVat~O$d/Pfz),), "n0M\"*5LF.fn +b7(,ZBb#|K2.2f$& }DThJvj$9Hg p %hԘ*%D.fv,E$GnL7 A(p"Kڎ"-"SfLmp Z$/ -er"o|R;"n4+\*b->.)#TK.CSXHX&v-Sp=!bQ,0teXs13E5((lgr149F|-ܮSk:5 A)3b v7DZ|O') C(Ў8YNtE2T 6b!dH7"+ΆS>Dp-r-4TђI 6.'.1q>/R)>+>bf|taGn x(BNr2~-O42/ONPS4w0햐 ؍59a6?qH 2+K/T@؎_8G *d#7rO:V:lu Q=?h%Ysd+F~lF@B%1(E"e&JqB[~P@[D u tA$$^ n&aBa"o6,Ōo̡7S%ILqSa C8b { bjz%$jC2,,2,-4-],4p.I :6g;D t hcfb?o=N![.3O#[AVjmPM4CkfܞpZ#8⓾n4c$ EtCb7$+7ȫucn祻 ;;#,oW;ÎT;97Sͳ<H5Г"Rj֛F~~kcF(rzva"F/TҴbd-Ff(ɚh1iZ35KbC6BlFW g?wCY~TetTf"llcn igF ǃbSHF! 0-L36b71%2O4cY&?v1pOZ— uf:%R0RPB$sЋjTJAZRa1nNaBs9C))9+d5{V!7W#͘tW%Ć:X=4JNttc$b3US aC61v\'3*Rvt$kT]קi^,,^5N4YB,aŽvO+e{r'E nf<"aYFaeBb7I|-OB"CV#XYxfXf":gxnHD+ʲ#rt*kjSQtKt6[ ^B+k*ZbV=Cͭ d-"4*Sm+\`/)<<٢7^dU3̨UrV٘cXS tg:Lu9Œzn1j|7a%% }σww%0g*4BW60ꘗ~-Z-Z9AtDm6 b )TPYeR}-Ob߷*Js"iId8I9xq.%BF=EzT "n.o:xY1w!a8Yk"0}{5{8rcهTs!]'*Fn{Dqāj/#7quW; ;% {Q̥YE#ɲw&3c8k&W'PsQ?2>FG\!Y{OTYF)-wejR9!*e1rfh ol פ]{t'C)zٓss vQY}(+7jc gmiMbΎ)Q5SO[zW`XsEYlGS G \-];CSյ>4R~ݎSv"Ȩz2'!BGf:lĆ'Zh 3nD<I)ɏMR$&—3ITY2gK3wd1s-(zꁫiөL>4QRncvU+#Cf\r 2 DX-|5wl{6q-Ƕ뵨Xe 様;o3y1mK|66!76smkXزxk=jYzX#bmU'1sG.:7os;пt)mǰD,2!MhZϔw7lCPF1Bi, gQhhL8D dH14ՂS1Ro:<MaBO# rL|5&K,I`n02&  JG2lyeFɺH}YOa)e廒9eU !LEZ2)29`֨0A04i]{4,uKS \9U-)E>u;^Yճ4 l r AIb S2K= აxɉV6iiăh"TGhY ճ!g#pOc;%?>ꏮ$(5lbS:QAk &okj4Ǿn|G=l[br)%9M2j"k2֔2u$ʒ0>=J͔kT%f|*s4sܖvJ}ZDYt\RȜ,mur 3s_~{.^=j .l5 P_Խ=c~JxIsP N;"x<ȑGQz=h—Ia6jQ.4Gj#+GfLcUdzBA HGJEV.]s$Ï~ZZ4k9bU4:)h;#ʈq,]a@BK3O?MbYLE~+ GZ!l%#ɧJiY&f`L~YRD%u)/9k֊NݙJ:oN_[6y('F苬o9.p֜,'9};q"-u ({nu-,}dvQz9UUlNSh11ijUZ SF5*4B/% ~3D([Q$df[ҙXTwMSŌHRF5rHgR;*-g֓6ε5l.oNiY?l]hӋw# Z5{Ƀ o{~`u  Ge4U՜^ C_ MxbaJWQK1zO?*U_8=m@JuK5;reuHCFq9f9+SycDuYKђ3Z֔ӹ׆U7focUwnj#=s[,e5"ihtuFuv;K-tPYmj/iv'h/V1-x1GlaB2e^Fl_lVmR7_bod3F Jh[y;3^N5S;#iY̱\Q.!vfjB=@d@(Ou~axeUx>wx؍w"_gPQSba`ud+0TIB7u yG'6(gb$Fmz&vy"$n醄g$Fc{IF2?Esz8GHfde|`Vw"VI'qHze~\+bֈzX8~",7,7eXfMTa.x>=x]M^/fH)g>kies 8!͑&5d/MO)@ E16HS!xkg1uwGQB3soRCҏV%rM(R(mcyc GV6ǑgnoSojƆ U`6G&y؇wXPsD@X9((;q爥D~E:>#b-I6o-]Gɔj4VDgBsJgt7\rfXrW+|YĪHLYmA1PeAᨢt˿ m"xRQh)ܩY> VܺG[ﭚVQ21M>=o]zPJiކ?_%|֋G(Y 3$F6Βt5E$ c'-7j\", ^FO`/i5"mvhaT7l9sV&{eG>?8Nۗbx?羔j/|vso Kt29tm涄?m-Hpy_SA5j=`P|/w_VX|΃/ "X UoE3SR|gp 2 v,P&$YXܯ gέAQcq[ A?޷[_pPT c3p,)4ciרfZpĈؑG!A3Rǒ"SeK_ʌɒM4KJɲOAJУpF;v \=pN뙃 UjTW2ݺ*H`dYA]jWcO֫nUOVoUO]j(R~ 5g\dP:4¤K6 .[kVp٤ 5*6wU΢6%TZfCׄQK>G.`'B;Koyɫ7e{ߗQ{7")TP ĉk1Ν׮qǸz*'.76: K[hDR*]"%oc [J»;f<A1PF cI(I*a ]]2#:.t Ċ40#:%ZG8gƁva B-LE4̓LrQH4RJ'饕D(:SOBj]a*+ $ ~7*VjԾX*DA. AjvР..dvUa-ތV{5 5 ]ۅ#,xw;7V#34kXs:͐V3K8P&<Ʊ?/i=;Ւ2lFk4PL)BA&" ,R] 'V?!,eÈ:bD%1Q؄Ç($X(Rߍhmm됙^ءB-gc}ژ|1$"ǝy[,[ LYF wHK!r JO83PEsd%GJxS/X.-1ʬFӌ%T]q#FZL-iyKtZg7c\ZIXf{Z3a.AbPdS(L |AY 1tFL=XxP$SCÏG)AH8TΌej8"FW4.HJEME]B_8*5+nj9R[djcODCc4:Uc"V[ jI.]uQ: 缈iP}߫UϢK~qI9 >y%HB%\& ~֩k ٰGg`r?\ ~.v9*riDLh`o/ga\{} 'mfȰ7Ú:!^ 6oh9p승EwdP[NX$T*>M$UVA;_X:IL,6humeqn3eE,whYYs+YgU*a Շǒ6x%_%k[R:6٭u`թ^A&7C(#7mN%A~S"vWkLsZ0?ى )039nS(c;|OM-*ѣJtK(5]w#7j~@jW4Z =FGSCݕw2?e<$*G>T7ad^cuͬFuhS&8 TH|=J%B-2Fu4w7:A{ TY-'2ёB‚ZsˢO k0Z)Ycpd=!5J,r!/ =$0`' A'؛G7zBٷ}=M)#8k2{#*=ꡉ#M>9kڊX2WqQڍ,DdAq=y !29>!q8z939?Cx]Ɂ_&_"怈+ `F9 :e@iM:2 Ķ JNJ&څ>ViJ4pRGd=Y"k x2CQJ|TU4Cp٦:dmӳH A{3TRH@D;@3'Q'AH g\L Lu+7PJsLlD s%ZS GV#AuZ \Ad5B4 JlOHcPKA=$5Sy#Dr˝=)99H Pؾܚp$Q3ߚ4[F.Bx˛Q6 ѡ4;Ns3YA s#-"Ũ yF$}3MͼxzjyL4i-lӎaOkȓܔ`ɗ-T337mjl MOP!97>M VbTL\'flQ *芧iIjAk" ?rO2T!MDul %ju*j;yW,UM)t41iekD4uSI-F S٫N{X072H{ZyXE=1 Q8L٠DՋOlYTVTDpPzk-m@ 5IZ 6 *K4:e%.Q t:4Z lV6lmmm[$)RTM%UzR#,iyM YRm{hk-!a F!AII8X7zSS>ND% \|24 Y֍ݓJ܀zJN9 Ø?ϡd: Q)DC&}ͪO]ED^]<5 +"d4-H{@D}ƌ}_if _Q%r T0:#(̑#&A!4z͒}ݒ.@ƴ_ VEXFm*쬷Y]]E*)9OՕ]I#K]Ht,<'P%AAL~!c:\9-J+&+bK u/A _-R2Q\ #7ZdڳjԺce5߰=)5֌4',/=HDŽ3}UL"/9cDѫ}=8FLic8N֮hvjgywsV}"3`g!V#QhHHgtL29 Lk:| ]7hXl쓮\VTlݸDDd z*k-.8n1Hѷ.+3rR4^F]Df8]qz6k ^VIִOcACȬU]BMC=r{l09qhW> o268|7pX۝A7f.sXu徂А&@b&Vs._憘`Ug!IctI~J[A tq_.5堀oL=W1da/6sq4؜a>s6mFTU QX&+7 wb<Ds[ ?cJjEn7Ҏ%Eq1nPqh_k'oƳww̜ϕgxǩ(?Uo, S/reJ3QS˾|=uu1]S6wsl+]P`nn;b8jQK{sRnA?tt> _YtQ @7; Xv74tkzViX=7l87Hwepڶp9yNݽ7Oz>v _@o> p-ILgnF㣎$p7vq\BSq_qqqX"{rwB}athT&wrczEzgezrW$wlFQwVG9#\ =L> U2uy_/ ?'wNeCY0c&"Lp!Æ qÁ bHPF9z)cƒCG_:s&͚6h˛3;ТDMtҤyΎJPe֥j,XG̊0ȡ"ٹsծf:֥Y~ =9`>~;uȖ)c83dǞ;zs=jErϢ9s:qF\=6nݹo ܶ OۅJS]H~Ŋ}ʬC2ƘǤw[?y A'0x 'x&"X 0*j-HluS]q!SqՅJWw BXYO~Qw҃j#:Oq=bCXsAifmg- Zf-IgAWk=dDfp؉Yfd9mm9b\"ҡ'_X~hA }1Zu(}RR*a*d :'bR%%jEbA^*IMR&G]!Hc-_ъLf)Zz}EikIۚr+%zZd"]¡{)gl~宼ǝrVBavrh :|PO1L|g!;{}-&1q\2'Gi*(Ū2;rPԭIjHbV4,~߫p%%` lPS4JdE %VU&ibme׬yVw'vV6QE7Q"eKNܬ7Mg+^ xN*_+|hqmU:EA 8(ZʶLNұEB"_K%זHZN'|^_dƅuBgzvU oҽ'JVbScw)ŷw a$]*a-<֐A*%Y P]&si+7"SJ m);ݩ:vE,--OUB0\[U&-r_Hg+53Z[8xo"95 KЭ:CXF)'9^b pY+>.D5# iA("aIHfH0q .]8{L g4ich#UQj%Lq\S*T1ZD(job՛'Hw7nj&G9+1C9O J TJ Er'l<\5v2 AxVfX@b%8ũUnhF"̤KKMU 1:ZAqىhˢX$/aiTOIʊOuivяbэnFYMT_vsVk!(Ƶ_iB繢pqiDz%M)XE2̑]EeE4H 2c[d7mRֱaIsY+eUvg^Q%^/yX⾌H"6’Ԝ),H]e!nNejȭqx s\t<ɂӹ++<7;ZOf, n0\_R*%D7s Sg?Ǜ*Hyp^Ű8sl'ppP?)-&*aZvRt$,Niңo]Z=)cfWH6f<^Z2J-MU0WrQc(MۙoA}шa"O¸pzͩr]ozp>S1;r.y{ҝ]T:f& 5j!EeħQeV+^`6MmK/&2]4]'Q5ةk֫}RbUf/;t6@ՓY^_[ZIAމ`P#u&fQwWq/v#_&) }έG!G8bA@P+.@^.mbӱfL",C)u؞pkh*85q4`ִQ0]epJw;jFvfv]W9Ci` O$b|9p<{큊\~|7>=`Ś<%'SUC=h-LY UU}P*iX[! /ȡ\ВZծ Aeε^P^1G9zDGQdȀ@O<ɑP ̅ uqI]HSxW!aE%Q5H!FG`cE ϨJE}P)VqVh `V^{Hr95Z.^N]%ҁmt- @թONᇘT$o|L[iiL~UGWKzQQL6qrEa7e!&ea\.@ߙT0|O)Xա:ږ;7ZD#`7ʪ9DDAXB u"IX !z]uVGH.*pT1U]!Uء9F&!H $ŭV_Z#Qb,-,)Fu8! Un F̡Eޒ T Ib?&$feVu5O}nXZyy^(>b;IF69G`.G";Yee>E)й]EAC%#V2&c2>&ik^CM^OzODʌ%K٦A9ڣc-Ŝ,c#J#HÌ PɚF zGy_n]0"brR -a`@O~I''4]52^K&%a|$M*62h)> eZPNpTUfe*׉ZKrUƈDoRŀR'u8@: ]%Ϗ R@q.-Z'{]+J] *hjG!#EK"K^ĥ(%h`I dfiVXyX\9'pr( qJO#ri!JJ(ZxF\JŇ|gwAi ޅp!X*f~"Ig}cjj|v-$7igf&d4i*A ii(iXSv8TJ t֚U6}R%ըY9v ux(ثՕWӱ; {&*B*[R)(~$IM]nd*ĤE6ְ9M:]֪Og}*fHs:g=zpaA2:mqtF3徖 ւvL=m Έ 9Q ېKρ&nzdތF̈́RrVX$n@d<,ͫҒe]I񰨉V劖$`"k%AWv"? i#'Л F8"1`w"=]"~2lAqiEf"Blm'^,FGP J}a ǃ0ξPD*!B -=2;NLnm@zr8v@dUBT'5m%uO_r00o>'VᶯfnoTŴV ޣfYmY窣~ P*p!08A@ovhYQ?D$ nU\p†&XAqb KuT'U, mM8zޏSҥr&v4VnqIj2XUE]9nb+mДVt\ ^  iXEY(^iX3lm'ŕjMG' ^6!V 3}Ivzfhi 6nm `)Q2 .-MN2^h~ǨZ.2F#p~EFp४tkI f ry^Kq3D^iު<3[3<,jcR2|!̉tr30{H2!({r$hB^(O95VpR/[t/LA-MѨ 2S]3MYLW6#6nU]Fn9P#I~u&+X$~3`do* tA6hNfOV+AnAs!+ZhCqm[Ek0upZQ~J:q0Q9'+a۳abM2CD*>;'mPe@,niO$/Tgoƚ)Fl >95!|T/-&W_RwފN5m2MIS4kvwӖo#Æ9]ouL yxy{)khC7Eg=?EnYѹňF9uX0HllJwH:TQb ;r#r 7jo.v:wmzoYߣLG7':;MoSCr|/N΃! =SÝX&lY:c}A';ǝ_W͍g}2N186c.n >ُ=G{hǿsws?w )w0(t6zpqX׿4P|^mϓR/}<p;>~,,^vZk~cP}XW<mJ<'/Ϩ{DGXA .tECRt$L1r1H32RcpTt2ʐ3[LgN9m鳦H1ጂcILKi *PSV&VJ2MkW 7&< HIm\s岥{.^yW8D] i7fX%b}GʃլtЏ?{2jKE;v[z.l٣a&$AfK0"AGGXwy7O|mhzvKr{x}|7\4_cj,ڹ2YꟂ&\i l@K#;)2B/ O3I;CDM,EJ%nKQ^-5VC-,LFfñRȱrqF<&O({dˠ,9|!-pK#$(ͶH C󔪫rq@A<Ѡ-ȤI'5͔MZQm^<6&o2njʣ3%M-U5rt]kQ9ߌ=h#Yf0 nCVtyW>EׅXB;Cְ;Js;缰+9Id{&J\:'hdin]9k8I:ٱLW&~NZZg%- Rd;hħ I)Ӌ`Uem"Œ0DLa;l'X p& ҌEX  +|g+'tq\6npr\ 68t|N u, ̐fW;nm <.ّJh.<1Q\".s'bȳL[ɅQ#l"Tb>yuB׶Ex>=b-$AX.~b$\S.*\2.#xGra["ZǘQ|g5=vHrzH{Simd8' * \n:Wr!1L!3J$zQT)D["5ezka4kSz: VJ̳Exӛg9a3vԣ8$6NuJ* G: #<&kb-TLghEZ:5$j DSbd(g;qĊ(X-,ȼދeFRɪ .GLCʜ_^S/65=iLҺ>vlbzfjz.5 W{)Mmf{ڷu/\_umlrZ7}lGz6on˻7p{wjdoCmwOŽ-o|).oy]sw5>t"OQ~w Okϼ-9og#}wkg[g1nOϸQNsrk=vvӭw]~t;uxnw+og}mM|/8U^we)p Ϙ}9o~@'x+ַuA_|W|? !!,@   * J##T##T##T##T##T##T##T TTTTT T$T'T4T"FT#GT#GT#GT$GT$GT$GT$EQ'T:T>TwETmGTlGTlGTlGTk=Tk1Tj+Tf+TZ'TJ%TH$TG$TG%TE-OC:ICCGCCHDDKGGTGGTHHTIITHHTGGUGGU9G3H:H?HGHGHGHGHGHGHGgHkGkGkDkDkKkikkkkkkklalYl\qbb`hkt|llllllllllkWkUkUkUlTkOmCp7v2x0~6?MSTT~TpTnUlW~mZrm]mmYllUllUkkUkkUkkUkkU\jVHkUHkUHkUHlUHlUHlUHlUIlVRn]Yqc|©ѩ֪Ӫū֫תתתתתدH*Tx! Lpb?qK ˔IxjG/<}Q0"-o8d"OjCę7MāYG7k+׮7 ҈ӫ7n=UZ,e ]q5:.He j`eIfV8KSUnk)PF8Iۆ귵R7'KF^YW7Hf?Nw8ÑKxn/^&Nسk߾fŚR^հL2=_/>cFWk%\Rnɟ'xTdTTx)TL9Yf&3U-\B_QG-^x]E^}E4SqHXcŷ]Z`ƙ* tY[ 操8Hhř4;)ӃG!jN%QHue{`E}G^SqfzYSr~iDY w|rS.}m%NeF^$IPJ^!H:ajVɥVQW[EZeժ]Y!]utMna;XbV5TKj+p겖 ]>J%+v Y}Fp}z~ 5nWkٕwe$W5: }+WtҐ9X#g6FLM)Xh ě'F& O+R~"lWjOX2 }'r1sHߛbihU&ZJj(Q&[ui6op*9}6 o)^߅Ye6Q OOTS_JbէS_A _eWfo˘O34Րpf-[Ն~UWհZ}EXekpZ. n#KnX29_$@flG T\Iav[ f@E`'QPg&K1]A/GjWx%gBV-]E')og` X%-FQ&3Yj娌5DCV2 X a9m*:8N4OH:ԠfXx(?1lNj\";5fL".av/ LR(HewMZ^q5ʃbW?5E"*X,u1A 5SbvgvTXRfu|Sh)3@sAb`E~2e -y+^ g6h -{#-i&j}%B8Yh Iִ4 C T EXC"MzFi,XU76چ\_Qɥ笕L+X dž㙜d=RxH40N^K *ʌ@dQg#( K4QByዼ^lyVRXyU銲+IMyK^jwf4k?, Nɝ>/ZNt1MXbo4F`-mP d(:Cg;y9Be@崗~ܼp "ِexE+k UB^8+E+:Lf<-$):IB*ԻVe\MPM!/VrEe$ f8n 1PScZ#ebXRPk0h0[*v/>yR G:B번gخ, R+ćDψ BMte$YmU:[ 3H(`3QAz[֩In6%Nժ`5GАڞ&U }^}˝bc١s?(dk^Qh # 5\E|4@9w DQg>lԷ gڥz մ$ YDYu#/Ym27JM|NʄS 캒y<W8*n@'ܗWcaOhA I4BC"ݺK[^t.BGs9Um\1s8ܭH Ԉ%PFґL$IԱcW 7{.t;c"2JrC x{# g$\_춨),ҔxY3QLT 'Ó&#K:|`,G# y-SQȨ%"Bg% B,@ V@H. we%fTjʀ^APVKckh P{Hag[ B%vؑ7^GJ/S1=&Џ10tO@v 7PpMPb2XIĈp5n"€7l4.QRcE@^ak(وYz&Hn5S!# C5gc[&oA<*5 R.Ŏt*-`YaM iטhX'w)mjED}-H8!sԧVlSp J/0 ` /0/@ 9 qP<$?B`AJMQ{D'?LF;lD$0 V"rAt&PRcMYYywF=)f"y(`AXP7^(\0Yy[s-ڢ&ycr 5뀞/@ 8cC;9n ^ChاuH+-?9f9[بC9fAs[=WaT؋d*]#@*功!niتDU6yQ/4fn4)q?(:#C% ڀ({pZr =''qh8S"Ϸ&0%B٣XaA:Jp9˪^pRt+ʨU& @F0Qc6s(QQa!!:m)ܵT4haaݠ P u;(Wr`=äZj{sN i Į0!a@{7AF/R6e^`pkA-N "va{_j/4@Ӷ//UPz2q'z/+/Qgl@dk ٗg=жa4`K]7L6SXa   zD)%%% L0L0@0WE+!}{e&1]6mC$q`YP 68Đ0XȜ j|iAk(^@ Xq5=8 Et17W| \Su_{LƤ, yZ'.Aʾ m Y rT$.ͽ1s,ڠ ;Q/)խzo(fޠ1ng*zT-!{k^>4q:&.H[0 =4oJ{d$A6c#- ?A4@ j( =&vB#q'xfEѲM0멟@ԱP1GMEF)z j ?[Z$)^)!xPmF 9-KbQIL ,Lv[i j x ^1@ MЁ11KAn1ä-qTNg64`LUE8 >m@Ҷ賮rB,AA쩟NPa.:KGrϢSށg ԝrnsx SV  ^}s1[ԁԏ:nK"!"r{eߘ&%4C2-)]!=K+ E,[Ĵ&J3)&F.5! 0έ ^Ј]ɾ.mBBw28ggMdӡeJX(DD> 㤍eQ Gn3_Ä4*C)QxׄD<O@P0E%.$ӖǢ8B1hSA B@BںB?J麟>ꐥl,nH&8Kz'M. ǫT5&a خ:n ޯz_БǟRPeQ't'@@[B:t 2Ej QA=~L8&J+eJ_jyB 2L|)-n|`"2qbU8Lĩ5I?42O_ BT OԨ^ 6"H^}6m݅?`_|ȡ' )ԓITkzZXTy,T_J+j<5EWa;0^z\v/Ľ=xq#Iqc猛v#t9q}]{2Kw7oq ~q\pž#(F $fItQc:J^ Hy?LF$:׶JQ}Qj1 (ⰑL)zG5_Z&E81/>W汯3_YrI)M4THvs!Uꏫ0#3!3ʧЊ\2JD`MED #HgKSM3)d ; )/VYNGa=TBuGn8.L2N=eeg͊٧.",/kUo{=jA5H"'bCڭq=r z7ҠK%]0_.1;>Eu(MϨ143BN $$Zg>5*nKvu =氽۽ /@c^pa  't$NrrEy@de&1 JATh'|rw04aP!3eXiQD4KMd-kDi"k͹A^0D&aJGXLLG3Sb#ZEya)j/z  IkZ0&Nm2%(?uMNTZeDz$LfnMD.)EPx*&1OHjQj#Dƽ$E)C(: nU^^ [IԨ"tUGyWO@tDz\+8'{͓3 cK16`ІF̒%H 3f,OyI=9QI"؍!cKc#] uyGA rb8U.T໶˺:yaQ2b.csyX׹8`ٔA%vqWn\Tl"X1#_Kc j`] 1&Y4!ԏ7D'AYtHIƾ;0Vtj`ԔdOJ^̰4 Kh㠊nЪGhU!s"+X۩|Q k~^xw<-87jGdGN!uF6u*?$;^uNhҿ֊}ٗNik:r`αmXݻ MK05OPOjVץ8-ʸT%+IstXu׬+KM“x{DSۺ .PpHȩBC )sA4ji IE5>Q)0r ΢ 9󞲡bA{|5~q@b'2*zn2as-A]H83s&c <W!9Q *Y;" / :aBcC5XCzRx "C@f8."h@߫0͂i;E\:jCA Vs Y\8X)@Ezj{D 8#,+)J$,#Հ乕aBj2?M,әS ;B8?\Z{$R(x5(\+YX(5t`&5H80bCH9 X!j&/@i1z74:Ҁ29) 9壝A1}A58!Dڠܝ537Ъ+Ux5T9eB蜺 :1[I#@Ըū=C jI@ĻCqSRȈxXphnV3Q4RhpQ(uЅuL5@p(\pbhfHͫCK:Ѫ'RX@!2Ď<{3 c˸.*{@345 (X\TҾ(e/$Q3 4*<`.Ҷ8$EȞ1 Y*;yS7Ѯr8 @ ?y+80@DT*1NmΠ0 ̸z(RXtH`Dthm̃Pm4"E77å"xS{-ƨ`Mp|DNhY;>k#3> 1Q[50K4I=\=܁NYR;z;$5T\GHZFΊAZ͊K0"T XJ4CYc+E?DqXB9DpTR9sQxyl.-3X:hԡy!c8:>: R)"L2$ՕSK\K1" M8O .=є GUR"k֍R:T9~ }Sbs 'LʰM ^[@TKD˖E50!!T3 @e\zzÊ7bEMlE* Zj2#W1'sɀ|ɂ؈ V#'S^A`WQ%nN!Cx[$WAq"Z-NR [RO/2]5Q2D9y zsM1m5J+q8e# EX*@npf&@̉7)-H6pԡu3>KL0 C ȰI$ @ڝsԑTꌖ-d1Աsbdey۹1,,@QR#>S8eK |5`wIcDܕS46@/]cz>QHt9dTd@lZlʫAU!uR+Mdd0]@ ;+#OJl.G:$b`ί|- q Η|R]1Y n<) 65أ\WbNf=ڽ_z̻fs#C =id?͓`J7GYnhf+n`<t8PJ{dDeftL`HYHt@SES}eB鬷Ho4" &}*ט(qs""ֳ%+Z(H#} ?ډRWc C11wXd7%:j1EEtE>*R:cYAѓxJ^JEm bG΍ 10cBy ;AQ+ۙ( =As`ܕ<#OCG`@VdKG @RXRYovXKZgݠP"=h 外9M<qK :P tv@k İ"Q I{60".Gri%vx"ZnwRCݚԉ_rl M߳5cS࢏hmez7áTOD CΤV Їj @q4Ǝ\VcyS;97T kss8f@I2Z@IOI0V%x\9~%0z*Y I‹U`x:Wizc^Vqz$he] |`v }W]x `[,rji|Y!5UZMKJ'a#Oq5B ab諠Zq >H𢉁3rL  I#"|)CinVCHL!u"_P&j1aH8AƑ1  Vu5Ici1ĄK!SkH;cTF2$<8\ Tط^}M)WOʺ!JH#4.^MC?i&~cx$߾('Xb&*gw4eU b̊nv 'U'ê4|1LsJdZ P%iQKJ a\O[AXXT{EN7PaE3R-o"aRoᑅIY4HUF2dOfDVF%eQJ!tP-%m&QU@}pTY5g^mťoQ4QWUuhVKIYeݙ1RUEC*RD :P)YNZX%B+o dCBE[ zcV \>~45R'I#-NMCaEU-^ e鸙\!&G'֜HM6T]כ:!BKjPeigULIRSTU"p,c%HVg5vsѸd+Q_aPt>+r?TJIHg^pJ"mp;ZqZgVLbmX}&6<شkɩ .\p"+"s,)gX9 &"SzJGPM(sTRJ\tf x8Y2"ijS}(n]f yRtѴv!x <]0+U}ÕxʪH?&_;CCt2Ί! xwʓPLI,9J]s5l{lXUM% yҏc]: >FJhN:xY켇(kVh2Y B `7~KSG@QT),j#S" ~՗A0yѮ2آ 3)&;\w;^9淵 [Xr%m҂@ LxxMjc79[2M".obЇFs90epCLt8ZH19/3D|T;"\IlD٘'v-~-&M Uc}HB+7ؠ tJ$-NLPT^Y}꣖&luarpkJB1Y8-P(qo-, 4o.IjQ 8I13}S2E:'^L?թ-٦>P 9\B*:rj.)NH▎K%$Mm3=IYPH#)ERz7 b*0TUi%W 21ވWl"o[nT L+"lÐDa)L4IsWcHV,>K(4&i ') ZLzyTZB 2M bZiJa㨙pHJrjKq`GZKW@;EZ5؍]%-f!9 1Ol$HνTBupKr\H-ͼPLk@\f ((_\G~ݦTfHL(QYTwVesΕe GAccUO|;.G ENl^:F{ǦaLXͧz A^qLFT֠b [ՠ5Vޖ`}H2Y hWltեc,6Y)\(0US`ƋB8va0  \n,C DCE!=̌P#0*N* EP2CzjnRdxmx,d& ۪td(FKdA u.GcbŧI^m j*npm^~W3a_R$PUM2R=c5ɩ*+ko ,hN|A𞝸$kH$NB:<(9p&/ M&cXȚPEOH!YT]TO.cD(KVN VdO{;¡ 39l˒J޼NK% ")%ғ4kɐXX)qA_FgjY Ƽ"'[-޴pQu$1ƿ Qgge_ A5wG*]ɂ̑g ]e.LD85@.LXkA̤/ 'D^`z$Jr4.ptoCX03ODMLW,ʵbY:sjvGoj[,H㐺T2TIJud\Ҳtuz`lIيLU4d 't`A">KODM(dfTJxlF&Ni:ķr;Hmo; n([eTuэɪXI#:5:3#]޸oM$([[eʓN+*'g <2_zET,{LE Mee[oّ02D] "N8j|[czy=mcłpQLq0OY7$K+;X֓GczU=|o =<;H~W[DOPxsv(d`w Sh a[KĊڼHIsB}N>>ȏc!K?DlWY=C;߮> yxuͱ]|ܷgwz[7ʴTYc7k}7 F9/tC.ӆseotE` pvwX[`G 9@ĉsa@ gMX+/i<,x/O,n40b8&,ReK(+ti6+fǚ7}ɌiL0Q2iI리TvS+J]~ʒL z= 4LL$1⅌w5PoĴ'_K7w{q㳋;.\ ӦNy]?Oav1NɧQV]>X m‹͝@#sg<y^ zqgǟ %lV߽Bĺ~a{S2}Oô__&yiʰl$O"\2/T:i8ϓ!"J JC(2 Q. D FnQ%FDB*?s0Ϻ|$QJȜ1$ +ҵ%/_ "S$E/"*ł `D(F:Mq)_xH9ТCJI(E]JF&IA-1g!/S2j$ kǗJխX]&J$h)2J2:/݀Mb΄M8IZD/*i,4O$io sD2e0Wm͡&ƺi/:L2eR/C:ae6z8+vcXP@s2eVêx<}fufr/-LܜB頥WDE\7ρ.>S릷>2M4'IebˤٞQ)Lz,\IB_mfš$7͌RPey0m.K'~ƿNST#ASw:IDs7UwF;SFNc,as;)z{(X>xscZX>{q4O@>xAmpٶ\{8¿S #=P"$0_XM/OV.Vܪ59`D d< = z c-~Ԛp? `Hc"4 2 L#Z(C 7w,iF}64Ӟص0 5"S-0A4tjI]Mn}$+% J@ a"Qƾ"(0&@D7Ѝ#Y:uoDG8BTLٍ.;R|HPKicKD">u U%9n薣.I!1aO\cezYU_'qp BNu3az :!I5c>}6K }yl-Eg! w%e2 J)U2*1u'|Dx`Q2w뾄H=&cSО2KIԳx,W:ق3 \d84Pa"HI9 ]͜.PEƨzS ٢ZŘ׺0&X7+q3lDQW{,WS)d;ZF?`XSsUIJcPM Lj1M %%n#?&-D;1S@+d&ey,yrMwU2UeO)a &RHH,@(ó,LAŚ^X!w9˩`ziNPBy|0ԃa |C"3AK{g2<Й-+L9lyP`"b=O*w‘7}bMPã̢4pABRֳWb}( !lBdUDd2A?WOΤfW @iWQ/=GE1WP$ٙ]xJX8*ݘ(5a"e!R&7]-*2sGk2SJ/uE0Z)I9JR$CM#a;W6ҔnDM!umPZ[KpKߋx19 aiMpΓ _YDˬpcgdh:{QVaoje1Tv?-@g9Dew孛.x@7. (/,)p0%nf1$:dž)02)6 36P30` @`o"<8hP(TPrv)L bzl–ze<+c@F<f& hʢ~&%PRjzb $Rn^AM\dμ!Hg|~LǎrI)mWj ndnB>(4.>e80EنfqZqB#V ̤Mcj.*p.ШTd$g0kׄ1OHܢux|(KĤ۠--xMYpZc>Dtýʽ k Ⅱ]Gq%i҄ඉ;i(J1(N*+" [d0 ?p=CS )B[vdh/HlnFNx*}"(IЍf(ÎNm2bz ycz(u|&rBvh0*njsTi8`O*+#fp*e-Fk|$GD#f,q- J-sM+*-b/Pe&"-";-,"p扸г"M,O+@$ BE&bD<kf>zJsI̡4oQktR%@?!0p&mr5Ц£'[P랐^E(DSb],c r"*h ĉhr iPpP;M.3/*L[*,Γ/=%?.!30-4!-^ "^Fq)&h–"4bզM?>u2eAgʷOmMP+ub>DuC Q/n3x h mBPRl$9#|E""a:MߚcєT")U[B",<"%2kA%[ Leе&cn]$L&UsvBЅv(<(u(f()^qJ`=:5.(%F-bBgkzWz]E$x)Cyte]>Hiv>e/GS$, O0t?CLDS31^`O)*L4q.Ts.M2JNsP6l485~'l37'5n_qUR$H-&*ygM)]U]5z f@+h qfVQ;oV!Ф\&hX<=K2́=s>SN CDt Ė d!0a[=[-Vos4BUBu5Uy)-MCwC,(sfu)FVz.:VSL^1(-Ke1OW q%"+)r!L fJEρ/S0-)c sLR-iMK#TMHfhe=f1<v7l[sl P/ma:lИQnK h%I{idj͹8 ]#p1=ܮGY\5qoq)Șq {]Y!Wk`eRtZW7uiZ (Z3KiG]ui]g)&urz._9cx<c0sŖ`yz"©jGdMX'x$ J e%N@j>@4gGhjdЮ"6ux™L0wB1ƅ $jf8k ZlzPϷ5PRQgst5g0Qtʬu#(\U {XpWU[IY&enHI[xN$ԁ2tcLNV\k/=7uvSkOmL}L1uA.KϓxpBŚxCA}d'zP;)ĔJ{1|6Z|r`f-}bLkt1H߆wJ9Wa6R"1g Գ9gI{.P(i%h0 Hp*ua{I3:EHnk֠uxyuX9+X%), &8XLEPd鉥(zbUwXU/V[[T}4rpd~e!U1>.8"K Tz>1|h0IRKϒ7Zy9]յxBoBIy_ΕPZBՉBZ$|YȤew{hOYUh,.F3%7NIvB;My\L嬎D\a՞ܑ-IdB:2aXv :ϖ$|g &QoiRRVwkoѼBʹVz5h{x$ڻVgԡrW%ce 1(\&RS@yzxS ?Nv6Jen&Ԃ͑# T^I6X+>m|:yڬo2B0!RC/:U[6G&ɽ0ppp.+)&`80Zc- $ F)8|bLa1%Snj;Jx)y;i^e' /p+n P2B};r b j?.VZ*r#2c{xsD^#s[h!"W%I!tQ|u[Lg :>4(;6_ѫ53І^J#h{=S~Odg[s1i%E6\͋j);Dbg_Sɟ 5ؤA/lwx] * @E-Jb;L1Q0 ^8'ĉ+Zō&zRbȎK2N-L'M_70swӜ͝9q&N}:j4fRҚb1Zl7A[ԡS8Lf}gqq^&.h ]\)&*Defqgǯe'^Y |w*]`xv/ qJ)&8_3(ү<2>,5L#6Eq aaҰBnL\az,cLr(쟏_qYg~EG+;Ca+j'/V5<Uwfg CEIh⒃ }dR*9b e䢧k z&d>w q0H`Aʔ\!/IKG/O u8S9Vo䆛h[jtU,C!fp@vrx$gv> rJ66[VD` W!e^xOS$U`^r,hi& !&轭h3d̸@s.Of7'4Q Zu)7cW,cv@<[ DdjPs/DeBge*r^ZFP+1TŠ t =Egx%et#AtI0Dǡz fvz=3ŤMxo3%ph#cт$Dbb(HF+u北9LB.<'w<œ^nRKX|UVd^_D|1 %@]zx]?$Kb#K7Y`k|C*^HDM”߬Wۅ9Rs* \iB%2ZdD'T9O@hDb.L٫0G;U(e!"dҴ9ubMs4T꧒Dž;* !kG)cl=sဆIT=SUZ=d!,1 ib}(>@2V@&PɊ"jBXb\2yd-'3}%5JVuqqBhи2&X$,ORɹ$0Ls.)XP1;Aܴ&D t4cϋ抚d?wJZcXr;XPK,$xhLD$TN+wjE\|A) O)ckĽ "zaQV|Q ja=kҎ380!tdzaİUJbøTpGf2"*G/L!&qW#gXeyh0mOl.e)R-95J)%i9u0Jp4 3)mչϔ NHun*)Si[n\n'r;ͰZ\ VO9e& wKJ2嘣(آvKSX2+ R.;SU-wHF?ÑC]Ns-{_<{mrIƹVN !8{=Xu>e0͢ޣGAy߸Dž, &3TYLy!z#f#OoYsQ[dzқLhU*BgtM~h؀V?&v'`PV@,iO](jQj352mopyҰxsWw56r`kwWb!aW UlK#m]_Vy1W2#pmQ2U*AOvCnzg0So''>3o1|CvPUN'|ce/*-4AVcș$eh}aCVD f)M:D2 ȓҦF[\)!/meuAҜ܍EU!/l"[ޯ́K WǁPٰ@1-5QrIra!SȣB~12J3y-!AB׌[w}׉ *m!_$" I3≉aǥ_"-l36T3GџAdM2LLW n'L={ҡIe[T[oICY<1_ѝcۢ[ܳf&>ܘcDJUU*d}NbB)*aڢk8?T N;L6!c^3 q/WޜyЛG/)zuԙS>ཷJ4Q^eE*MZPw>ݯ?R|O?j1h4ȗ0ǝ  sg 7³Ɨ:K23C CF9̱D G7B>d > @Q4D0ip9E_dinJVFàj}2L/#LBer)kʮdDȤ/ŠG)sﵧl4.sp8' i":#$:j|%I9rF!|6PBɮ2$IO*5o2lY*0,"lw f+i603^ cLe~ eY%.Щκgj#4u!Vhh} RH4AjCĚ#>\3WN{xb2PHqJ"HZы2xBMePdGB1e8@@s$b\EJLԭnj)SyO$r!be+R,CJTW̚V\9oaJѶ]8W(zE0uRHt_b"2R滘x@*̛SNYs ];?tg {,!$i ZtM!ТL!Xџlb! iV % D e']\G81nQՔ7FYIUx pq(E8lD*~.jY 0daS^BM`fى-ڻSd1U|󥭀:֍j2)&4 tE*d_xݍ!ԑo"bL`vJ;@JӴб9 G3=EfR&gB\CՄGbaA A}Pj6EoVEYF _3=E *5CY7]L%Q,q7A)[RBy"S8m{2π8#jJLDpyXC)*9:Y.!ՀLcid CˀJ>cJv;6ceӘ+lsp v+Eݮ.ʬ͂r4ԄŌn4m$hV19\`dr{VJܚThV h[\Ht/ }]VYZah*MxiC=Ꮦp t˂{p 5%1QT3 _~䰇٘*TyOvLb G#24sYAy.cM]-\vk?ݮ }nV'U1͇k!^w/!D "ÄG:mt?YX3z)Q^oF7)w{7_Ҍt|I]\wmB&bo{%.5._&}n Q{{D!Y5dL$(Tdy3nՓhF5p?y48Fo)yB/tuA~?gŻjB)i1+))!:j5'"/X\c>\2#5 1I*X;r9s*HG)*ϩ13ܸ3+yâRpC8Tϳza#2s0c1"+j,H# c$ +-3<192>8d؁cp;C>q-[-C Kpbw{;[ JDxDJ8̶!9E|{Bp@1 ɿ9.@%E24ұ 8:;Ҏ[ |;X";n<0o; ${<,<[G GCӊ8ٽӫfǃÏgq$I +yn72D)5!#!zTJ>)#[ȎTyHk))807c'C:|廸>Ը,>p"1 J lF,:")E$bDZ,bC#F$R#Az*KSl?IC۔Ȯ2BF 77@F}K:썺 ?c{ %2$ TqIhϒI/bd@ :O2@Y'ⴃ"KK>A4l %LITd*;lstUF$E2U6. U<&D=kdE=`@TH홌JFi0L&MN% !P,4L3XJSY٥ݗ 6uR RU\UU<$e6ABf6ʡ vAdਭ 0I`$$qU&fjq17VIcb_"_ae>7csNg9]\Jfʹӕc}3LCϮO |~" vSem-Z<SvNenĚP#=)B9FZeڠ]bmGiE34 w#3K &iڠHp y.A=3Z8bj*mzND6 ڂx6dy.k@BaҿR.4*=;ʡ kW@UM]ƫ;e@9*E^꓈%tmg= p.i~WiLz&vMUlnfk:s:qP= k~hngOEnx#iZߝ伀!7u:TxQ'HuuOOU9f Lf$1LzgljvlVyS=u˞cRvEsmOޮptٺ<sƭ/#鳠tFn6BOaFt"L5P5CI0MKOxguGvTgU@UVWlW/ru\kWvv+~v|z{,8|jߜ|xm_s Gzk?wf 0rqB;?UwfN--:sQq_xox{z]3OG^זEwfm>{6_Yӏtv^>՟;ՠs_'{D !0aB_B Q^$Ž?.(#I OjtXq`&=J=bS2f1#\h5[=࣎g#_>gԝk1ٸdfPZ椕Vƶj HeGh}YfYb]gWst|FVק~i}~(y.ڨKb<18RV&8Ur(o*!h"5io*PʓSI9eխvk>ItV`AfVXrdZUao1Yb:Xw6XoXm)er`R*more+.\[yrkgSjpf0kYv ٠~]Eaćj xrKE ʼ+uئ&~"y:>32A|р,pPnceٕQ$c1ݓhYcI'4ݹIКՍnpC Vνn^ YxES']"y՚3(,S>>cj=*RJh`-ԌjrUY^&QGVbmpV݈EBۗl~vrKB/JokioNמf8KS$i3sB˘FV(F$tֺ0Sဒ˄) m+NV4Mi*򴽌-&nCxؚIk]bsEF,dv>KCi &4F*Nz7JE$  ṣ04 iT $ C(C]e;&.$3͐6HVJ T\=fx.A!o` a<(JCP&3 `"OWMm6w̝|lv : >0^iS/\lģ &%)ȰLS;L4LDdܨ2=9% E9RM%L|YNFP4.;D`– q((׀LX&SG*!2-G-.:1LmU&H"r1u*z% Fso{Z \9$d>6~l$'K9Jqt(*9\)}ҙe(db9KD"u/EqpTXeHsc*\RTZT 88,b[yB] Rpghֽ-}:然wImQ#B^t=1Tv["Zݬ+4Vj7YHJ_#eT  '/-hWMϷ"rNVKn*{jDq/Eq]ty6&zd^5T7Np7:Lg仸;Ow֓,{taV$Pdc`AStSnI3lcnP NRK6#4jSR/[4d5x<^YÕ0Lo<89M4=C.]1|V Lh}utL3y=bj_dOa8y.%wi-Lj}~t 'jҕrlC[Nגu+/V_7sIrSMft+Ʉ%&59G,¦x3q\:_{q\SoNi{P8`a!]&»Ȟ#qk bU&$oqIůK?kbZ3es⍖ƘF=^)`EmjsK^vG$WM\h_MNuQP]l󹠾 ׽ q"u5QGI JQ9ZyP ɇ]Z_}B؀ V a^l:q=x!l͓-61Y<KYi޵Uxِ ֏7)|M="H; jF1 {IbQ_>"gxn #==-cU` 4 D4QA`·]x a0ʐI!+ȾyEX]t0!F_Q&XDE_M_"ihDENDŽDY A^lXU-__f ~U%bbAn!_Y~i!BAJT"#Y#)Wa F21eaJQmIMaNaMUɉa*9~aŤzD-d#Ud"A%3k`aeUWwuwu 9-XWo^XX^|Yٌ9fZ`(ۄԙ %^ A#Y`„ybD ZdI5P9@&THRfpe^чjH*Z~^q~~L~$O*PQMJ%Gmf'o!"goZJ`UF\٣XWD・}]\ [R 9g?ZB^ :"iS"awi_gE.7bBF/.JC4Dh.8FuʼnfB k 5#)1&凅&JF§-Tހ'Ԩt拎'vOh`(tۋuDjD\tMYed y VE2ĕfnF= h'MN(&J- 餃*kddHhH&^I=jϡpv^(F}Z@݉FHk7q e"HJgA⥒v(#Fɷ}vy]b-kpVfjXh­f,$H0f)„li`kl̂K֩*>UG`%ix).ϖODnLHrCm~2[ ^-}eی iABv"$QyUUtɺPZ{bl|<\j-x|lۂPoi˨~*鰒ްʌUP!.kmgތBY.'lvմ9!ΕnWeQh )"_k9C)B HsזYwl&2(:ljdu)$P-N}ǂTeݘziZ̢ċ웶ovʮ8{2-B bYmVTDM荛!h;"0Q"Z` Ɓ"/^*u?-mmRǒﱆI~hh B#\*n ϔR\ 0g]mH嵕VV2Mm,1p^ j!9ӽ~>ZKun#npj't !3/9-zhZ/|^Zi.T KI%cVDD_ȶF15۞l1.%InH =l\a*ʱDQc w0= /r ~pҕUCr6ϯ;v$)_l>`:H(瑱-0߯qQh֨ʩ2+!K2!d뎮QCȋ3w/tVJ 6 *F6Iq5IΆ4?us$2rHϴ[2#WP#CJ gY(4ɒu+rq tS'kqu&ctVG{cV;t}Vm3_&'F _IE3\1W7" "r5CfgsIeuƲ0a.5ɇ85QguojA3sQ 4Qj6,?5`Wne3{\Vqvka]Wj4a6 N\ѮIg+" I4"ǖ]2gK/Kw9(ɱfEW7e5ڦP2Q`zST/yh |FuQeҥddOXosdx+r28oK|K@vquM r3\0:_yGڇ'ncȞQra8UAʐYɰ/?ϩwggJlȝ5i_e\I.׶49n;fqn9 -8%is {Ֆq9|LJWH'#+bA-.'a>oGhىL97/Is7ls}K:T3)bcQSayTaY38gDŽcb$moR -U:6$J7;XЗpx uݙX 8ܲrzڑuֳEՊm\i\qݺFvo_~;h/JĈfl,%WF3e%ϣ㌃Ǵ8W.z!SeN}wnSmn*w[ңC~t& 羜6ޙGƘv| }֟k}yӪk:,_i(Z  P:# "DkD;DZƾ{KqFkGB+Cf @z.$4M%̉8Ѓ( '7s%'쎽224[S6j'ܔ:߲@+k; ,<4<G;3ltQ<)4h\dX5,T4235SE{Su -R[M;ފ2znܦZW_BdmZeg 0<Ӗ33V GVr7}xT K2֗Kϭ4L~òo ͊-xE"NcELk>qUUx: -4;;2T#JDRJβL E؁dRzYr,,/Ͷ;y\h]wUsRm4y.xM]CF?$_nB4Х%гvt^*\dMSCqnpUULTQ"вՏ `$y4-muvDb5hud6qi7V 9#+xsSKdy {.IJkx ʷzu>'n]JXbi^4|Iͻo;{IQy'#ߎnԼ.|A@j"ӔLb<HJWЦ/uHK+t !W£{ƾBHwGin I7$#=?DQ1P^)}aXh..?OHw%pb↔Q/w4:V9?D4Il? iE,lO{ve;+(ę]/Y;YҒ5N~xv*\QUǬI@D-шEDSqiEA cPEkφ&FgnXH8Ύ:˙̀/# wkYeHɕ1WBd (Q&ĤU'N*%MAXˡFs|? 4DpĤTJ'bA ޜn̷lּ↺g̓TgD̡5G4*8ն^kg>c9>󻿜.܍>wz<۫i _t)p?R^'֫cO=_|W|!!,@$HT$HT$HT$HT$HT$HTGkTGkTGkTGkTGkTGkTGkTGkTGkTHiTIJTHITGHTGHTGHTGHTGHTGHTGHTGHTFFPCDJBBF??B>:A;2?A*JF%RG$TG$TH$TI$TR%T^*Th-Tk7TkETkGTlGTlGTpGTBT>TFTRUaUhUnU~TTTSL@}7v3ojyyS aWNٌ8}].۴r[JG7ykEsڧpH؅i(Ap"%a8z:@N'B0D֤d@sˈr(AeY]꣱dzc2g:, ,ԠBPR3 HK!!$|\z!F"-; ԠPFiv$!2JM4$e]L'Vmr+aԝ L١NGinJMGxJ>сb`HD=3 @`maU\R% 7)dVTJNw;,$w*0m; Q%e_ǫ`m+J i=%d+`a=\#M?>3{~S]W<0>`"'4sZE DZҍqaw3QJ/B R.y1%Z+>kQylFPԲJ_qR(F{us0g9ej 7pϽ~DopML8V`2qL )]XB"굥5~elz3Qy/_;ge;-*qy\>zFRLGЮ,/p?|bwJ>k0;no.ͦQB<\ %m>6N}ͻSRZWIHRUG2`3墖?Y`&/ve5L%bfVd 930@1((_fLOSFIlW]'8XGuWW+UBeO&Bu$0D|wrJw6:71`փ8a0hjDXBw9yx!:eTXNpqxZC#-3?++g&yV@~~]Ƣ5^p a1 1#F 1x|1i#v4 5n&ަWqt},jRPp 192(gBiG#eZENWg;2%,8hi%$Xs0#4k$AQ.Cqi"dvV"s}Ia Pyd]?zȐi ؀w@y p8сtV(| atdX#4 q7usQ#R%63\$R 6q;Z ?@!w1j6?}*rtX؎iG;ԅt)nQ 1.C4yxu.UB*Rߵe=U 5aa H XUH==ѱ e%Lޑ$pp7|„-yZB_./ÔcP+EԎX78bn璙*vV"nRQg1kPZx@OE&َ็$iV q;:c%1.dkNIjlc.Qy@ЧY2.MR b6#am-'BodqSYaIxx &\VO sauL6)fx% McfT&I78Z 10bYZ؀yFwFH$$ׂSi:d b*Ws5`J5[ aš#a {ke9 ֘J : *J<7N^%,)ñ\ <,85[?Q̢jV):k 0 @Ǩg;(뵢k2.Yrwɀ9 4'LEX-8h(P`b<ϛ6J;ыcvMa<ųX0-(m߈yU Ze{$Aafqz 0-0Ɋv`۝QEJ&6k?{'AHz{ykQܪ]ju+Ɂv8 @ ڰL5d7zQ2SJU Ak9aMp sO1LoQHY,muS7ŻS-ἦچim VXuDq#`3~0~ qsU_59b!{=Ҝ+uJnbNҎP ' |1\Y U"jXO+gd7-"c.F1eX0TFr( N-FqwUF),*C>T{.&1(:WFdō]V1J ճL@'&o 4^#1[P  &pYu P4s P÷P~`+{U 4: LbСS9C#FpVQp ?H JΚ:4&:psJP٠ `, -NVǬ/+|ɞu"U Y2wd|%"Vݨϴ ^=[.#p Ω% e8n$ h|D@rz1<>tҾ.7dIv \ Ӣkl3MNq >$>G.T t^ s3dn}@~ bq6i1Fy [)L髶j?.5Z /Uf[tKw4ܽ>@˖ɫ^̬=S*̚N Ea wr uLhA4\V;NK=uF XXZ4xD'Z0 CG$n(5aBG'@)L)aDR%>t=|lT*tSP6N Ti 6E %ʆ.dXeDia6$x0NȘѩҧs=Ud -yƅ[~êѢʼn}z F][T\EfJtƣ#ɚMtiXd&tF`|:[1P8o"[89˺$74 aeɳ-j It?iƿO}սo9"0R̉T"1j50>*:&9EFP&NEBR(FièF!b L:"s|3Dȸ"#= >ۢl Ɯŗ SJ77R 0 `I O=R J=q$!V#]*;FLP]t1k6p5:ϚjkX+ߎȶ 0"R`!]|qbdƪ³<3Coo=ح+ː&t0 cS:KS"K/j<; Y9K2B8TY/"ú웖i -[;k_7DDED/)djBCbG#шs-L(@ dD#&f8Qb)|5!~HxG?GeF* j.H-xnF¤SrF-%4bݹ.)Şe;F G!}Ep!dS0iME#VT)#YAHG5MF4Ai䦿@=h'!RJ7 ?r> d!?P#$|"pazF}MW>bv1$,h2B8`q%cDX+FhlXdH-848JN^ Xgb0c[W@fnӣИc nP@Ҏ|j3aʤ-r`0n!o4J;`6c2BU6$Bj 8.iJ]AŦk՟R(0P::JZJHg=}EG5%N\ESD$e ҤWW"t.MVPI)ߕnD4 aN*1AFA |ҡj- QzQYFTU)FbXh_&iN׬gB)5`Yp%F#]dFve( l, #P q4PŊҥ&֌;;Ɯ7"VޗCuuq\8Arq]Vr;B7EhR(Fm9gd=ь[`4N5:t߆1$;q~沜̀*U*@$wuxhQ& ]k4$Qd[9\%Hw+j4C].mZ0s$-@C (I",DIq؀"LrbhɄu/.Y)~Sg֙d2N@_}$ZsDޞ(zrf#x[җ#RtTL,[h=G#iYmv=q=ZI o4#a4g;iЦJ}^ѸإϜ l;XsTniĹ?4*ϾQg۱+31Ɉӕ B{ Ao=á>!$Ò*p&ɉFhT#J9 b BL>= @ 8C*KB%Ȉ4A8.Kp.꣉ᾨ 06L̢ېtC TZY|Z { Z؇8̩%ԈJ>P넼 c-DpUa >9ѣ 6q `$Ҥ#̚ I Xdјս:EVvt#0 (FݰJDWVJC/@JS:"XEt7=ć؂01 NqMÅW8ADYnZ+ndGc|А9kHh܇d&}|xT|G䈥ɓr8A'Lۓ AP26 6P*@љsyш3!Iˆ0#P6Riϙ [.,ڌRA$#SFWf0 0@ޓ6IS 7)S8bXq @9'+!Y"SwJy%%a<& {fDF{De%̖/@}OB@mFv!FLJP[gQ&`[v_Ոafhe Um\|Dh>Dx̘VFPhĤnr\Uйo9^mɆ܈ܘyF4a5D{ Č+>Ϫ.MDQ`M'~ W&Z MPY` .@E}DYHԹv aYTvN? ]+,AB!4߂HB@ +% /iqW[a4$f%f3ҐΆ7$@R'̩,$[MtUn[HV`Q\\j>zkLCjtSx6 ۼ,;ʉs#,u:5N lx}/ tǖG|fn9,A_8k'j\JSNvAիo뀊Qd1GCN`LNPI-2\APlA ?JSLw֥ :(BqrU/; f-Uz"v=%yi eñ#J*-2U=vXSyJbyy8;g( Rf`%sO\n(8Ŭ^|hY& 7=\CI1s5qLDIW9", zdO(r7\!&UsMÍ&Ӧ 8hA,pp ۅsu-/;&aN;N۬5;>28dH.FjϦT/%(P E1Y(YS2=0j ˯a႐Bn94׊PI$ZpK)0ByÁlR.pM~ /iG&q{ʁZ@ Oț{U [x*d0Vh$Tss[C<<ǕM#S6lQn٬%5rw~ۆȪI*=a0xp*=IaC#K8L!Re(k0˷yС NzGc6,h6f1y BFo cmkЛ]K䲞pFE%_ p EPBQl I` Ҥd PBVlFEaM@R1pS}ŠْEȝ ׿T"A0ˉFRQ式-!FF|D8TBXX 9IWeC6Љ~XKTKX) %s4%#(}aύ%TA(. &@؍͜ tH Rle44i ܌}l8Ѓ98,rPSP!]ujH{a> Q^ aM"S}⇤ vQiVZrNɯ[xFy٢y cL(Ar)[lbK*%}V.Kv z1[xEofĶ4xC='۬ &{*\cY~ doFQ[ q!\MJtِ\-ǐI9!YcNL5LIwE2!b6]NSYEXFDP U>K~REWTTQe܈.I`HJ H9ؒxYWLۓ݂`.rXX8iawrH č4Fh Ш5%2@hg@h\nFkz9r[l$ 0aVqF,Ȣ&.FZ̈gg4Z b\#(V |ifF\p1 )>0>RiE1GyS`%f-#*p1 ]5 Z *jJ',pRyA/XKɎ,WC  &:º!9idFPZdD ZŨN&&Ȧ NP u UZ]5NVVO(EwJ`ĘX ^˝R KJ)YqJL^ "39( "4eG%] =Yj!ᵒalitGXEm Cp*EinABzHNlZkMk0e Κ*fְ֨^V@<ݘbac5rEY-["UcӸ[^EHzwh0Ṛ̾"'~Pnq І_Ԕ*fde$,N(~iAHFOi\ J/ꠌ6 I 6Bl^ơЛR A`TĘPQ\UaC 9 9P ϥzj%Kmc+%Вa m 9l)lN{A{5^"ܞR NU\EV,~^YQ1fdClE!*i"F.$jŠt)*;o,vlƀ\O2eWpe qj2rf !In'".@EJ[?r>ʲY&BD@ iSJ9BT}oAKKL87n`tQEȎLSIK,fYPRKP@8(к.M*%f"e_Y46q敞TݰaaTKIDT !pSlܶZՆiTgi lLJt[cl퐝-&BQqyjYGdpnnѤrBѼPD@ge(qx= g$jaa+hM:uYB^%RlO5 >RQ]lt󖞦҅< Td&&QQl:C>I12RAԛ9؏`Om\7vn\@QQL) Ě} IJDeD3Zv [؟I C`KᰔhK:YEgg1`V fR)F.ː֖ѫ`U"eq Ǫ * GD`NgmUYjRMQK!z'/_P`MRm̷*q-uG |5y[1H֯͞XE4`D48:΋ω|R:v7lO4Hy,cAXү̥ ]ݨ_i[x۷i@)H庨`ɧ4N;h+Rd뢪1#?j ,ȍd4LS{;?QhR-M8TbdkiDuWeĂ,+췣Ң z&ӿuuuWW[¿Bdu2299^br9GPp˷IpeT%<}67(W| Tv·1 @Ab?*:T7; @L@ 0T0 *B \h ĈQ`ǁ=8r#H rʓ+a!2%Ǐp"rD #: Y4dَ) I%mzȂV+DB&-x0 ΊюMXL #EհwՈw޽x8Vdㄬ9b.dnrݎ|1g֬wsgϰ"n 4,|5V|5ٺu&$(|),{onXBt&NU{y+Et\qB׻?|8h$vڻ.:.̒#q K62–@6-򫯾TjDD@ʨ%;TDQEGLEv 6 Mɮ0␀5 Z Uxˋxb}jQ=~p>߻#2Un[XNuYeǎ EܐN:, 8VzE&\2tG&ST9J|Sӛ(i;hISwKCt:ʦEFi~)Ȝ*k3-#dSc PZ|s)jE#S՛bMb5+K]., Y_B,ZN€ IYlL  L}Gԥ#4!F ŊzP8&ۂC J%Z4d e=2RgԟNEPzzˡL[:O`0b$|W7^xQ9Xɦ9&$UmYYZO@P=yOaa] cRJrRBƑSlaP h i:~ /Mqµ(|!Ebt)z$F L@YNFj:|9i24fy~(e`d,nBw2I@I 85 >6D HTYxV,m! eH/~vdDUf^Ǿ>Zqj_ï =葏]HA8"de FY2IBc":]ꎪKjWQbU?2a$COn HГ*e.?%K]S5n,3 I'1T(dp%+ : dTxuR0-fpCvfŚ`f0*g90rOP+BnYp]xlrJu8c7eؒ~6-1T T-$X-9!pɷ/vnvU䭆gRYf;u!cFlB;V&n\***h1Wz@$ZsOB7rߎPR!}lkd5$.)7$CD"Т[Q75v(q;J|rPe;.\{Y IKO![-VEfAA B <.F+&/O\_:CgZtV / @t ?FU~ kόR&` hوFda/$Ȧ5!;X'jʙd$ |EqZ]"6" }ZmhגL?}H֞Iw=aPM|QGda ZS!.NI dA;lYW<&o}kl=B\˜&ξffrP(A;AGl}a}f YN5-9מg}_4I r!z H1l jKZ:2'ҨC_C6-%!'>60`X+dddZe#f-TP"L"JCh܈Kw#C2J벪8BD! ]n~h0`F"EjdD-RԐl.+"Zt@g!/)ޮjv~&`̈́!"(hK$,JBTEޫ+,(o-i$c(`[ kEgRp듖$%B%CP%bqv QfM M*c,6ĥ]ZE /OU.\H .MMR4({QZo3 JE/*Vä'j/z:(z122H(x"tȗhJ.&C!Cz7`HLA&4:t n,ѨJR.%N% E=-x,%vBo ,, Z@BT(! BFDgD$*j '#ϵ`k2I,GeѲc?jjdJK$#r"/<Ǖk'2P$B`E$T+kj`Nt`1]o1 -2eA&q`&zaDffm#Ҙsh$'-br/M,` BVj`*"Wƭ̄8eh5~ds}Tó8#1tFO+x"}elLZcCvMA ™`7 *!(nj ъFkdpHꬎ$(M,>=ǁ,iRr&}Nge2#1F#J(rPǩSƁ`N!A1!sO%=8巐~*s Gk#vM&6.59DO"e,`6CR5Q/i9Tr"9:L@JQ;PDkjڭ#n܎Lң<=0냋͒Bp=A7YNɵ:\Wl]]PЂU4%^-R4zb.ǐ49d Z Nd!@LfoP8cQH2d 3bA2.IBJ-Q7D_TYԗv2.B+-FsĂ_mIò>1jOO2R 31rU47%63l5,K'0IB5Ui,-z~xɘ4m9/gQV]:!g>rvQRWC@G02\\\_@A9/}HbnPVQ(B($fr@&p ̼άZ%PΊm`HiR,y08C6HE T GBg"B'j\p%ԣ)T&ug >"ʈqbJmC=ŗt 8OURN[Ovt~QiNIklG5Un+r͓pjINJ68ƫ56홰/+8RDeuό &3 'zv#EP@فwtDu FjD焂&w]˵\70߸:wAAW^5CjЂFFBk&7 Zebr"Bs7+5/fdf$ RSXJрfEvi"ϖK}}b?2:o# -us)%,YOYQjWjsk}3n83{3_O4qPxK+6aV7y,yE WquRaT"o&ϽTQ3\#b %0 <˯<ڨ'>j5gzzX+ܮFs)wA\=Y]wtI9{(B^;uʩzέH+p!ʪ| {J iTsT-G԰~V}ʰH,-TBze8>Qգ%h'fӒ;5""K=8& (T(JfIkAixaOsK*584{x]FqXѐ (:e'_'U(xXUEԍ"d;NV4*Ct>d؍'y,_uԸï<Ņk>$\C%')z\<7@uuc.t$UBOCOҭQ3 ],ol iJ*ٞ*DYW.{) J2]ڴـEd%(RL8R2J-Ѳ('?\d Q>Ǽœv֟J"/k#zSJa b4I)VG%؊\G(Vs!O"m3I RBFK|]Ar@˚WL!G?n 6zAt1pە,<>!rۧ55@GW {<7=gaïx 2z yʌCMHOGƱGki+9sXNiX] ImrDw@2'T"|tróu,.Q4t\ K[ЎTЕ@ V1,}S‡~*h눝Jʹt0 >KR_oO]#+뗩vp[9({d(0~} ݞ+Yr{U;C4cno2 ,-;8NP.GWFk}#6~u~L4qM3?{csUw*a:jm!NJ^W t5/M9sp,NSb.AﭶOl O\~H/FxKje&CYZp TaS;N.ht<D]0 v,;1ّ iHل$/+[r4k* RZR!I3.fѠlD.7у)A0\پ-Nf m,c?;˛v0ohv83Qgi#rYUEΐ2u((s I0yRS '-IG&\jdIJRr&֦5 a @Xrʼn˪ơΖ|iʳ'-15WMm ABAaO?rkNrN/~%yߺ%K^4ZЉVJXA) ٞ<"<{> G [8tjtjₖD!"d5d.BRfcm]#"#A8hj>i64lZQԗI?BN'!%YƬ&j 8K#*Q8D!~"3b**dHAt,ëM\$\ kn U;f.SU>i.y$sg.RfaN*fBkQLde3@9ɠm+'Y?ಫ3 L{ ˭T rRGAAJiGbMZCdӭp05FŽ0@6NFmX30%{-a#l: zrZ5&t´ xc‚wمznAx}E3&娦z]Lc a2H|pIrԱ#wlw%ADWU)n9OyL[|[_6s\K3J! aӂM>P 3얟gG ѣ>61'VuS?%uiu//j8j!Jjs}QtGkKu7V2qF!FE6.d rCð6_F3uB'55`;P#&2`[c,I#2 2DTH"Cm/Sa3dSE &)NN7^R&FGl8snoWpI"WAdAd1:Wqg:ws~ww:xQrNщd&fJ1X.wݓqZrB'?&WN0CYPZQR\%?1"^@֥A(vv7k7FA$8kU "U4"sFVB#m"^EDhBEw&_X8ax[yay] 5 ybg xa'noybVr'&EaIp!p}8|هGd*yd {MF)D;~2X.B>V&g`t*!-L9;8 -x8ɊqahQ)>ii?]?WH/jf/xnら91Dknn>2LL;Q%g>W-?xWX'SP^gj!ZI]ics )ڢ1%Υ$~_H '6d\TTyQyyiCR,4C:BL]roG̹7$V|P&$Yfg'|'11'#IRcJrZtqP g$Ҕ[dM9ZK MhXl=Wm4[[]-hB#עZ;!8td\syj( ^P2֨!H#Y>f5$kgj4BX8 Tw bSZ86B֏Z욐 I dÉ^FbUVbf73W(pacїםd:tW-w}S5BNXXNl^{l #&Z-4 )Bk&54TRTb8H%&r#\,xvfĒ+̸yk bmXJd` .`SaВ vaK(cm*ҷ;$]vq</ۧiOP'ZL-:=8\z͛h侨gxwhyFȾJث:ؽk ryn,X+TQo [`Z}{mv̜]{x):Y6R7t%4ҙ|ڛ{X&geН&p! AFH2-2LN̅ F4e<ӯ %.F8@Ojaq-W!w+ }{zQI4  R[V hʮàm"N}Qsp6 ;jߣ>6,0A]Z'qf"B~| ^f{(_"e'5sX 돲664-d;0|JڠSZÓ䬭*6a#qaexP&pRh7ı&.&cjZ׻j {*M--MqwAЦ;JO:bɾX}C2eBNdMĽ=觚ՙNF;޵lSL1"}KUpPpqkdb<Ș{MeQ@/Z2XE7h&&MNF ]Ә';9 Iqƛa}+t;m΃ͷ@B!mo"ifVoݯ4P0N\<sDPuw|9!v,W}z%d{(pݞhc,6MXQW\e[49߰c7zHQZ*I:>N vOUcZY51Ofqp$~Z^lG ~\mo$QxÚxl5J.4+[ 6%]nRm#1S@_vKN_*%/"*E7,m"Yq{]."7@44pP(4B#oYmN;qKgz l{,qgOwEb eJCON ; k.+Ą֥Dg۽5z* G̬$P@oӋ\VM'z\S900i6 `A`:mhE PKis! Dc g![ 4T(C3;f6l 6SUtF E& ,6s(IHXƂ =FB@V(iRᓺFı f38a d:,b("Mac+׾/E(/Bqj\(QR{59M!SP1 0!LHŭpkrB^}BȡBJ"tHW#󆥘WN [ YC덨sbB~sK@{[AFlVYM^d!o20A}Ѓ#:a&L5L$Yp2pc}`;1xVe%;<2ueZ 8ĎsWZڮbDg&*\ MQb,eT, F%џYP^_D9;de=8:Un;U|*q fz1bJ;FqS SȏJ%h]SErXr] / W*dLTc*Ӡ7`ҲUo~\6B;%{Y#:ŢIV,1 dP`MGV|!?ulxNM^=lRŒ&ġ‚pQ'DP*ΉdkfD^GFd?TI XS} s ^Ӽe%PZTՁj(KUQM==S =UORUky\Z7ͷҥVs&mͫX|!1[$ªج1 sX0G`bjEb\[$IqKgw}hQԣ<#nɗ\NƹrV{@y-AK9H^I`֢#?՝ tjXUr$8Pu"ulESQSUEFvۃ ]V:n5Z`3}4)pA`j6ت!cgz?b݌7VW+Av"k6]mITz v\_i';wjE0%pMp+bZE 5V(q[Ig/yw++gy;} r @)E;%oFJuB_4sTW?]vbա7: ɘHߚɥY"_VJ=C`'pU ɡ"Ǽ7xÿmg[4>侊ȢyWr.xkoޯ1v37eSrUĬۢڂAXCC*.9~!,AH/+z!Q!5[@k@ 129sH[#b "@[0;SKH;$#Z2#=Sdhϫ7H>0B|J9>^4[;3P) Cj<Ìb?T(r/꿚AG܈3ۊIDJI>L5`_ɞ:H滘5,@;#H X6QT]r _ҍ|aFa!<da*'shHq0F&| Tq˶|誌$1©!tƺG۟}<>3\ d.ÏԪy:̎q53=dl깡!HCC;??9D/-s$dÄ`!ܩ/jCtEԻxW΢휊vC$MOIaq_btOy yrQ\H[c'OR"2%u1̰3<' $ @GLJ[>@54uxzRȃ̶UsQ=,/REHzD" ѵM@ᄙ܋%|4㴿Ȩq?/2L T^ڮlӤt0ũˁ0J{$Sݳg(+AdT JpPJ†;-,iS > Ϯ5PYR6̭1LT |Q6U5 t9L zC/E\M_]1H# Z9V%%;4Gf>dҙbYQ2e΂U8j,;9UruNQ9 vSmE \{m,P|O~ҽ 7pHT~W tU1c"YY*kt; GMe3*KKL ]3 P TWu3-CHL mNuY ͈xC\~H  ȎLV/ ) :͗ZFsZ2v`:24a)kN`+15CB8q'7}7ꔜSA8RLyS c !b]A*ȝF=X} {ɋBJMh6QB-8-HFKdFd0&bV0^NjScn8[lxycζ˜yBd[٤kfP=!LmgvG&s2PP7{$URmL9SMU =[=Nlj{cne*!eF[~ VH &[EfUnVFck0fK;fj#ת>̬v_¶[<|~6hVnL}hE&ٓÉnʄS a^ўm>oo...Ak0f'^b-j2^o<4ppifJi,mq~kmpm>;pߖϥYydQ.e>e-Tf]S^kmٍoomf.̼Jv'Wmٖf2c4$p=c~mFpf@pUp7Gms=Lp|kvӏ$n6/Fn XxCq[Fn_aF 3HL cojQQPr cNQyt泠~*nCuuY0)Ɖ`afՅS\m-wcm=Z2OpBs+\¤gsOnL&kPP&S@y_tzy`1ȔV3. |"X*g:uXyj:=rXq^']_?J LmNfލm[;A2y5vqOI.jymnn>vy.t't?tfMFoԝ>00I'Ur>QPu&UV&ounf>^iV.> b_ej=d2p=Ulj/ m};?B{/rPtwoLGwz#m]ߺhQPWWnaT'DU|&YJnG| 3dP*_,7sţP4 YR|?础x{<%<:s@ȑ]JL@@!Ä&8P"ĈNxqBvE4YJ"E: rL( qI>y4@LabV|b< ϪUbu+WU`)dh֟e{,sڬ&AxWލ~ ->jj۸}>bHdJe#iK>ͱjM4z`AL6 =(//^)X![0W|ԇ#؂u1.Ԩp|x1^,/^ݱx> tÆvjvEJ5T#L4SNIaMqڅfF`mF#WJVn'`\cՕX^|y(`$H"=Y@nGmFJNQ oW–ea#zx]שrmekg{w~{ק{Qg}h)C !YJJ7QkieL6qII izTMbڒB"SNIjh)bEZvWUAO1JvZXvY]ώj[HVr$[nF.I&%")'^#aRݼif%ShS(yӹZ!!PBBrL*sKsBtV2 7Yv;s3`m3]u6 cKoWuƴZFInOچ[mXH(qÔgSς9uFw'M0 ?mh]XX螋Y]ι>RTJUM%s`z!^5govk}[ulMU?HAZW]ʙ۞mY,NZ_iVt'[5Oy K/ڀ_ߝ9mb1.6b 2֭(( Ƒ sdc X RvQYd!tWsmd›E _A~2$rZ;ȧ!E6 dDkf6elWڸ%vۨF9/iԈy8)Dz(&R;$Fh$F2.'.v#t'YV%Ki>#` CD R .1 m)(ZAh DӢGe`#Dd<@4gof-"ތk8i<['tF{#ӧN Mb>*$+JIln/&GGX2]T&KRvJK鳲\"6feD9}~a1d\M&R3Of6*ajpal]Ӧ\mhH6WAOőW>% R "B@Hfcf$X.3ʸ7$*IUTd3u%Qu ̩%)KsUR9hm}ԝR'lfĨ=[]n:Jbb\l.UҔr1=*R5)z¬)_kxɊO/6Wr3p/D PL;C /JW sDGpb)J'.uG]BYbBp UX$l! w/*U#lW٫rmҥ$6kI5Ɇ4t,-iUJ,T[9/KIGy !Cq裓ļpXAe͂,XMޅv )9uY%ݴ^49јr[;r#wiuc] ,H|r@%p* 0hF-H6R*qVҊps6kb4)(K x㽎UX;Է=^psT7M'grGriSSaS4hS4$v T 鞼aAqjm 6] A ]`Y^ LC[Q҂Ր-CA&ӐhGfdRN*y͊ 㡖ՔB_ƙqgh㵡UD[ #9\b) "Re=GxSC Ș nM㐎MF} N `U䉜= *[Ya@Jҟ9X6Ř!XTIYRQP%@EIpZ-"!!P! ,}V5`72R\!\S1`&rYӡGD$r] z Mm ` M`)d Rd`W %,D"-VT]T̅IXЅL(%cOEfF9]h䄆!ZmQpաV Tʡ=el%RW&#bR8(sPX { ?vS]CZguWE~g`xx:є")digE&%9YL]diBۣ h`ZShP~Z4T!(*(BhQ%eVSb~(UF(ɍL}ZP^+OJAQ [IrF i%j+@ P*&8TY'%W6b&)9Ď[,oL鉶~f*L!8\Ӆlpl.8zG֧iF`_vc~i]ddaZ ֜sJ-H< ]fj>YVݦBB ݕR( ҭF' >JtɝFEa]HZeğ g$Z+綎ɐlڅSik`fqԒn~tAG5*ݓDY~ZbsiQu0"i*bj/t!AJDjF zi|El/kZ]2p^-gq% p,Rrkc: Ek|2DUaRF`ZW~d] Α'dAJNg2Q>vjpޒU7}_ާPmրNlTn,-1q.fdScșZ4)xl/Nǻ"a'p\+l.ęgD~K( ymbm^²xn&kL~JZ 0)b,_Ux>kr[nTL^Ձ HL= XS*&a]- 3.mr͢U reź>G֪]K$oQ2d rj~:Om|mPr0'^$~fmd ~֒5.而O h)_}`NPVvLF㻎fle>#I?ꪴ{eGǮD6g*'U=%3 MOrVܢ2q>+^Z_~0[&LD%2K؟N#EL)L\0}F4"KrW#]J_0)1,*Eϸ_3oK4.7Wvr3ד~4ICH[B 39- ˰* sݨݲ`'/zVuo_ƁVbFQWt1_$(-1X;4mJo_&l,$ge9(Sa,1J#r(K'pg!wL'Hr0zcGv%f53M^R'`sjDs0 S` [-L-#8e Ű=Qm*P6cy=zJj'8kwlASd@6R`v>tJ@f0(N<Ӧ7%/|1̖aʔY&0VӫGV]kٮiVT-'($X߽qhҽ6/.6GSMd>>%.B@ZQDR"':KC`a0F]4LGtT-JCeО{QHc&V-kXa,Vf n@ژ\6-4xNNh/@@(4{ΐmgW\lΑ㖥>Z?d@KW~Md_>=wqS]bCeÿ Uud N-2#1F'5"#y,%YIʚ[SQU#YNN3?H;m}8/(Q-RIITZ IG5QT|@pFv>]W-7-^r~{Jg3ʍp=o 7Χ%7i)XuZ~uo!eOWxӼӽ8ca3ҨݸQ|e ; n{Xnab|HG%V_x~ U@&k9d:JU&c|ir+dBv F7; 7[xP;7uDhkpf.h#\25m%d [4&-lIr"ST҇K pIi@wb8"ſ5eDV1:͍<4.i3 DzԸFsH鮔 8Iy8+V5EJIy!Du 4K~$+&':w犏w44a w .CaegfN$ &H9B:ę!v+t G^a >'P:BVz{kX y tk. lC;E#j|jvG˝b_6b[Rp#&IS K^*SpL7vS&23D1`ۋRx &"s5;h+% 2mM6R Z#{kN- 󉨻<ªka?%XfRٽ{Mg**/͢L4-iJ)4Ii/<JsZ|> 6MȭVEb-Q16M1i\c9ycA\d#IVd'?Q\e+_Ye/a\f3iVf7q\g;yg?Ё ]$4N;эf!cI[zяJOBw!ƎYiWo:ӊQIw:5-iTtiM[ؽFv; cټֱoen6lo;ّvlZZӔ浭MlZve}m{׻&k kx:ފ}_.w߭{f-r[6uս鋫{ܞ6!_;81w +wssi=u.%繾5=rz$am<4sҋkw{׭r89os[%ynuz/{ryp'zmv?j6kg谦E <'5xC}?^WW|jw{_|W!!,@   !!!####$#$#$#$#&#0#:#B$F$G$G$G$G%G&H%G%G)B:3H(J-K=JEHGHGHHIHQHPOUc\x%dCkTkTlTmRq;u2z6=GPSTT|PpOlPlRmT{m]on^mm[mmWllUkkUkkUkkUkkUkkUHkUHkUHkUHkUHkUHkUHkUIjUbRVkHUkHUlHUlHUtGUFTDT=T1Tw+Ti)TW:TJHTHHTHGTHGTGGTGGTDDKCCHCCGC=HF-OG%TH$TH#TH#TG#TF$Q?(I60C05>*>F(AJ%FR$GT$GT$GT#GT#GT#GT"FT?T)T$T"T!TTTTU !U##U##U##U##U#$U$$U$$U$$U$$UBBGGGGGGGGGHFH=H@KC^GkGkGkEkHkHkTdjakjlklklklkxlnvmlkgksЪתתתתתتتت٫װһé䒵)H*Thȍ4l(1b+7ݼpCơG4}2()AeD/TJtC C)5WMV8BG.)1Zh͆.?zlT NVzk,HiТEs 4)LHJIS݌3݈ (q8/F *y2ZT>BK2_1S;4Qbkxu~Х|y^T6o v(P7+_μУGIu5IMwה7z>Q>Nzr%H}$eWu!*Kg$RMVaR<c-_Ca&dP+ue}|yXCI5 IVD.[}W.8c+WY}0ZggkgrXI1GIeFVyyL`Lh(ttJAOr u G)*(zY֤YjoEUG^dno9eIQM@(IacJre[l.ŦO}ɚV%VpR&]%lgC_.rS10v'hL,2N0W9P;uh+G}\2㯿 {pU`I>X¶HVd;ĥ_}^<}XQ@X&1J˒<VaQb`{^^qa%f&g}\&.V㋕ՈcZWQ3an\ח_j|1biPdmozJ6ؖj`ũT_7amEEsiժF9Bh&) b CP3*:hԇ,1=׹ p`^܄̠2юD⦥G Mv%#`'z$}CysԢP(ԬT+QXJtPyTcZyY"D9t)>+؉"z1')H726LK4E(Ui^J~Q @FGIqm{S~(ӡ}-7ItyԯE6 APSxAZ@Rȁ`xK+Jm%u{ Z8g'R,yI0UVQLJ"/hAJkMLbHQF1Jbg ]G_!E6*!UUþ /(.sWK޽zԆ̳9,隯$!?@g)4 ]5A%BQN] Qܥ P')*QZx -c D/eT-9F!Mf*J<:LeӅYZ38`t-)6VroZW$7'fӪFviլ^ppiY̗}J,I9%;ģEp29%%2:xV,DFr̈3J:[5t~ûG:Mgt` f*Ɯa`r w2 |(=sV:y( Z[/2/+N\e0;0\_Hiovͳm4{ 5Q!bZ/j#"7ᬶ"C[3C x]-_ݥE2GyMmj! r {ǮrK9 Ca!>Yʛ,b~0($]N7iQ  z6я(#O>5v&-^WDM(3+qqvIoOp5a gT)#D+e֓-pqi#m%r4lH+G'gR>w4f h.;wg"RT&v$JG ~L` t$tفA[bwS)O;*a Rփ'vdppiP7pFPiFp PDi^RdUg<.؅#l"{FwPu8'{ZE.A7` AQ(X"Zn%G R6%zAGB>_%Z ;t9*QT7.Q%7kt3#rq ,#` v7vpLpwߑS؄X K~CFӦ_aӈGbS"O&CtU|1InsF !mOˑ eoH'&)bV5m?nPXa<'f=D"ukd~;u9R#'1muiY6 HI.]?`u(H.qړuQn6jȋ2P'gpMh7А7U~X!ig$.{Qq-YNvw;5x-e:p8Q:"p*O(lcBual AF87e3,dy%~}h~aAgzFF6P%;D<(+1{& 8`A3G+Ll4IƨF8}}#|ymїy|+Im"g[HʑnA!`@:"3A9s9f (tI`"wXJ(CAqUwjWQJ*$q dWx}ʚqG%l}v !~#a6CSNȹdaX/ˑHIzyf9E+4B1 B Zgi哟!T!Sb zk7%Jj5e(uch~iJ)v :xׁ\߷dE,Xbfc81 f(D^irkktbOg99ةI kP8P(c2UbI$qڈveUSBG2>Pc% ` ŐۇSa+j1A0d1z)ɣ~+54MuBlkКYZG) pEf@"h F 1 T%v o$]aHn#dtPlhmA@ IvSp5fѭRq%"q"dGvd@G1(Tw:9zb 7ZK.Rd }6wFIu/D(B(4:~KC}kk!PΕZ\[ Lh[ "XjTb` ᓺ 8#^P%$k#\xƂ$mHyN`椿9A;m9C&;f5UAաƥq'G`}k F76¬^P b Q\1f(#RW3"lJXl($&R`қf`6ztbؙ!D,jE~އBV3ɾ" )@'\)|W"s;yz`  Fny')^] L:$/GPT)J¯>5rÏ#Lw݁buEGGtȍ ,d![>H:!k57c⃾R)\!#}/PP:6G%=e PjuvG iT #a=RYrv*H^txv|eu ԆżI*dOL1:s`DrSGP 0e m 7bHS,Τ vA /H|[% `-<`z$Wm{+"X$7,n97_1_=?EDML_"ؚl7y:$O2R8aTF.!Ur񃊣8 FH J%^^!!μyXf'2WP6@V,Z_5#?'Uݷgٻ؃%5f Z&ͱ'G8eeNʑGOR uGw=aD=Q/& .Q Ju #~bD k!%~Ge\KP0|MN?ۜ%!A)[-;ӲYI!#a[%~{CԂmvLpDPsPsx6s^!Ī?"j3o7XKԎ xyy$;Z#|e'І 8o뾻*+qA*ATtTᛏ33 p(~' ̸_kf$PъVRFI%ōM .lPDRQŒ =Dxd/^x$F ]K.7dl9CI9Ϭ t E= O:HY:i ?FD XM5Ȟqإlsi<7Κ۔LMLt&r&Gh|Yj YS,_ƜyWGG :. DVYlM>~;7DŽ|2/k颥VZ+/;1r/[ԭTv>l%W썐iy}_?xs<P A#Ce$BI#h㏿zȥÅ:pi(za_)Zpîu#d:hêM#:mkzK1$3'r(!rF2,&d< Rт?I3NC'6j(NʅIZN!/4⪇"CEGtAFmn4eR%S[Z"[~\o^GVbbhaS]!M)\h%ko+TZԻ*RbJH[JkV**.wybi^ IFQv߹m W9e^=tR<кڽ*'k(+'OvP.R 5TNS tUSk:&.{!*$H6`窅jE(R~Ś[q'Y0?;6Gңpj8*ȤF:6ee\~)&Q8/WPs4@_L!Fn1^w/&"K< FyЬ8(嬎ΜeCTٲ r{*A3Q)P};k{*,p!_\5~ \ MTjIK$ RԂh5Y\r֭ #XЃdseD!VFvvR L.¯$Άz[f67:Ib8D*D_R𲼶E,bșև+k-2Cl.Ћׂ1x3U10` 9hz^HHUmh_`؄C!AkIzNV$%wVGݧӤ6!LWE08 B $I!:9pC#iV 9 l R̒䆖H/ &5ʉ.;R&wVu8DkחTɟcؕRG#.>FK#B.*M9Ҳ!~^q&Rc`%5jjYׇʓ"kql0M  @=bz)D[\d K>Ј$fBnt0A߂h!<}'Ws˝Tj^wCp>^QIHF2$•Ji/<Iy~&،a>1lsG<| L2윣W]4j·*h3aof~M׷yNq6XurӬS+֡68IwiIlr_PDt1М$xdyKlFg5q=IKyRpHa9Zξ.ϱF!+hvr#STrh{r&$Vmsed}/YLVtK|ZC!Ş_D~٪JQ6mD] a?Qka=`|1z]V,f~쬮 Ii*W9m칙HLfv" 30{@ng*U1ZWbrZHN!xYwTowo˘t$j f" h21.i 4G$^|M(:P) _^`(ڐ:7x$s1Ĉu&A+˛Nv<318Ԅ# i˸а 0H6 У[HùO Opy 6: S{,+L㎓HØ'lᔦ B*Z2)È bB2k`)p( h"@fSܨ3^Qt E)1i#$! t?xSeaj ۛS:XJy8Z.B@SԹI z4M@3'&691fܘ i 2Í$1  Z|(@ri(ZW6r@'_# :l 51 0< ;p0۳r^èYnG )L j*K.(+#tTSy%Gk$ͳ06X n\ʣ,+62l['jʱc2Z\: (A:rAۼIZ:bPZF@pS<2h˅8h:XFl^.6xR[% Q0bv$ ?wzx􁪹?z+9CY%$ڲ><3ok陫@вh @SXoԶ8y  ZȀJL٬ID(I>ã‹B c$RDNz<90E_it%a8G6k;ttDk}lv0VWG췄`.4FX8qKvݛTc@$L"IVqOKa3< Xr ݰH(SSl*Sh-* FS!,/*#FЈLRӑ.+˫]KJʺ[-k0[ 2t A#*cVc#L?!cn!WMB!8M2t![\;\iAS[eME9j̅8i(Zdأћ ZY!XVY!-[,ۈߊ-h ?YnЊ;Ol6ǩ=J;:s^k- B?tu:LЀ;diE,] 1!(xjn{Ո".Ê)'>h>`ш֫612Gt½ 'H=^ԓ< UZқ M(aZmvaaDي97)M9IKY6r%1 ̥͎#2 X2bCU@$*B 3["[D<7fߣD1 ͐-(F0%:,ʖ{7Ɓm!:4dıIH  \d@=dI1`(r  '~![R3,(; ]%h}wڈ>k#ḫ Wk84u$i΅L$ʇ%砚rŔ 8 q^츖G!8噑ވ.3;O;f;V Uv!ZX7NP%8 7EaaˠfZnrQ[<T~՜ڬj.\ԓ{]!&E);1eʚYC p6e_J xB~ sB'R;zD;b-#)R@{LbŔaBd]L. [j&>nD4ñnh7!kH+C1moQfհ``9APWde,݌_N= ['\(jfi ȏBIr 6pa~ P^bՖ`͓:UU?\x[!>t\dQ񁫀qȇgh∜!` Ƨ*KV!a7ecHz/Za\YhX&H2b/u 1{t:1mƝkb\CH=GV~%'SY%,iJ~]c%7_hPAPG6[Z{~g򐭞Fii=k|r&rC&7PBKJ#:a!/|+Z=pHJqKR~YW-25Q+P/./ R/G2e Ljgm%LZ^ }0T_BccH ֐&4͝k!%QE{ h4k'sEV ~* 3nV1Эn"F,Hz4{MFݶظn|ZbH֧wu+ſv~݄lC* -{9wحra)EopzVК<|}[slUI~ixXXbV.Al{qKtՅTQQ"yN:,TV>R:F6ق0 EZA׉{p=<5B%Rg uŔ@L&(3Ҏ} F/ eRTS5%[Gf dQWHR hDNL,c%EkaE'Q R(H^Xc:@a:7Ѹ7g[VFm%תt\BF^$RH5RI K !M)fwqtu{ k1iBA# ȃۛȤYdbXNJ9wѵesUh%-~4x`B,nկ*ImEj=Hr sh|8RF"F[,E=/VPn䡓uZ}eY. zD[N}Q$U<3n?ʃSa)!l Uyѡ=ZЂFa;a[71n홫&i?XR/u R򐾹U,\{&\\$%]P#5]PѴ&P**AW0`JuL\*XM>iRc˜A )yQMyY%gzI8_8*x.4H}ꑋzLCBrGp4vɅA q1#,h:0Af?"\;TtB1Ïh1du*g.)DOcyME^E;N+N H#Y44MqF8IԚ&#ӤPySFGBsR^яXRʇF5.|҈]/I:pf hL1x ԤNYFu-fw ђbg&r'YWR&ifSȾMHz9XSLvrS).3׽T!$L~,(X"}7 Z`*USLʿSүXf_#J fPEmr`JFHŤ,Hp#UL݈2q _p<"cf8_ r Ο|y kRYF=gJ g>}D3Ⲩ;#3̌-CFY#l}PlbxX cT$\_=yF$k4%D%Ӽm$YIk"B43|&vҵ Q[ L.^#P ƳY;ma)3c 5N21 Z\ƚj b!eG$޵fh<x5ժPU!J-16_[<LX[b&-KJ7I D FZk&3M0GCBFGJVβ-v-!rQ#q+U)[F,.b Ka}diK*!ѻJt@5aj\̐D]$VzkQ'0aV:MjT1zP)d8(]%g"n7O=i$*VD%A[F"55 b ,\b(5z]tCXr r3M7hUh+pR1 l""U{D56JAuҭz3JL_#S;pRI'FFz$ Y=/eδvewJh3$Fٰ%So&hl*vb/믤',k.¬^BIR/"Z12?WN?]"VF SJtU*`0h }28x=U=4mP9)CG)Gٷ4`Q[v!Σc`U 'ߡUdh2/Wr;flQ&sI5]~% o2ު.dLWrEļf.J-͟mE ƃWuGwp1TI.uD`w t܉1lYǰEAUx~čGK *- HXD퍆BXH`@İTݍQ]Z"E%ؕNz.RP&BWCWͽ\'.a1=)߷pb5 ɫx-i&Yi%B$Gd^ Oh &ڢ!HUx8S cJaȩV"Qb\L\GuH HޥDѣ-ˍPa`LUmF)E$vjVjŒFMj-r:壤Zq9'QAqn՞o9plGb\mmH>B@ZC~B~+x#d`ؐGt* $haCzg)oFVRИݕIPq^ ReT KO(h)2ϡLSi&S(ѽ m,)Bϟ<)HL%ʨF̬Ca]/EB ՋFfi͛RDԡe ܕ^ܷg.Dɋ e 6O ^$ZeHꡀdƴ XSwmY0H6g|jB.m !3@Ww\ۉAm{$erRl‰.6eeVRt_zkNN-CUu>M Q/TroeLLFݺR U9a^R׫%Ɋ05WJ /d^U)[t !,bY 4&2H9XQ\E7v+1wJp”dh_\(9Olv1VA^`bi[lU1.211"#m&8U(I4vS#XZ\sLw~vN0M_W.δ_G8Z]3v2I. 8^^jͧ9U+hE&p\Hh0M+_]IiGppZ7h(ID0?P< m @FcYf؇6l9 횚j\Tg4MH;Y"7&wLlUR@M)QwJo6GQ&HSWP"}w#LYwvsk+K,Y_CnxmCPEhuf6FMxƦ~G`bz,cքNm836]~Ucd8E8Dy(bť"퀦{sm.A̻5zI#;5l4˄)5*i9_O>LѫQ)[P֬oQ$ ݭhV ,"ũD3"_fSm<7`{z/bN/#zRp&ԵnQsx'67jm\GDM} y8FU,_nх}SvB;x&Tixjx\{<;^#N^x@ukP7ϸK}h}Z87 ~\sA-Ũ&eFm9 4Bȏ"aG?i Ib?LYTAdpmiVT6c֢/zGz =D:QT;= @rf@ LxP@D7^ F4hCD\:Fʖp(S)^tɐΖ=w]94FYniP ROkXS _E-C&6/Z5>M*ңnEjK1J8Eg[.]<K Jф3iJ7y6D#[) Ա̼O_cض~v^/qEkUꍫ|q\7ckۮ ~nuF-+W\ptaƄQOPƍnv A%1.)I) s!P 9=R?/Z9kQj@>Mk 4mƦ-@:+NE"Q{Ȥ4hJ++2J,K%L0} ˇ9Hbs$*DM;DO 1 Z̋HN4SMEͱBvMDkK-tiY~һPmk.VmCOhȴexlTQ: +&s#0~JLZ'/᷽Q6(֦Q"wܛxn)-wi_*PGJ뺋0kRujUTex1LYO1?I[i&)hԌpBZܲ^<_]H 1sqV2엺P(qy-$+Vd #K`h+;q\y93La>5tgϝ'm- .r \V 0DK+XF YCM?I5MSFZkl*gy8)bU+:XF%ځ< dv>o^חV7,Cr)(/P|#l ުd+BUgVʇu[{oc?HZ^f 쁹U~һ.hi$XzBe,kgRCd,Xr|$n!?;[(+U QyAM] |/zWM8qE@E?bw4D#" ^N'>H½_p#BR ҍW|ۘ$qR|HI&ň2b'OTRFq͹,d&D-i/hvb:JnuS]K.p1`ĠE3b*MLa W|)!VoHd1ZB6tc~ HrKLG-4b =l@J4рWx @ʝX: f6) 74O&/h(t*Y@ZZ ~RBH*"ļVe݋jfC ?Lm#gё$=„!z8+q`\=#F d _3&&GG:%lH%Q.&:VnC9-n|,rb(J6rUؐ-d;J =n }"]@ p%),WW,TX &Z"UMS) LP2 [/W8%Aֈ4|c ׂjՕ@CX, -d k Atx:&JWZRª;X\;EAi$`j%2/ċ^b "%?+KCZr6{] QCx;Q$r(Y4ic)֕S/XoeyNCǷVaFPI(UJ#FP`9I"@Cc $y&cqoR##yQNҵ쓠I]֤ #Te-Ԇ k8^< pHE :03cjj;2ϥ)Mf1ݙڬJ HC.kIRl%3cKVˊBX$ Z(P_QMDD<‚#|c+G'D//͢Qx[=JVo8`b;'T&/a P@1dkXUm؄,]iz[&bLdPERK[PJG̗eah?o;R~dIyv~܋/ye__< Z*M,r$6iKJ dPM\VoHpV mf$'DZ(i?KndKFbBRr KӀF+.B@+41*aڴMlWju6B-7lI6~c[V0ıls"j K0JBv2;`_]Je# AHć!aԾZKcnhm^+qlRK3=J.$#腍RDBT<#Ђ-nI(x -G1'epEP1~Supch*ԯѻS8)-S,#T8#C܎ Ƣk<#B"$NV 6a8fДoO22##XP#'?EBF7NR%{Fn8h8Bi<*2f4JhPBrE(D?pI\֣=,U mT0-8Çʬi,p.5Grˉ$*S*3cNhP/1,p#6gxIVbRBFB(rw\e5Bs9[U逊'#T>#rUۤp,.8`f8$eXIhʄb r^Obֈ9jNWW@tA\5iPD~.%/R^uhbK{dJ]rQL|$0CY%2fDDpRt)[)Bq(*9U+R+W@ FJ-,iI-5)[o8vP^f"|v(*-ĨJ+I:ľĩFRoNi1#@Yj?moP?P;#M^LQ5 qF+Z!uR6C6TFX)J6V8:){N,&FW\Z SfSVPLbd{*<%K)$p9 +MDiQ1ENC 2ElWKt^ֵJ nx!Ƣ.^ 0ʄm/51>uZ0FY@P( 򙂥s:d*-UFpDg_DlW#\%^$%5'u1Qt9DҲ"<[(+XewwvSA# @cМF(*N\~gZ,`]u_MYN,[{bP)ATaW`H+3VcxbL%o"ee $iJxdWfXl-15j1x+/7fu2wX;0uu+'gZ:w'@:A nړs01׳k ZXa|)D=l|RY"2|G#Ux4N5{pAxHdδf&{-֨;Bd,d[I%3Osqjt;Jk`X ,D1#" ([t8{l.e@X8 zRos9Qkj\% е'bNZĮKdg4IJ˪+\m7@I@$1:wđZک}izύY03xE}ʜgnpF*v U]'Lȓi-VӪT C)H c{֡(E¨ǒLp~EMgJXr֌L*Q%MT(41ZTIކBʺO3Λ3dp}r;%Õ>9Қ%f98,ǂ lxK{F4\ϵ3g5my%ԛf,lRǂ!=;`M#,A@z"_:.]„֢9thW\ܸƐE)n8zH/7^Hjzi5R^F-#IiS6.\iʶVmF 0KKFM4b !C(0QSe5K6]bi݌: F3;ڻoε!ѡ NƗ'w\Snz_,6ktٽR̶rm׭|Dۉ;^} i>8d'B`sZ%\S .܂FH!sK)Qq휕yhD_gV୨be&#~ щ"҂#w]DfCYdH"yoMv%^]k$ZbeZz bj4t%tfu)USnj5Q)gB˜z6P45ԐaSzm\JU{jQ$|PPQZC2QTJEK*g>O՛z*j5J?#)k[k$">c:b=^c5-diffag6x.nJɣ hC]+!+M+QC_:jN_ؕe T` 73~m)n)+x_fh(Y1N :Q)6j:i%&ru|]BǦNvB2wHљ:Oy[^.%X Rh4&|9hJ#s]v4[Tn=GQS6_N:[Zm. 9t)IJ'0lP" b2UI a SC$ k4絿] a.ٍYcX[JoZa-b?'"ӢȗhKC^@pRbYoe[1RE2zbb aAX(I7JrɅ\+'?G_2\KI<,e˃i\ Th3|* !1)JgnXN44W%:.iGH鲫bR\Ҷ Fmɬj燘1Y ?Ui9M;+- _fyfi9k ކST@YPBpd/I^BBDŽW1C -VP9_ '(ͅ ڱ\S4FWDXR]s%-x$dӍv{J9"؀S0iX'I?qDIʷfe Q RvԪʎ/$/c*p= :ׄ˵T3NЉ86(;]t)f,1l[0ؐK+Lɍt]٬f_^'Bʎlj.>,{4BZԦVD)"нHzƟ!1d:!ɚiB}:]W w= 3Ёe}Mz+q!~$;: RԤWyܶ$mfˍhtaCu#>"s3݄Õ!tjֶU{wQX/ӛ_cHHM6~Nwx`)Y8gYs=^L(ABNksyNdqhaU)d h'͈P('2'xBY)8WE嘤Gw9CͱT):R(BxXlz 1a55M#x(xw6 &f)oW2dI/ZXՒ dI'fW%Ɇ}j'pHǗYS4Sdo2bי5 ZVy꡽1% tNg!!y 0i%Jᚁ8&B2Z:*I!0h',yW0 7jvo#+l{,!X!ERٚSRɱ 7f3-au'VVw@1 J|V:<Ao JeKNe~eqzd$I})F&B,H)QV!$6YuS7WY>aYdmZ5w[jfbHVk5+jפ]v @G $H]3z4YnLO ʨ2U uot_DDEW=\K,h Uqj6D{Ym &lV:6cS/0VT{ )ł, nG<K"HќH"P|k7z;9s t+h: zb8Ae A)X 1X˫.REs려-J"l.RgڄMbV#0U@alwZ> wv_L4MvO|ʘԤ!1yZc KPe ;RxžiOpL=#+qYwsZmmlC5SS[;9fA(ʪǞ7;&VJ-D| ||K{;j  ]) I L zr,+R` RgP ` ,!̻s#=KͶht{xڌZ{sA1q2{ߍy8m=-^t6h&9xeMc7)b݇OIV=RA7 |3鿫Rp >zf(=O<\C"Ƚ\<:1eE` L` K dHk;͖:73?<\Zn.T91P&[%:Id"s)GI^ѾB!cꪪ'0zMeHA1x',* 4C8,w}rn[36L(>y^,ȧM&ȵ<j *t&/5!ΒF*ECkF,8K[X~hDXh,.1H($q…-t#f9z{MfʡXMb| ڜ@ŕ%"1ρQ5C-@ʮw9v"7Z0¯{P,Źۺ- ,<ےn~7;aLkN$s+w m/<9ǧA֗XEk1fH-!+xMm4'3;0i }J-Ae#/HVAX쾮f me5fe1cX/N>l6~ی{o;Gԡb1^Њ˂+v Der =/wR?zk*{`[}&?}un-ƅDq5prW }ڍӄ茾 \Vpc(aM]wx"fO֣\Ɂ8Wɍ PIŸ< $80]4ˋ7^ Ihȍʼn3JFD~hɑ>8ѥ_΄饆9qԤS75MHZ\iˎN*RDtWZZjQGG*1K.JF!*)" _&Ľ@!8}L l)/# $BjL4ICmECaѫ"u(T)L%TSӫSK[=Hmɬ&12d)ڑm-2JԫSN1–[)嗁&kg 6+ h8Q22{nsEFK.X/[kKFեsp>IS<` nl(*O,b7@yJSF*lf0cR $šΔVCݐSG pqСUG\FLrH}ڲG6.; 88;N HAS<9Q i'Jbjq/USSUXUCu;ӓBl!A3]{ x-E^kjF&1 k'//N$[qkm͘WQW!`}xMM}__䔗ͽ5PG5Ue`<8gd9~?A?+SYT2hhȖ%EM ԙƳ$Q!KԴv-k:Z8.umJ!Ў@dbB A !ukCPtĊXh#x2G  O| (uE\qS J2/nQb_ϡ1seTfԋY[D+%.z Bդ;y AV][qjuKDSqa] )XˊF;, b5REfqQ`Pv)8Jyw$cO_3̍#X@f)`1Mf,$hpT< +##dnaƙ!l+ܧ|B%M~CdPAHhD#J^Z0d:RIo;#")bV0jmzSqeWl#f. M#ZsZϙ6'xuӊ.8kdWiӼQԣuP+Ž+8ԳY;z2oLBӉc=[MU d&DZ H3 $-8pH"j&QC,aF<v!jA"#患+fe[4hIꅬl3뉔x^vo%YbTM)Ф5b[^ cz'Sm|.>B ko5TP4/^, L!I}PUH4vSZТpu§aT&c|9x=HV=ޅ/[oV^;,<5A|4I's;Dsis݁Vn!]kcY*G?j;LΩiY¡Y,r+_┇A a8r= R(UxORKER~)NRRuj%uJFykk{ gC9QRIvdqBWFTͤayˈ Khe lE[Ip휷RFuޯab~M"?~U-ȶX`[_ V,3DZ8@;k(@vg؍SǛgC9M6R*Z)j:B㖕)X=]"zu|OUj\xթPǽ0kūqY:nhGYKuʄ6UŽ&7#s"b ,'-%,AT '>aQ|xY>2jsBۭy#MgYm2̺L:GsWî:)y@ q/LJ(YF (m*ԃ;?f*>Tq0 h h Rz%1 "0Xw.j;# iAT2Â,yR3mˣ98(T">C!'%ܐC;8ʐ_`%ًȠ1k'/`:0T]h):C -5lx>*F{[̚9cB%>빟;Ģ+l?*:`:,(  ܨ ᣻q!Y*P@@#%EX6xB@ D2Sf%vHLAS+C1)9\RBK(Rҳܹ: ̪C:\(:X=5KܻD$:3I55t;A:͚7ۄDOi 4q~[!ɜŚܺ 0 5nj@#?pINO[0BZ?Kdts[뀻iOKt=I'rWz>TG,]0/dG-=PqqZG)i1Q j9Fʦv>yɎ?=MkT?7֌?/Xa{MQOjB53 I[$ %}Н\RNbC_#[= , \Cdҗoۨ *J3FzϺ36c||AJv;KLdȝOƖL.d\0 ˹L :&DPJMGG%9Cb4L,U<4Ցڸ,>RAM-"D58c1\RX0AǏRN`.}$03T}ˢ̘ S}]丛k]U9Y[U͐7MaE/[))I=? ]^LoEntໄ;|mU}gU&C\mb%^5dL\ƭ>w9ʸlɔLQSFN]G~5݅CܕݗUL"/Ֆ*&ՄKMQUUɠ4ڼWGU6nާ-IQkV|\ @2DTN+_c.`5feTFuj_if/vAk[pnDb 6`u6ːc7cZ&Z VDaԾR=Äu=³J5BeNhR.O[Mx OZbSVg(akZթ}e;`yh_%iUf:w2Ӭ_bF.ܕ~cn碮,(J-wj&U6ȄGk4gͰL9NVO&BĊFdMɔ^-E̼RkÍ:l\Aێ`kVOyiWO٥ƶʾ˞7fޘhj$:i:dLiOYܧv==r":m¦ˊ̼)BO.IA;kZ5x]ôm n5iuX )! ei- Wݎc!jĝM]j @mbSqnn®>.eo9jFUbV/d ~kd/Dջ*YyE{q6u/2҄lfsS?&[ˮArS_lj/c8Sug~^aex.^s $ho>gSMYR$ HqYaQdn?}RJ^]on?doEuU+k7ȿ؉c-g07muoL*JKPwllj9Vh Gj  ganՒ]Nֵ]NitOq\qkOYoRQ7WY l!xY['n)glm) [+Or]Ê70lrK4t&5Wvb7sso|޶9wfam3oA)澴D?qhm`LAhKwv's$i1u i}#,n`Uz'1`YUS=9z 1XJ'?ʨCVr_gmldl OlvHv0ET@TAwtsOsotT̙ZE"ƙY~RqWgWާWy0][lѲ'ݜ8h򈴟jCjibS׎Vo=kE~Kk)OuBz.zFG/0fn t0 |hpA:̨q#ǎ?:qVRheƑ"Q\YeƑ!? URʨA *t(ѢFz9PѦBuuԪTZ:p!*:PðUł=,ۊmŊs͖}| h"/aj"v[x/ ,KjL2f7?sygѥIFm:熘[^ڕ嶭Q° $LB;yw+} oٻvjT*UbLrhs=fS6D`PRfdP.EZkaIW =!qfbvdq( zdYDM}%cMbɘb`=DsMi_{$guMIVnY喖i~`p fZ}DG"סn }H@Ixdd&ӌC HI1j~VĞ*fQbn%#'xⅣVf~5Ic:; )^+zjӪViVY'a߾m 5k ԊCmsR]^"ttIe}a /xxv0pRATUcAb:SRqiB씄%w >I1kUHɪUACcX.ytFA*5^J]5iQ:/fH\^bE8sg!rD:c(;Nlkxa{h1w!Zf2;J^L'S5䰭nH8r`t:q /x[5nMFBKuUOtTFRY\,Kwhv~+>`4󏇌Jk-kO$NnA~ noo.&G^O4D#`:wԑ8[`,Ch$,{d2)%AA_|2v͑)XJ1u$+t\= dȢQC;X'(hq"zY-*"R#mKKUQٺhApL _VC.إoq6^رE/A"2/r@¹)#HŒn*Ow I.h`D?$Km8OspQ%t%-{&[;FFiYI^ь,.^SkӛK6c=,Z\RbNo697>aH-@W)ŏ-)~?Bӥ&t\*Sf&d0p44އAr;Z¹8nM1D JSUQsH˫Be2 {L7:sr|mmf6^{-P>iVdDT_(힭ђ8#=N~0yJJ:oyؗXs`+ۿD^5纸7HxrX('[З}-:[.L⡳z\涉^>֑lY3N( otƣ$U ]ѿptNx1 Nq|MvVfpZĄAybQ$6=petƋ"wܕ3LRL1Ԩ1Q5fi%"S%T\%E}O3?#Ktq( APWfNeI|@@x]d0{M tH_g=sCsb%Fʉwz7~_#|eZŌV}?WfX:Xd9٢onf>N7^q骕b͸2˰z͎ Qr2!\-[ 3ͥ힒&Y4e❻xOxO?< =gjr6|Q/KCٸ8AT9y Yh޾e YAmY$rp}ͅ`!!KH )Te;ѩ|( ݄%WI4=!H+[#RIżN̈́LK%^$ m YmΞ_DB= 6hDSOX`!@l  TxuyM"xE}Sq&VK Z~YQ}V"P"1%,Z]ļhrF=m_¹@9Vx,2aKD  RYehcRq#|V9w`!!E6cBٓXU _t|*AZ⊴WB ` 2 ":-F" |ՌюZB0xgTP`Y6aʒ߉#Nі%LD!0RaE)f4?{ݪW|EhIׂ![V4F0$4^!t'$c$ xMPgxH gAe2dEF$L!$\ΌMM_fqw}%pNZt٭|vPLWNPPƙlO+VOb@Ws`45&qghݓ*Uh9Ѳe%m[*ʨb0*hԨ0W^/ٖC64"eP(`l_H)zZٛUbbL|-fc,*y = |o͊a#h:E)PɑST3f&kݦHa0=%N| (Vp\RWčPUեVϐRdy~g[)b#jY:z&nVNGڕJv`fT ]Ow_Zܭȩ-NNhfрx3cF I*H^yeHcc*XF[ޅh^kۧ 1g&䩒5c9SHf5"k U쿬/sh+uRJİkb}k)!ˬ))P2 e&mr+ ک Wși j*:bU5rjqXCIXuOpteKuO|pQ]{`-22֚$gXki]q琉$ThAҋsT2^Xl"spY~V=r^+JMစU`ۢ5Uc:qX' 쾱Qj'^1X2ih Hx,or2g4FU) WywJ&0LkdC;K#%Neݳ$+zi m.E"cl k2zffO<ٹgco벋.9KUPtrc4.9+Cw;CzdW3dC?D Mn4DA 2BCTx`Ƅ5vhG#I4y%DŽ2jeC2PL)ysdH:5V )ICd0gTMzjV[vkXcrQlZP2tƸE@DbK۹_5\Ftl2w 7Z's,.]"Wkj=Z5ꂰ5v-;vçy㮍PƒG,>CS?Nysn㺒G.z2Ҋ#NGڿ'Iغ$K[@jCs%3(C,4:/0T…iĭNp2cF"rMFp7 2#[kE\I᠔R #iiz $ )[1T4H=bQ?5iy)&5<12\NC/(M4Oz3EmTF&rB *‹4.?tTYN=32M5JKHM-bh4Mncm`Np)#Yj29"4A?W :@Ts@ml)oȈ(R2Ћ/'/NT/O=S;Rܩ(+!n˭h7n43)Cc-5S 72޸̉=VVC6H $6F9Sk]VLOu'fjCqG !%瑎!{qXpiq~4cY^: N_Qf{_FZ4e|E[nߎj0Xnru̺ ҏ5:Y%t,3pJ_эgR;QɝcMYnga'5ټvi}a \2:6v?sj͒#G:qƧ`t߃\ ^ߣvܾOWռ}˞`WC*WA` @OF:űVfKeec`&5B j脊SZX; P IZ iŸ g+E4"gIIbd5z 9g*'Pn ϙ@>+75Pi5)%,o :4_W#2$j bW%fnh !D]VQTq` [XUbX>d)[Y^f9Y~hI[ZӞUjYZ׾li[[ny[p[\Ur\>ѕt[]j-vnw ^z,|R.}ݮx_׽5,}{淾px["vp%bXnbGrx& 5b-o\x1e<`6qkBnc!3-v B,q ۸+}-cy4~/{fCP&2K 3\=?yhE>vt )Hs^:_dВ.ts5m\Na}b@׺2یhFweSÇ1ml?v=[5{eZőp;([{󸯼no:Ԥ7 m޳V7|;Zָi p?)^q_9^!!,@  !"-'08'?B&LG$TG$TG$TF$T2$T$$T$#T$#T$#T##T##T"#T!TTT!T!S#9 %#$#$#$$$&$2$>$C$A*2;'D$F$G$G$G%G-HBGFGGGGGGGHHKHPHVHUJUMUQRWUaXn`tlr*~m>mKlQlTlT{lTnlTllUllUllUllUllUnn]zx_]WVRG:y2t5pBmPlTkTkTjT\UHlUHkUHkUHkUHkUHkUIkVYbWKVIVHUDU?U9Us3Ul.Ul8TkETkGTkGTjGT\HTIITHHTGGTGGTGGTGGTDDKCCHCCG6CH.EM'GR$HT#HU#HU#HU#HU#HU$HU@H;HDHGHHHPHWHVSHkHkEkHkHlGlGoHrHqKrQtخ֠מץששששתתת֩өȩħ—plllllmllllsl|lH*THH5 5bЂIҤd%i}"^f+POFB-Ovj ̐=QvZ0'v#4M mQƠtHk PԭȌ%;nd~F1bȒNME.Rlt'H;'Et:ΥWO$J)CI؉3 abX V"-~B0%EKTKTkZ zCc^N,sD)V+l~(X$" k |= ~3[,Ŵw0Po|aW ' Zf*zERt鮂_`F1B!H: d@eZ p BL)&hQD<1kAYĠGH yũME&X]#Јj2}2@|BA$DŽy0LyThWI}lPW1~1Kb$vlLh-7Y)PٝWb!`F=X Hi5ˬ2 H$%1lqj&ӥ]P-eκ] Vez;XN+uZ=kwN?4Rxm@>Fr G5[LdȿRߎj4g9ē,h5uԽn Hǧ j7x_N^$бnak\].<'%i:"ޭ+cΚ-zw1YbնƵ^CG= hܲ~ 6MhqNuGuŘ;-íߙ)boc۱-I#sU) ON 4tyW5sdxE;%xO>Wc>_\A_fа^i|POPs|sPHVgUGvbn0]'5s&I'UC v$1(D}|ǧ{MKPHw|w%a,΅XXs)q[a-wxb+"[hvQ.p5 lmff;&sP|C0\u\0C!(alXIS6v/gqXSNQQ!pEH:F(bgZ-e +!;) +Y3iJ9ԑJ@&5I'm2PWvW6AK 3&HÛ{I"( YktU3Jh'8СF% cT=vUuҜbbY )8926W+&I27h㌐eUT%)B'(YBK1H)`)a0JP4p#jRcG߲mi(rjwXHnHuE'xXjRZXf*nxA*hYm, H UbPh鈎hI|PXJcVy3f~ɲ6 Ô] %j#J,::-*Kar5YS"C%0SXM"zr#'Hɤsp 0877x8 U[e89h9S&"FGFB$8HШqbX$Ȑ ɐo}pt18'#:/zsu&5R(c$J ` )a75rKh6L_">-)xCOʈT'P/0U瓀y䣥++)k!%xOyȵ%Kq|PՈdO}.q)+AZXh&`Bl:Ù`)5}֑II:(*a atƋAg(iC&Q>2u: ASiPH IzHꠉ(8 :Lj6WsXfcnm=6eWkڈuiOIʭQ抆'V;0 VD{d ^-d UUv{sA|p9‰uZ2Xs8Q(Xv )@#aP ۸G DtyKxA+²k[[ka.\됫;\P{?} {[WzoN7l~#>aq}h&'m y$hLh(ܟ\QLo%a[|&´v" I#J2 @0 Րaz,堫@1KAI%vSmP*0.| | Ѐ \gT#D4hN毒23(82!m7$8Ln˭RD*Fr(֭m c Ή4 Vt5Rps$ w| =P ,"!8VP:VL ,fT,i,8J[IPr Pp0ja7V,bB\5) iz.r**t->3Kʧ{0{†/֠qah\@{e @{ 9tqtOip'ȈģfHَZ^rhO fᆡ Qkأa 3g+.ud22&l33=!g#ڈۻʽO#9Zܜ}̛ q =$#:;ݭnfPHKީ<v"r~ºr"IJ֒V ՃN h1LqOiAqgb6+[[C!5Hn/rY((̳дVLT11xQ!,#|mu*\[2O ͟Pqlx9DZ= wE 1 109B@@8p#"@XQ"D9i!HrdC+ 0ߓPY@PhM? hPiB[Y1!ʒb||V]I¡d$& i$J-p`ˬj+i`iX!ÏbzlNrcɞ*bDQ3 -DoPJtj.9s~޶mSڵfpW%zyzϓt鞬On9J #F+9mwV ?mO#_>o@> D@cg96 #,DK#<5C 1¤ _?'#03d +,I'(z80-% (q $I I%ҲJ+$ -dK-\!2Ҹ!^,W$󫡇0H4Ns R,qmR2 l4mj>09զlSW1}U,%n*"B5L$\KOu05v>=MAҗ "6bGCq-$RRc+C-D$2?΂5-4*#lBy[9@R-f"dG1~ߺ몳ƶ.T>p˼l^0I/KRsO,liPn3N OĈ@̬]CQh+ *(OWqA<^݄x` **]J(1z*]* "+sy; % 6Z{La=RzNCgvJ5-R/T~r,{:1@P9T 1 L1Hp%Y{vc4 V$D(,ʏ{=U'=2@#rdx将hDHHzLlWW$8 %ӃElb: ; av(AeJ0G8nHP ԈUl )S=!hIJq F8A&dvp'|PNXTYhc$APρSf#͖bsgl34IBYL@>1P'C(!ila9?k)a2,IBtAݎ#9Dx{,36+vCB>Qi$pX&iLAJ3z;PBJ>7: @UXʧ=E,DxD"V|Ba'YdXQz: FŨR0"CbE'TQJ7֥b\Ʌ"* OxˆB0l&.f`C@gpfyQ2¯S{YN3Z¡%[G568%1VZ:OƸکZtIaVZ8mh c'd0%ӜO=yM8ֱ-@ë?kvjs /J:(QwwB[g[GiPGV3d6 `t7ZAQWS6. 㠹P`rk#x4Ze4D5%J0h ?l%x_U4XHP$$P(GD,:Z kL**yVy .ktX.!? IyT*E; JW8۴洔,6{ͬt( *QN<+վ{xѥ>ed)To]b<1G;fn=O+Qa! x 4Uw !NJ`m.3l+PW&ΐ( jJɼlۭXAϭx%O|{}_6 iK0i{O@3؂rE+'&0 Av59*Ah# 0xs {O[PH$V,. 6 ,a#A" D!0K.{ ~0r?bib[ 4 js?$ۍ2\9ٴB#0x/ A1h@L'ќky<ͩK$UC XDϰ9h $0H8-dpp-8,x :f=z@D,I;Nt ۢ+Řrx@c)/Cx5q JCo1TJDS݈([+xBP,&Ccp b 59_yS3JKN 24YBR^,EWE1 500 , HsВq8qx?`gp,HT#i؝p?96>ݘ A~A r|GpHKO r6W)1m%HHmT-vܾ?r6D ?etg]-( U 5J%hP0 f` Hg`vH,xMQ‚ܣ"d[ȚN r{gN挟\U㮕PqS r6b.0dP#P,0N0cv>LA)1{IZi3N1KE 7Vs.] ; "tX2КC8㙀HZ %kD#>' G{$ U\Y -5RȲ "S2 j5(T䚠zI T]9Q37*F`3:K۬:I# Ș@=%{wqbR켫WF:#])E^[M#ޭ0|J\P-%r4IX? rj٨SRCWE8P{ɏBy\ rP2q0 u_TL$ڮ4lƛqSk<& <}IYzl&A P qM" pr yP 26m詈3,] /l6x&O8*v Q Y: \TDԈ82^Rhe[bzkx V,A$ Z8 栥#f-,!=d)fbfc^׍ YaC:!k Bn2Ͷ[nR%Na#-lLv)N[:#ӏF)109K;R9 &k]M9dyՠq‡14L\B,V"[4" gx>Vb= 8gbQ`61NMfQ`o>jQ86viqEG8oV\cj* ^al}s3o&ag #ƜӻUG gx^6׻@2&vv @fptH$' .̌҂ [P Ts`Fo;wpQ& ,b pj,p : gp..y T*eKc*MB R@~ 86 S=&TO; =^ y !7Fu]/\5CEP`p(UU+T ™WQ;@#>Q-<㯌u/7~+6u@^}36u<1(nx8E4pC[ be kgeg`~fu]Z_>xffsǏ7upLo@8+G^$@( FJE9lPcŊ;RdC$(U @7R1 Ҡ\ȇhŪ/djZڒcS~R#E[zO*W4b*Y[[g)4)Ug*ix$E PaLG_Dj iDԹG^+q@ȁBQ-"/:4x%xRqAFh \OYh_}V^ThmN_elD7TUGmAύ$8dg7LeZUh`tYBFQ(F%icT0?=jeO͕tRJT_uLq@X0%剁=%dE5JO`8NyWjvEXyiv*zeU'c!ق qc4wک-2tZ2gWS SQ]@eAueq5 NU_UZ+HHFDmVTWW@.xW")H+do^(Yd_#:qc iV~7% }\{)NOwb]IiA/=@^v4kcjD9Yg(=ѺYBHo5f`V]A~Y0Ze۟1zi]rRx\v0i$2L1p|VnS^`s@{?,ghbA*kT2 '8!QբLt,%+e.Q[ Nat2L2€@_m-0 1!hQ!YaۅcaaKF*;mVD ht+^t)d$*7'S\4NqăM"59UBEčnFyOwӺXO~jvݦTC$;Óu" "QHC%V,lQ a8&hG/99~$໖H5)4&^,&7\tBQ ':)'9Ed_!pHEU 2辅B|ZҰ tǒE.(/ )!dS}QSI`"ܐ*8lͽcVZ H5,eFЉX!1BT"v" ;iF+t5p`˲"pcS `63&`sn%t!಩*~hʺ: u%{P$YNeDA-@=W {d>Ix*s!MDpMZF^ٺߺ@}3lSIWc+=2|oL"!5 xV?&# 2h1t  wǶ4EF2dl&"ɗ)%ً?]Rlb6)!muV< 3_^u*w'$ zP^5 3T11bT)l"2˨+QCU*w+| mbBK&%<\S5i_sFD+%uaK$1&Pqj9º `avi1FBOQ( ;Ie7j΁ƃXyhb87QZV*zqCA$HG$#]vlس"1{rY*M&s<{bvrf9y(.uz*1>S3Q)CٹuҤU"`\dĕݖc(loaׅ=J)r4݆-mE1k)v5~^Nd(t*^D`uE6DFϯUo d 76Y+eiUNW|^ 6eiy8FO,ojL $j!_xӾ+y]%N~UƠ%L1q$>_n98+L)aM﵇8Աꉲ0ixZV3ؘ('6l*5@yT6PS 46J"6 ~V}[¦og+"% 'a#.rYi-ɽ8))$HLPzR3M(FJpFO%\Tы]Ol4RDP 4E TS0_E٠{߮)E i@pY9_N%MVO?,LIYOe^ LMƦS -! DC VÎD~=cY ީOL٩]HV_ ؁ԙEpGT Z T =TYEZ blR H jT܎QLF?Մu0LM^kGsƾ #A8-`.e#S8ׂ֛  cyDde69] ZuSy׺,,[v=uVD}L= L ?t#iD$0X$pś xd_  Y)zIEص4AO-Չ!ښl1Z KP܆W_4\NBPOM";<]XWĜ)z Xݦq ^V]IOYKU_DKLd4BJ Nd=?TAK$J&ܛu]ꢾ,V&nYAԑDe,0u١D `E(ؕFM=Ѝ2 gRtZsTHTf4zc OI-Re)RZ,V]H*'ER@qN .Ic֠~ZN H> @ IGHEpɧ&XQ~rZ'ECąiM eD4=}\$mH\HΗۀ T2UN`B nfvTK&A˗ݓOE,Lnx͝vё>BY 5Mg$ХJT\GӀB *&o&bMXb^)Zы̿8G}SZ(EY J_JǸ[gժg-r dRn%a5yLiE8hE@ƚ.Ʉ]ǀy0߶HR[uP@sr lfwi' e#(mNL&(1q⌢d[0HX I ƎpLi ~,p~ɦWf\Dc=L<Ձ!ZƢZ^ sTC[z 옍T`#%CNk Gd'VEC ݎuZLNZOQ N^Fo ٥L"څ^L$rn{̫*!x W,\h`  (k%б9y薚'麨-iׅP eHw !?L qj+VB ReA8Ɏ%  &Oa݆X, zt օy(ƒN@dZ8M|,Jm^pX =l 2ˊ -NpGNGlN - 8!˦bDIb")NF]TBlj >`1@{ :ܺg; T )uNTLpݻL'*.Y֛9)i%FkVj* mDpNQB|8:+PZ6'(:J4mGyCu)D 2&%Z ^QšMB2l$FTc e麉!$;2? '񋩄|`JEyQv2 ,\$%Ӭ򳌐MuJ pj4-BbD eR TX]YN؋ep={0j)ܖfܦ8̝}c&F0J(*1MmWmtJVq1^0D@ڪBDFdJ Z4SXS\Io톨"*ͪ2`{Fxxl?SaKGl`;%;eF8V$=jIVd/(?>vė2Ku\ޘI M#`.F\ht3OaU0WsVJeD(@u,d#Յq/%tCsD0Y_ e0i(P|tH>WT uYa1l&ww}wBT CbJmnvZ]&UE! q7ox@Ko[LI5V O0rL TXXxrǮniM'@[st: dBGg GXkШ+SM2Fv†9kٜ9ƆJZ,uXI[4`~Ŧh2GA;eSDJmlAY\tTZOݝfP`B!axQiy1v/ N}4~cWL& 2"硱퐪M>D&}kVѣ(1q@5 >X CW ϻH&9rv ׶΄M4j!|$w|eyj|SvA{*2F-bh u} >uX?9JL!ʏQO̎no`jSsM$ʊC1(03r_r}$RTatɩ^Fj7D5Jlu7Paڙ}0M7iG7Y7o1 ڕmlw֧%ISXJٍZV[9~rѬaŮfD1$EhK;͍7n`!>I#~>ޜ+p $Y!iCrk L9_ew[|k s̯Wvɽ~69²z_%<%VtZ3MmK?@ HYIC^8ѫvPj"+GiJ#`Ɋ'M"4e˕-U"t945 $E#GihQG<9)Ro>eJ0!BVDbjW+ ڕ(H ў tm[@}к"惡ke%| \{8xw/ܫj6: 3i1U;[A^>ad29h$ׯ_(z%eU&@Jk1dcdLЛU"{dYayxw?ފXKÆzGv}\aM%5 $ͷ[μm?B&0 ú8@>PúxC.DQoE~k,Yy_)'! Q!C.%AlH S븠"Bɘ. , - J32s8**Hpj(zi{:Z/$AdE=6eSCS喋I)44)O ʊx2! ~RbՄ)LfESTU/7*09;RX_?+6p1rE}tp͸n )Fe'!ں,|(CP@{yST&^IA!-W XbkSR V48H9z,o*g!*KZHh4Ϡ|Uu y )J{-'IY cvråWlEOEq:6kǶ!f/tɱyMlyՆһ#EJ)]B״tQfrޒ3̥R r K0ZZje5yU˼l{0^l9dr1 x~Z^yzǰӡ |1A*+QD17 t5|m{^ _/ saGF9ZDc uBs/(aUd]K“m*!+Kc" +e;HIC `HvA#k(ES3"X䴦'P" dmp` 'h F"=ibĈN+m\t&o-Pׂ52STMy(Ə83b単{e9q԰FKeD9n2cUbF š@[H8暿\*YQH\b$E~D1o.nZ^a%aKr>-p~K|@S8'OAP`ĀLvc?+g_E~}C &x[xAG#ܕ{` H Z8Ұ58h `vTEHRiYTVRzG`=2+H؀$!-Y+#( [+ l%qo0ޜ5uC#kH2BhUJV+-N[#R5* bdG%emUJp 4fQr#€rtD9 `t5(QJ3:upCeeKX'Èg+'DsR(P.s`*3lEL ؓ= /(BM@S%D9ع v/Ftp4 ל0 T 6mi|a"͝NA;eId͊QT԰!orOyʑ%"AU=0t'$ĜE5/m]T#O4P!˕3a1r}B6%(Nڱ"2WPb)7Hn$Dܤ1Hjf1> )0L+r5»xQuRi:i&LR L"QZ\\7۳A4rˇ/GpeFXf+bXzR7.ډ<\'os~ADaf`5*%Aы"i@sb*B :DBa15 FkXd+Ȳy#TO)A$GrukVeaL[A"4suh-9rνrW΋v pvSYA$!|Ä2P{4)=d|ӖfاYKɋ Mx% yBQ{YϺG,\n'DzNp2+ڴtVrGufa4磔]/>#e}^ۧ}Ȟ1/yY'ΑSL8䲂9vA>+o 0 0`*7FxkM$^Ac,bB.C@ PL{eGfn&B N#ep@58a@>!S8XB184OzH몌X0ejFll$h>HhPF^ c+/B%Rb!: ˡO af~E Rш"H*k1CR@-Jev24TR6O@АYTKME2$Q(#2m12ԥ`Frh$@),K58Uj1-nQFF M]۰Oܸh.O/b=vbVPIJ@(0B6ʃleHA_cg&;@LId4 !PFέ0n%tU0#W0SG$:`j$6y#XC@#b(#AF*}F%5bĸʢ' P(=R& f̎hPꎭ+@DFRNd&EAJ: @epܣ҈/*Re F/rQM.,FcbkćdOi)2A*fYHc #W*h11p '$q2!<%.FLZ mqh k Qљ-3=(=O Pf./g7<^i*B>g,pcHP):M\'2D+++AK\B}RGF^@)$NSqd$@-:¹4! 2x,cO EF B1Dʶ-u61SesSHxyxT=E줾&cd`eؐ>@d lXn}<.Ys<2Jh>fGsCu/Ood\Gl\i@HDbO)/>jG#qKT<$2_W EVDUt`G`q3D v7mD2 h*-DKEF4 (rfr,;/s)Jh'Q{R/TRBt0C.~+&MG1|" <|rU!2 r?/bj PB"hiV6'61nVKorT"p5dpQpa2%y'y$f8߈R6_Jgr~lZƆ=hZ^DDL K `e?/&Q%jǵE5=n\n+IrxiNG_1dO0"BeL[0z`D`QDHV)cFɗ)glw&d R0"#,)S@mogdCJ ǒů4e[(nI_GԎ$ ;01\5tMB@ ckG8PBIyPc"|rذ%'ODO+S*ok3R!bcTao8 WPP#PH-R#Y%'˜iXGCn ?dFX7rf!HY %'fԼ" o`(CQX`娈' |ѣjU\F*w.~jc;[#a _92ݴ`z '2aDU6픒hF&ba$1 C=R: plLL@&ffJ+X(t/]Gh[,xM_afoBTnx,.3bNt CH6I2G_"#191y8n=:SGy6! [ގOcpz, 1X'ݸNׁ(=M"i COH:7 &aacWnw$TY3!.G} @EBaOډAUKF_ٯ OOE0˗i^;>D14r{Ѝy~Ďkt#eP;U& m"IQ/rV^RR-{GۄiGi}[nNxq41kk=FiRJ!1Aico[ER{v&TIU8q\xrm)R< x {'J,ΟG ţ$ʁ5G._p ?] kBJ%B9|G͕:|WCPO^7ƫUkV }lYa7hwE|y)/pSc6\C\T)+(6ۚ pn(-%<˯PҹPCYQ1MpLK3:Zw,Ovѳj uXvqK11;[ӣ1Le줇S{Utw"QsksgkC O|tt(h5רwy|C;TvNa(D5jle@Qy?"g]FxyXyDw\փ;ˣF| W䙱c k5̌b9$eS -yg 1oz/Y+RͽQB.{\/Uo.Y&%T@'Z%K2GZ@47ӇX7ӍBᚇbR.D0,'/%7n @C_Y!=1Z=E3ó5݁* b=ŧp\-3^%&y5ǩ(eaYAD,**Zɗn|kT+ [u1&i# ~}|t<\(8(lavQ>/|/b<"b ]2xvO`.ZM_e=nOkKFe" 4ZP„ :DxD@LF~.ȐP$@"lقC2k@%@"LReϡhr%ХL:} 5TJM+E j[m__U*Z.lӺWf\]|;ԒLReJK,#XdbzQGOd|=ɸY$Hŋٮrߺ:ذk]{[{Kpă^ FPw':^2,4<3i5{MHe"+DrONXM,g+=VL%gJa#xՌYf" y%HwvKIb!bDFtC'*L8WD7ĦCCtI{YGgh8TOH U):BN<{ ^`ӊmZ'Eg,$%$F;_DF[͓BdYFϯ_澯΅|mkۺ?hd$Kp0g d s 7Wvׁ'F.i b0d0CN!?,kHUL *g&CUlFCUhO',CXR֯IxC=ZdQXyaJjzDPi`ThO,64#xdŊ&#L7;QotQWH(E 3T)Ms#EkSIȠQɤTɏ}RJJ;"K1+KTʒw*K W7׼̻jWD$>\ zR_ 4DY) ^UK3+M9tHȪIda5J2rtS]Íj#aFLSk v7(JR~E"k,8ӬE{yкfɂZ 풜u\.)IfLzCRoKr[O=]:^ (`I:PeN.Sϙ=>uFO2(HFVhTYlX>ixA*Ŕot4k n[ƭf|āB#Z$PsB]J,*KT Ѭf1mGA׏@?Js0П`]rvFv!(H78 zPS>kF)]*Vl2l.jnKv2NO~+4l#qL$wfB ?^Df.Gky~jeq6/]^ Ykw-,D/{ϱ@_{JɊnًl0Jcw2QlZB\ѫ2~,N2cM؊֭Gpxː~pt! G\nu4676Sh7W  KK+*^S"EY*ŸY FiR]99e';S-2k,)}5ʤ}z?]eq[\YMCC+raM871Db^΄t75zCj9͝Wd&VZ02f \%J6Ț#HT+&n*~"f#u9/".Ƚ~Rv oFC Z ~n^QYrk~1q:=}e`)8nH~yb6Еc ~O=DU|WEqiH9U:*?P海4jE3d,;'K2!!<2&AL j r{i`uKE\&L^A!1.SG!NFg<|v8Ivkiihv\N33C^aљ#1p[ԑbPP7;)bʴ#i JRϳq!AO_V? JDDj$ǪaH VV JɫM6&p8|y'WS9}G^{}#P0ssЕ,7z]6)KLԮ8jfq;J6fL!%83+M U;ȓ,+R>O.pQ_H Oi;l~@H!pLdFȲwj1dA۱`k&LѴ$I9z'&ՁF,ܪvaU})!:OjafGC68xd vpISQf|jp{A& OOZ<{>#(BlQ?d;E4[QECLѢSX87ťr|Wf+z0-ؒya@1%Hl\?g ~-_aF|K{-m/mh }*a7}XhvLܡԫ2x龯_ʭ CyU_*Ei4C,d|7H F64=\,3fQ:A?;-kD-^]J߯A ͿQeos*ęC!Q~q$Gml,(id42S xt"n7l"h)()B(TFqA= 4ۚsi- } UYG4-YeZy~GJ\.ch|-+I1sѢtn"Q>z2d LzoFFIOJ}LdJ=}cؿZ̝6F).1ew f(=uEIBh]˚lBe}Nf Ӿب5i =;ÁUg﹋Ybg p &bz݃Lj™&5L4$u&!Ӥ YUQ,QQة)Bdp p!oQd} zCְީ&b%.$gA D%.~^r$qՐyC]8!;ٍFf ;If2J* ݮ~;-GbOH}'Ma1.ezvLr\w03s #hxO\F(4X5:8,VME}Yy]RޓQ/? gIU^U@8^ f%Jwxu^蟗>zm?")I"ˇS!>3_1{8nB 3A4fW g9LF3 f2RٯII_!&i^^%`HuB4)Ms6:将0I+N9txD5*"5LmJ,Q4gEm1M$w1I]F4L"R$Ԫbqsźe>Y &@$a:4fN9hd}IMBfwu%-HD\SIzeG:(㧫l\ԗH/M  Vha+p2 Ʉw2+5 #iHHeRqeA#A! TU >aOzKoN+ SR0X.$d!k39[O J;-(,(A!W!(C{[_qxV1]cM4nI)"kY)nU'67RV?U]V9HJr$e:ddH)HUV("i< 9crIOzweVUbTs^]9R|ĥFNU0c%^bz%V#\)ǛqʱhkA'XREG"+GfS+Rov:`9嶟]T &ݡQ#^THrY\.*; {)BE)z>U]v|1jR,[5mYX^Q 3U2I%97U=n]ҬepSȺC54[S(ڎ('Fخ'njKAPw L!X.%yz q8& U+ȩjwٰ^%}b r‰ճK+ƈsZY>_+Ϟuc\c@݌ÄN]Bo;MzT*!sTʊ^l]p&լۖ^%MxdʹdgqTij-8Rqmx5ʂEݷZZ)[z붘Q_Hަ_W/-vluDӦX0 nv嶶7F\ȺT9:1i1AmCƐ(!wRkjIhq@ubE:k+W`)3;]oeheM8\9~"6=|מ}n[qU5)˨:Q](N0Ie:䜗㞣J.UץR8ASKpfN=TVD"i /v*k8R%*K~mGUs⬑vf~Е~|¨_P6Kٱ L';yl|3R2A̧{rVH@]fPur-QsXGt񂶹Fcܪ(5k`:%미HJ$\:+*ٴc+L:&0L z*-fúkdc; ; v<6V1(1@] 47<! E+ [j {K"1;3.q~+ QS"c+s *A,~&<͓38#뢄099.ء7l(*.y9Q˾CySY؊#R;20SL#۝S`Y=c0Y[@$A\6RE>'aܾYڰ20);7tkDY›1h!"4/TWz2n!D"::|2)b.Ѹ=+1}"<679j>[>93Tғc44dCÖ!|53x>C0;H>@dXli?>Y.T[2P;ndJ\$O4<2N%s \?Ih+@T9ϸŵ]V-1TKBǜj&DP+XоmhސK#[ҟ,p).d92[0 =%ȃ LA|26ȉt!;F3Ca LI4{R䚪UA$*Ɛҕl) 20)MR;HsD.Ǚ\Λ%S:a(X@\fSY\,NzO^4,tK>6O [=㫽K gJ{ԟT -վLl )5c CZMzQ$' ̚cC:Ib9לC<ӨTK-$͇娎-5NZ#26x e6-Gî(vN}=l1rR1Ϗ1@@6OH]Xu&ۢ-j}kH˹U9?>c36B^38RLD/M(FJW2È/a9[}} ̌;6?cTDBeOLX [TX\5\͵A8P@ YSKUBPBi"؏+8\E] Z_ECA!bb]ؼHl֫W,R!MԾ/aҰ1)F49r@jW5T 26%0O O'?[XlSDJ OG++\KKZ`Xk5-aY jTP&|UIER$.0MȜ M&-!ȤH#cUU<}b*d^+Z'^@Db3@4}@Kҽʺ^3D;*% +,$IJ=@LzLTM@Ph2\FFdriԍPVuL6+L@@q C\a M5C2I+`s9ueQo9h==kVT9l`D.j|SeZ[SNmy5?5`dtf_\D hYVe dXZX&UW= F'qo 56;TL\Nt\sFANg\l0kd` ֞(͘XX* )=xeZa-ib#ޭ(fp`_?Ń]n]nXvxX赮T{T<26"[e;hz= 9c ^nN#Qhti"e=!&vl@K< 81m(цpb>e~Rm+wcV'6/+smNk\?D0Fq8/nfn4$wdof<gY $6ȉoF,oHDцb ii։M7;eZ|p1gJ~վi+b 9g+Dm,E!fq̷=tݻOӴC?wlt]31e_upljNMls'!79hֈ)u&s$n,oVݮ ixoLֈ! \ sl?yxg0\}w0_&tKovE}Q"v;h#Q2bremS*駢^o(BX9? /W\K"/ 6vIKN x7.FosqWZ(spTWτv(rNrxȺiZV{6¾e+.ⷧrO1Vh?A3(E|V?wzI׶3y΍n3dysoy/w|GISͷK PGZ9 )!  <ŊD" -F2/lHɖSn)sLK3St2'+3y##Q9_d4ӆMyT%Ҋ<Ӽ|(ծSidsXe-Z1ۆE['4Vlfܾ:+80 #><ƌ;F‘cʂ̵(͞z,sr3ѮMn-ۨ]iJmU'ڛ޳O.|y#=:q+=|qx,O%~~ǥFſq*_ h'MRLl1]]]r^lVUVe&Nb&vdiVkcf08xRğgd#q8F Ph7&hX!Y*GpWqCe ]f~)\J]`#^~5{ {x"TK$jPB'dYMI}ӈ `YW'qV)TfՃ_e"[ƄZΚk5"RG_' [R*y}-eOdZh[ޒٸtRۚ\%grG\5$nR7 /ؒQ-ĔbIfdz_~mϋ2<`R:q]ՓM [e뎻3{[OҜL6S⋘{cY,J97wLgz]ϯ]tµ]d[Z9&vGoU6oFVtGpP 'I衇碓 I{DSh:Bz)wrHLҤ췛L%qVZk ¥;MD/AbF}ц(=[s}YNbߋmj>.?/h6u?\K_c_ӷSA,pBHM Eā`#PGJy|H=3ݍ2)y4( UaY4RՐsP .!0db5^Q&BH]"?8ͧb3Yޯ=q]@C+v-Ґ'FuyD[ɛᵊr5Pޙ(l(cⱒIS(EN$'Q[JxG90z`*[i˭Z奲+ZWxcUjthLr!HEB3Tlr}JՁ?IU 5vTe ÛE% 5QzRǻZ R;K/^GW;40=0r=`NSpvъuP,\别 JoLHSϤ-qrf( 3 ? fF7#Um& %ˢTYT+XھQˊ2VJ 5FK~W;u~kk vI`7lgzod~䡂n"˿le$E[t2IQ-l@S%4dxH->%슅U2&y Q%:34qG^6$ezRs6Kٳ7%xr-j߸ ^rO~-r/;SĜ.lHlXRȁ~#}-<(> 6})ekd^47Dap JjV-O¼|H1KkGK؆Uf z4PȐ4DYF\G5m9Tnr 1LV3 UFPvTɬȇߏǦ9p!$9#H9"Ru\QC e7NjH3<ĸ iKV8k]U>LGTj:Tj3~MG*|0+ZcĬ֮Z[˩l࿏Y J {[k#34ꢓI=hAO 4.d2ge߼WZIO8eY\@<*)y9ż$׏ގ^b8F.{1Ff7u`iuSXqӑE_QaRaZY _ӁJL1V9sA=!.PDNHXYZ(quZuELMW\q`MTm^n&C>`Mm =dTApҵI9]T} `󥛝;ݒJh`FtL'ɤUFP"Qh"U*RH<'<ύ$"Q>%>%}WhԆh$Bf➝"?hT砉'=çȋnGUo!̫qƑ !eD喊)M:bdCbd")aI@$irSquKV¥9< I8ʻ`tڠLFjyeYvRg\ij ~'tfb)#H XVN1ҧhl% ܝaL~Zg*4pK*kt ٱ&bĝvzYYP Ykc[(&r]>.kMA!AfFI<A jrLn tTCt֝\6 H^fl܂4\R UBij#Q; B6%l{b;ihMXXĢr'FZ 늶AB-gv^&uj&g c)R˅mg$ʄ(leIzR(mA-l6P*kal)i֘xER 2^ *hVҞ4{=\Y% ݼ.'ƫk2. FhrIy%R\nPVK݌D($fn;.n2(륎WΘ&nla:o"dFYjO~kρk҆z$R^.}uVmjWk{= XZnhVBHĭB6IZQE­.KV2+O .-PF\p/.$GZ˸h2|=r W{{d֞8Ɣ lo=,mS})(w*\ǂ %bEfҮVj'2r*.t\-+nC IQߧ'q'E &Z l%ĜpޚpJ歪* Is.Z2hPڨpLi#֨Q1:0vU]0䒨0O,ܝ,)WƸ>A;0-n:t$ r*cFoZeGf-4tg!~3w 36C4p2=oAvjorV5k=W}=c=;kָn; @xA 6H0#Ba40d #-,IrdJYZtŋ3i|!F8HrG #Y4BFjjсF9yVYnWaɎ5[Yj6mܯҕxg^{+Gvǎ[ݿ~/vr#ūrmfF9s章y6B4T;Ń'kѮ6Z{Uawc-ɒGy>u#+t.s4=R_@M.eSy)$"?篕'B?K  A¸ $T@ tAҰу1- 94Q $ůdC*٤Z-Pq*}ЦGрI:ʨ~*{.)zr$;:5YKD;ړğ\MsO@R;3';‰+zT8[A5EӲ" TYeՎ9.c|WUmb=V9E1I!2ȚcXˠz2*خ<)p NYEZPܳ]=3@4KMZDr;#en!K#Aӗ<ЊQ%C -.UWƵ%2OFaAÍpRVWo=4eil-:;Sx1q}[^4K1Vꍏn^޽UNst/:n!ܬ 7=}WNYJr؇Tf9ˁs?R%2;N#FEt 5Yw5)GK+<@0i D!`r&~1'2WwI# жelQL۪=8G\2Ky"ԖV"R1B/҈H@1qy _YHuC_">V!$I$v$7Yf-Y0d @UB]I4YM5poi6+y#C19:xNaC $+rܔ: Hև0$Rɂ;+al42>| q ]2pR6ġBÛ^E6)N8QRB'm1LQCm8K黮=4)#%FX5@GϚ K&6n".9@[Y1';99ή'<ƕyiי$%KTus`dDXGTb/%J9p$1Y`ԋ-i:efL@ڨU,Rflg ESUsn)ι ؙ̧O{..tH^v]~x[^Uz^|[_~_ \` V`?)\a _9a!I\b)V{-Nvgc5w cq< 2z#yQM2ld";q,f3XY1Ӽf1B.20\.:9ʁng̀syyN|DW5e=ZrlՍ4hA+ZՔ~2 Fӄ>3g7/Y͏2!9ҵ3gMjL;ֽ.Lg[S)~6=ihO,iq>5ie?FnjdmlA .{{vVc;wwMqe[{wEsG^i=9Ҭr\*.Obf|?o$Ή~p#Po \rֹ`^viWvi!!,@$GT$GT$GT$GT$GT(AJ+=F43A>*IE%QG$TH$TH$TR$T_$Tg$Tb%T\+SM>OEDKCCHCCGCCHFFQGGTHGTHGTHHTJITgHTkHUkHUkHUjIU_VWMiWIkUHkUHkUHkUHkUHkUHkUHkUHnwHrHnHlHlHlGlHkGkAW9H2H:HAHGGHGGGGGGG$$U$$U$$U$$U#$U#$U $U#U#U#U"TTTTQC -    !" #####$#$#$#$#)#3#D#G#G$G$G%G%G2<=2J'K*J@HGHGHGHGHGNHTHMHHML^ Vkkn1mDjLfK`NWTMTWTohTlkTlkTlkTllUllUmm[mXlUlUlUlTlOmCr:z7@MT]wurymk|al`ldllllltllmʪ֪תשששששש׫ԱηøʐH*T(d?iPn,BGɒBvؐ' rCCZ@r'62-R~֌'Έ:=zӓիWWauRï,z-)R#SmK9r븽eGǩS ~Hǒ{+ƩqmXa ?# ѕإytfY1B Mj(bbV qK]QN*c2ZE Z"Xm&ыgR%b{QV!gJR}n攐fŧ6&,qƹkvY"v&N g sl? h108M~2 ۿIWͷT%mJ GgtP3UQI4W2 lVU,ExGWKUQI^MV)d5- ԞGO]8ņizonWҮ7K @ Vҩ>T8rx4Үh8D$tp(JQ Bnz#c@ YBB jUβb )J2`@ $k)X2rmRfėHY9#4Y`cRIQ4 ?4=Ee z !-vwD8<@t0p``sEVц6(0eJ6M(i\B8# yZWwJPzr-Ȅ'lrͤW$+ ̫b,l){S:B,yY-:G=fh9Wu%zgj3.z p%'0~.O\sڐ c^ -%$V1 0BEQ~yn!Sa*BCX 2$!0U rוF/VB T 9niNh~eNoթ:wWp؀NAqALskb@hLB(*d'#@B 3F WA"鶬(*0u)peEBdұR/\#|o2 a#+HYdA {FIeKOiY9 @Ӵ`<9N@PEb)2ԓUy$~1hN:$+%̊d7Yh]96픤鱼/Au3G:@W`U%K| -vz/8uw]]F%z\p Ӿiu؛_즸]`?Ԋ}:v3!rkdO#'%Uf~0:ab'j!`PRGU!ŗFeGфPU<4>2XC~ˌfy3R"u]n(c1MoWf5p|6]qCt7Ɣ_De`? 0 - ?dju&tAShA fRVhEccrra=tt0d{wbX%HgC WZf|QX6YTvGH yrkŵ_=Ez;[%2L5SiQ]K!eF @ R6 p p  pu ` [DVDcif~AT:SJ@1 #9$(fo*"q1&g `Q!j` Vr~O4 End8es,`UpYSi)a27-&VScahw"$'U6,֢rG @ , p x x {x`|(J ` s*bn tD6nqh9lq{GC4nrQrv%&d.Gta0HQǑh7h锃>Q_A gw^{V 8 :*v2i(-9Q+!mDvN&Yw,a,1Ҡ }(a t((Jp7H4(!1'gD\#t0a;)By)zOz_R( AАq0v  ymИPX8sso 0Q[8?&4oXo=BVie%O<z8lȆ(/=gFnGx!7BHqK6i6 ֎x I5'@q ffvHWYqu9!rHcv9`Iq` Yqp j ˑze(t7qQ9u1Kb>=D ly"!.'2`wY)jpL*t?A$Ö<$YD2ȎsH puȆ ?h65H@GxyNf\\EIUu jP%2f4;B %#J왊xHq 9H]qB*E$H0p $Lg;f!x3tg9H3rb @"pSwi5*&LjQ QJB@&bvfsJt6muBsoAz8HH'Eq'p `j` *q_!:?tAY "g1vR({x3:q J<:GF_uwh~)zzb@r0I1) 9@⑗d2H\y/ Rڎ`َW @j#Ks1wU.wuKs'~U{јUU jРxz ٠5E;,M"&*&[g:nao,C -ڢp;\GqP381QXɁ^$i.d#5I71yd5[s (Q ! ] P (6 &Arg{d! 1YxR,q'  U qP ELA ds:F1.#1F1FZq˔KkѰ=J 1j آjh `˜ib(/ T 0, {cAiUl'N!Jq8 1)JˎᑀJFx-@4 a `ܼ ho#S#"6bcZ [JO @Rmu+>(p@AJwZn;'X-EC +ݍՍ OFEe $DfCа̐ C1Bʜ7pcca,Y"EP툹!L2)a֤ɪԫK -rʰq2,ZH 7dh̿@$1.*" 4F DBRu'ڶz #ʿi?Au3 5u> \ {b_ҮϞ}@pI .Xo~^xpZZ 8 <עC\q規h[P.eò3*4:;AbkA-JI,`d̎Cb,-vu7O|^ڭ"%O>ûI;)‹TSa  e@ [=0䕸V>tz* D^5V - 2\ y򨌛2` A!*]VHU7x!N;w3-;<5'Di=$ I&"/~%u0̦0[,Y)ve˖)SSK7ZpwĞ7axJ;1 x&p ͚3?x 5XCU3˗c]yL,YΝ'^ 6,`@ړ* [ӣ33h 4\% ߁}*B r$@T0OG VчGR Rp! h!!tA{L:RE6 26h !D`j"b*Š(ͬ뗫,,)( ! "hCvɊ< R)R.̳"PCm60A84Q@`dPͨ̽4 ^TE3332S!p7!)qhY04cUFE{ =_)W^|O=`}1e *G jS6OMZQfLJl $ 7>Ux/(|(:ZRx~iz*,XJkҢeNzs@.ɱKٮ\Hq71N#4VPr:bLT#/S󲜼kpiab:>"mp/nx;= 8 < 2* pK.2u63ˣVD fI^"9;yqN5wə:2x.񌈖"1UB`Ub4Ԁ6L)ID*V#Ӧ3r9tVKm`?!_t䐞t`:q $QF/(qD`'5I Lg:̙NOT߱Ix T%QLgJbW^IG͎4gzG򴋁*ed3zQ#(• ŗ\DD# LQ\:jV#(*9[_95VG/Y`A{a%/YLĎ$.!GHÕHeWQ")#-̜'>r_oH fL:V,f'u%X5IL"2LkemEõ %^%_WKV͔L;N*@Q: XNMM. Iu"UU0_[^"ф't@@LUsD5b;n!|uN—fHp R$'~6>Q'䣁ҎzK_aLN4DGCS0-Q'LEF2#\)YHcU"3E6aw;7~MJmUI%@Fj8sbUY$VY@X8q7N_5E>!L%*tͅ>;K3O\Mb5 R0C2Y.QM.C`&+ZYRFVNxtdQnCϫF|mަ**7[lby>d~zNtKg$_Ag؆[ô~b027:Fzͣ!NRjfꁄ!8D; h5HE Zh2i0eR"FLYȮ٣Sڥ)'N1es7}[ —6/;.T>?^[=%dJ^ϑƉ¦F$mtD)uCvWy,{Hq&jN]GIV.~ !"r u#P'G7V++b$NZI&;|Ib Z1)x9[y+Dm7$p9FGo0,m^>yHK,YH0~[:qTI#(s{K(zÀ5Ry: {:T 3p 2ðU=ҩKR;OQ8@ hhⰲa @69QA)Y$k]ÉTȃD81Ɣ!@ h:pO6l l86 Q<D(3<W&t;S9@>#~b(>w8ӒI6y5|9@Z0KZj3yrrA1p7dSA0y:?) PtJQM/@33J,* 8xhM.iT!1DslpȆsql~aC"@1+E{&K>DZPiH$"r؁y;gk(#)0ʳP{)̺P=x,'t>8磋ڱK*'<DY>' Nd"5ٯ=QySh ؇lhlClla79}4A2 4Iۋ(#I\HeL圖8P#q &A.aҨ; OJ1B2<q&)os:4q0SAzXlI1[t"g(kB8c@RT4[ bO?X:2aC~8l`ǴdC O_.<('bMI;0K t#D᪈-iFu (*C"ŠlDS3 8)w ! .'K)X/Kz XT3Ļۀ,Q u#D8>G بoU0686*8: i}6t'P4 7:`ךy8y`Im? P d* };<2!Nٌ|:M Q1)xK! `&qrǒӡ82}Q7H;ɳM!Q 7 cjBuZ,}[!x u^O-4yBSZ$l+I'ʳfj9A G$O N#]X Cɩy;WqnpetބT7V£;̽9̟΃! )b]ТXD޽˚"_ ;ޘNOQ;&0p˩:G8b"8Gj!ɿ&Mj]6$ ϛpePSrU40m1u:8ߍp"R/فDTJk ;jٓUSCRP I}溜^9#)|˷& E i|@tq[&ంOPwi*:c|=686j!X~@c>d?&3[lMDkE\z֫.B` w3ZǨ^:+ |g-_hl*s6<ǀ9}O6S͞}G_U5SE`'sa H[OlRڝ4&kz, k0-Ǣz^¥Po} `{ړj2a! >ȉXv1s yJ 7PQؕ(sr"h1`ؒɩ3V[@~Sc8_8X<~EFdW~CWhvlv )ɠ :>(5nq'ـ>q^ԖVimQg[%w`Tf?{&!-kUYAY&jVFe^Ŕ`yiL쑆kÓ"wx6~)[A^:ܟ? J3H$(M83H顗7%KA ^t*׷%tTcE-[00hSjb $fu{ZJTD?B|l GsPFQrņ0u&ߢ4W' 4N̢dϦS<8ex}WT}N⼍՗ L 砆yԸ?ωOС{%a"?z $ZY 7%wWRjth" )`('͞2)؀.RB9[99ځ;.$4Sv7 a2 x.ޚhXS{7TRiU:R~e #)XPV2T$HzJ]n@ )j8VUArEL9gO/NK2p|+wgU!ljmFYAn&pLv܈)KQ bc`C YљVtGIQ6e"+fv3/ 6S/k 63`"iHF(:aT GU%h;bw',*~! 6БOL lVщXFd'`+tA~7 D[X ryMF)ᢐ T \ u`/P12!,m=3 )D(څcg{hRJ4%9R)ЬTRIIv+$vXfdmQ`Mf%$HG5A ϩ>%ĿpL.<\TGBB0)tLM7)O0Xh[S&Q)Z(y9wE;wҎ9u_5ϡSxLV8 "@`wɬ4[貖/m- /f #rv3"2s "x 2R&;EMUQ;UO0)FG8ǷPfYW3;!qf!I_8ØyM*ٿRD-}I>6IJ1D)7L.  );d|֨l*d fg!dd gV*v9TeFT6!} 坚`Pi0lK_/Bc>#uLcmVd _np#}} <7g)F:QU Y EMsLH˔eX{h}4Fy"/._`n*RGk&gIʳ\^=`Fي%FI0PLO4.ꎵ^%guؤ*Y ڔ-X,ZC> gt3h8IVHHȥTx%@L<DF[UnJh ".} -PbrOHNnhl}Š_nDvh\h=MGdJHL`>` 6yiOnVpIFʁS 31\+) ]a|cul K|QPxĐUlN"+fN֋QMSYj0J]^0nK\Yj܊Wl*lc@jp`@DשA셰-F}pfD0MZr}Zmwr (2n-Pz)?䧞vgBv4YQH ,¢(ªohA&.>HCyuOP~,7o(S|I||BiN],E<p>rCyJ@ۃy0Cw-yaC7% Q gF ٝS:Sf%$Ad]v@\blliH/ךNWs&Vlt}hIjSp!V]w zx<{RCĉB9eO "P& /fVϯusqЬEĸwꐿ1}Qn4ĩ̂d{]9FQQab2r`WY̋xt솄9^7cu2+;6A,Gqz0gޘf|v=$w(9pFZS>֥Ӕ v{ڎ@7P/B0 vs6f6(tf TW 0WV(7q#SEZb ɨשcL%dj4FCoę,{i$k?&o_(9c`+"\l94|~QR4b Ο٪iHE}|Gjty1>|#y(+ӷve-ƽQWb)NPi,@JOd27Ԝ~=\PT:7t@H[of7Ec@HA B6 B`E Rh` Z%Zdᠧ )NfѢhc(qԙN?{PDO"åѤ7}&\.Va¥L4eܾ~B7vNAuih"@IBV0` kܠ(DGaeH1+|YLiy ]tಧ ^hUͷqֽ;|$tGn o7x;S)`}XaDG/?~q7O_yo)4H\D4n !t:B/˯ Eͦː#Z~O}pB{ՠ9 e٧c{Ka*#s !P0&(Qn;W]h -<#[/k͸7H&/ڀ)Z =-ֈ\X' .H9Q',{p!8Pz-\Rbڏ@hsBGU_UAfMՂ~穟SًN1fKn~}#z?&c EuQ֘E/6Hb,VEbx6D|/:O0B1! h+0 >HNK& 0[j+W*u jsɼ5{mq4=5QhLA`w]HߖP[J|'Ff j@JS Qx3ZFGڻEō,\M!f!J&B^B\D$'qzԶu*\dD?J>$e˷yI;^izVY;d4>!f7 v0LF!?b[Bq„dml6Y͘0yX^D(f@JU^ uii t Dn+|ǕEx/ #o/S&$$JubaL1ofqbY*"b}{|j8i'Bq_Z(x]@_zW![*NB ƽN -_ix75+uc$]UsAIc : $"Bʨm ls&}{o%S䡮BٮG;}chh-{X7׭`}ɺ4f49ARijf0\P !>Uf%F&@oiDnjʹԥhb_G mVΣao_KI‘ q"Sv<-L D-ӖR/U1]-֒\RpdJ(3 r޴MհTPB 7`V&e U.bJ(G#Yk61Q uR[RUOe"ԏ88ci$rҶ윇CPzL2&h@̝hn$O7ZH^RxC=sUpARnp433A05Dr+ŋB+BNi>bZHLMBppi Ath0(2`ET(9`ao#vF^})% rl>h4TƹTJeo84"lBfeR$}f%xdakkH$:'L-1K! j=VsJlB>L\MU`VFҶM0T\"]$,b\$_еU̶u8J`k+1V1e66niRV7qw68SASE5%J̕8ʢ5"kc(0e`*mIJ"G}WcWC9UYDhtb(uZe7:dzpH\U\.( .P} w DrLs DrDDV{"bY wffFE`LBcwBjD&x-jR$0R%@6K-&;1~TS{Zia+/k2׋HEkD,m¨@jl^";#hVZUhi+u6Qֈ-lSo1e8zH.5eϨ"MLM8w=na=}Θf3nt%pFς#Ì7F@%BC0LaO[Y#[ 1aN>GXJ@}w.ydc7+@SgsEUM!| V|7 6(a(`_u P Ƭ}3Uu\,/:y ¯j,Cm BmxS{ͻuf;Hhe{;U308'(*x6tyK(vu2`zNjqat[B+b)L[˻[{uSa4gO1k8K zTrV⍇Z} 1|Χ3• C4VgkZ#5w i4lm@ohNPM ډsY1 e)<});Pgh\ B=h_@kD'Ip[ܧe2cn6U,Unz6yo2#}:mO+݋())[ԡ鉸DZ3S0͏^~"s|(7&;;; 63IW8w+&կv}MY0Nth*7$'fE$E^A?UyU]Dv((Sk`5n@9q .gR4gu.WpXٴW'ab4s@a>( .vcnHc>p.c^̊ʹLTJ~B8iJ.M\ʔt;%.;GCq4ˉDW/0"p;[H0.)xy$1'Q#E!Rf*\%?EC ՅYbeq:lo alb.-)~kIN OԚECw\7mm w//-Q>a{2x2͡=9bفY$H .s$,Zmb:T3aA 73Nڔ7z{d=L9J(҄4NT!1TD>zZ( H5t[;8nl#"wm.3}MB ]FABHݞՋar9.^/ gUT+%9<撗$EQPՔ1vUJy˭VѝheK[ig8|UY+7QMrGt)O_i؞1<>*\gslGl@4T펂Q(K+RK^ %#ZR<3Zv7 et+D@)HN !DfS/@j jfYɞmxVt-D-+SSӘ}.-j4/`F;Q(CQ#g0*hQp TЖ4܎)aPZ:e+gRvFr0\6SZTץL'njd=kRɡM7iP&J @ZvA\d}8MAF{Je: &_hw w(t2pjjUp{|W|j3?n-g~4Fw)yVКh+ 7 YWat {ّ̃=3̤g'r60as2&t2ti~fҀtW;yBuH~6Z;Ƀk",UQvQ0ʳ,(79NpN=x]&1Awpk,M(qiWLkFTi"x"0`Lq8A Q,e @Bfmv1w-Q-nGe1 4vqb{|9oo/5@bek4'D-g vh #G}(fkpb5"3P޳ 7(b3snUrG|~7(B -'J43Xv// 7Tb'7W )z;SN+"ZSׁ7<Z%1BjU1AExC0^^7 e}$(6<w2[![@Ḿl!f.=igxƱxI3~80=ӥy%KJqm p &c2)&Aw;CnGA|64CaH6g830xbn)pX|ndq9H!p%c>"a:<|F/~~~F#w#2zdP$&'%qf7B6Z 0 @ @? ":(!2*UKF8J`p.z:+A|opertiDs4@dE%b ח7~X[2*f(C@>Q"qm8qm%ؘfe;UQ;bY娡9*uX%OQ6i2qw,IRah޹kzxkS[10ɴ Q]o8`s-H!)8Q \ᠷB Gꔾ aCH("sce$6pa>H|` dd '}#[%Tq&tuyZSGJa'IH' Y:Q8(2奟Rɰ)J'* g+ISK5CMRJ}ש*.p,1[(6|}a_7 XHhzOOEDjIj,zѦMčh'APuh(;n{2O>SCF:^5?׌u5FǢr71K4BF*8t9=:pB骋OoVG5P Eh oB`2'a@Lؙ  <bhuɤ?'qu:MVJj"J1Qiz<3S[jsFu\*g'DqBbY: * R2cEʼn4Vqurku#q#o/֖P^ p~!LG; sD6r k(#cQ>$CJHMԥfGQcYҰh3NGu~ruU*!<Â.zO/F=ς}Ivt Ծ /0癴q Ч̹o4=@ xN" RCEad[\GI03 R˹ :F-VecGFc4K;b;&Qs%U⢔q$͓KÔ2,{.bT5L&$%x2Ss>KI,F Ї1;MweMcfBY>1Vfϻ(T\JIqJrgUJX| }vCIy h%F A t'C۩ 6x&iJUѫ1ARPk`/9ޑɑ)B򷪽Pǫ'?lQx>*>-t8KZ-]MBRdss3$QzB7c쐰QQllu&'y-%d#q༮a2Σ'e#lixb14S9d`;er ;fмb U58Tx6v@dyu,b$K%&"[x.f U=)"sZ]A6z}Q\_ ݫ^ 4D7*V{" 7+g ,'$a1i$wn5Z=ء)>nF$)aH6!M"Aگ Y\dZlZW  3 xQs}ܽ]dzVyO^Ƃ.Xti-N!r1KuՋFݾ\ղZN`,M p'5/uJ[d&"1.7>lGJ7\1@~W68<7ގ9aYb}cKƓ<[+g҄+mNkk]AߦP]w3 D-K,5x>=ҲU%M h^R:n&+բ>-orClXuݢ3@##vmH4hq`=zyV.~]ʎݮϖW27DlGS34S x9^ng l 8A?}b1T_H.Ĥ&̹c B֙-oyϡA]iөQV]z Ζ]aw5W<:M9v)F:7bOMVJΗ+Oht\yiD9co=J(,9d%`RpN;OON0 hOnn6l c1GqNr! hɆjܠ8$-2,#K.%-"`\̨r(,10<b2^@*J%gMjгԄJj^Kʌ)ѬRtSC9-TMMեNÈeDG3uwÅW82qfı q|r[fɡ&h.z+&WɦhPRʉ):y7K <Ĥ2LPFm NEURL*TfK R3brQ_?KUVVLWҋ51_=C}xirXGvhԢvw޸wg~QlrEvF4>ѓ__T 1+/*k9~&iapGy#~pA786.|OQKg*%pz c \шgڑ&$)IH*5EKRڕ|7j)ڗ6ymN+ٚNҦh*m\/hQ#rwO(O'z80qM@͉MܛfEC^v>/s :׌fLR.˱X|G\>62++6GMxd\ U'=ֵftgWSm e2xz:b;G& c(Ll ϳUwˠl΢;d+Sx),Cٔ[|3}OF`-/g~a.z@]Sy:|ItH:!將eݷ6jӣ\wۼޕ45x;;n} q7:>kn.!o+R$2Fȃ'B :C2> 'J&7z+>ms2̠= e#cB&biٶq@;f;*J33]<^sD0liA^P -N(35$1g+2sk r 7!i,68q9R:4*kK $>\:+Y0lR?D21ŐV?h=+^>8f*7{?7D 2j(tL2D& y{zAA1H2C?>A?4@d8[៟?sI@$4?DDK0̥rNv OuLX8b\#K#dϵ4Q|sS'kFļk2!D5-AF ¸F*IS v- AG&>;=.LB(^ ~LGٓ>fñt4w K<0-8 IBLKJI&MIhĭ[K$Θ\De习_D䠥I,ܤŠl¬,6-O !d⑤L<*?ɈJT/KE]1[\3Y,RB$\=)2rz3\Ó#@(@>ʹ7İ'dU᪸sLf:<}GM!":ZV? ܌qGl2 jή⤙ V6}NsY7qNv%3+6eӑZ2d+rSlVd4Kfp t =N+Y0:/ og]M$^ߺ&eqE*;#^f̦ 3gl#섈g.ӆrO,&+)[mmj$9m3'ԾmATqnYPL ̰m gɀX`I5 gn.کye >u~sn/t0jVqi3'qn dݚKLj"'_ '/!g_p!)2_/v7v1 qN' H]3yFrgs9CksqjosSD::fhuzc.=ٲKMuzp|\YioG}~k^-jZX75؂EBU)`7v?v.rstmsCaogd&-UiAO8;QwQ5^xјt%>0yt{zuIFqFlveej֪oh~ޱxmXGu&3lY6 а~*7*/֍*'ğfyJntw.ѴEk9OƗذA D(0 $@ ňb4q? G!?Rcʖ(_rLI-R+UNLxQF*:(S!I"]zK3JJ^~ K(Պf-ZPgNeS O;Ru޲q+@Nx+#6n61eȖΌyΑ-{ ! 8=6鳒[$8!o];)޺+;W\yyڟΟCnRc0] X36'.ӣO~={;OSb[hצ#ƟC  y1 YrMv! -Bfa` E XC!l]آia/#;"أ1)d=%SFSREGnVaW啿 \mEdTO&Bl ѩZ#iډ0ĉju)rI@z妢W'KzbSm*)B'FRXcJ_W!_ͥ`yrYH`_'ֵZngþvr2ˬ5~vZif틬e8$(AmF\~[pu)D+擨63쮆:ڜs4`tBAC70N\{w֐G)Y  ZA~(zUQ4qU3\";9?5m6xs$cG!6&4R+m;R}&^6xzUIvA)8$/Yå[7Ye7}shq? jνQyuWI\(tK<GjC u:E7.ㆷP<\Uj)$+ ׷̼ӌ͂Q& m`MY׎o8 \woHc2;Xi= ضܾ \ęI`MhicS}5NјC} M44mscOȠ&G3zϚtR#Hٍ,̴-0&GqF&N\RYъ(Lj1`&uBVsm;%jҰGю+.!0B #=ѺAhev֥LViMXK`amS~oWɽ+Ť$qTآX!Dypeݭ4 cؿ V%Ez=&˱ӨB#2Y˶C91ee m!0Ej 7e#<< VQh2" ΦF_|SJI9/Y"$5vI% ;G[RŅtCBjE wRaxٙH9l_$-hgNZjLz2ͭ)ÍW,zŒsN4½\*Oa-/T3e[WeW&CBxH4kq }q{[-ɾ"m*.̶񑯓lny­P0BHohP'_Nle3Vz>{u 5(=C$h/b</H۵KןZ%^aV@>znKC#|6д0ñk ?h>WPKPGrXJV }ٜYٓM[m fI]ې pu혆y]]ݙoUK͕mϗ@+ňR9@̝`Qc-`9y H|^ -%Z!D]R 8poY |\/P0I2۹=Ab ]V*]QGyH=I,hq]H=̾F\)V0$: ]%~]4R#qX^-Ĕ!up`.IKy@`MơPE5"a^.P#f:ա #1cQFԱ Z^  6] KQ꣭]Е+[ڙC,SED "NĠ Ya i\L#@%Z,52PPLJ.eR2 P2d$7zV˜y聐l9M) c%"흛[OTO3U%f'>c6F*rb``"fpFE-rA$l\囄]N<yEbV#4i&4])C9XmaaKMEVHeUg##ssdt $Fն 4l,wwT_]0%zED|Psչd]9aIJOf{ eqE` %:%} _6%͡Rg按=!4Yo*ZL搥cMrʜ͑KaY|WVfF_.nT&6\ҥZ{&֤X$|(HMq&qiIek6ÈVii:\_Bb(7(cPVU%>sc&Wبr2) :rBttdԙxj !(Qf*R֬ې]$FZ!}ja$(Rj(tC9(:cچM(PQ*PׇT:ҎN-f)L` HF] J>*uqWE[ސWtjn(`̵kuEZiVǚMpЧ}VbǹPڼ'!ЄC$5)i&9jѩ,ilOD  X jwP^FY hH]ܫrc@Ix~ zNb*[=Bq&-!ͽEjPH!_`\pDxVJ!cMa5Z &GDM{&qs`RZO>G)8E"xF.2Um AdHӢ%s*Bj%Jܥ ^2U-hX gY _o펅*tZgkan1&qEϊXͮ/V{F'X9iNhkqz'x'gYJJES~\(RވxN%lr-tct.X}D"=ndkrҿYa+Ovbnyi` &zҐz+zHƭ:DNA@0pw xlE/%,hϡi#2+u9*> O(rX EIL/\*ɒ-^Q pFk^!a2&iƲ(DZʌ5m0J =Umz0 ds {3BQ [gJ*-窺l:ؓ`i2J5ߺUA^51 :P8Vs*kEcEǪ ש^FsLŭ1@2t,Ƣ/YE;3LꁰrM#0mҴ:r?:2]K˅?}>OI_HhT$nrUXrT5/k2 uXrZ;ZKf3+ʼnOQMBH1Im0r73QP'^Uy4OSabWn[PA$?]JVBg>AwA;ql#.HTi1 `fho+VtNhg"^)pFwy±I%5[p.Qrʄơ:ʁ0Z$zt|÷>2w )0jB6AOɛcmo?QB,VIXC,ښn5.K1n+luSTv[Nvxykż{ޚi˟'ߒm?CaA$n929E"*{8Cy.{t/wF1U&2cstzp*p{zMoͳ{w Ay< 5R*Ax #ł_M۬wy)}5mu[l8ʣКk&i;k6}6]4\s}tӼ}g^uhd#~+Rm; S~삉]j¯B2&iB|X pK#N<^Sz^"N y7UѴ4K[K2ֱO=n .zKJVf+?x^[oh'+՛^?14#=oX`!liC tÂ'hŊ/6hPcǐ=4dƌ'YLAE#?rTYM-yO=WY1"ͤIu6U*ҨPQ$լXV׮cn*Xi:dKm\rŦ=+$-sK_z-2[dlPȐ%Wxqf͛9k|yǣ&Ucr2ɣn,bܝymyl۠R;Pڷ)0l *۵w@g?P!Bg29~P 18C8@P@J / *"PK5ۺ* *E"*=qԊo#KhG;i|",Ӌ& |2#J#[ n~n4Lz8<,M065tӨJGTÓ< %'۲Nu*A MvtNa{hivl6:⺍RVqG\L:Mϲ^Dxԗ)O}^|䶽<~ȿWPE G~4ӘVnE ] !*op2 ==6HŌfkVpf 1C*NH RHDLQ77󩩅ScU)01ƶ6Pu"7ĭ_;"zXn@}qfTea)uB`9i$AālA̎2X9o<C+ϽY&( }S\1ƏE*!f?$sRPf,"s&l"eO!Fc'h | D_ТDfK"! ۼfD?)&E530 b>!4N/V-AQ>F"L1FKc=IunYM: v9I,5++~wv+wC#,i.f:,LWVM J#B24t^LJثmH)dcᴙ~L0Zf¤ؿ6IIn6UY'`6C"5ps;ߠ-Nm:ܘn)mӚ߸íX{bãODGՉS/*zgHbqI+ΐ {uQ}CPÆ.|8)(Æj!O ~?RvX~oGh柯{K6m!6}$Q16K 7:Ygسkνy3(ׯ>G^HQX=-k/2ҡO._uD"TeT]D LHv'i@g,`?cAV.ϧQ=FB ZPkYE*UXƶEgrNj]Q-uCBSW_QUѸ6 NGPiJta%,I6md?ݣ-W98$ڏj=qUDtHƕ2/`8't6}o\zH+ %bу8Dإ,Pu,|GI&Ev^jӭ-x&=*3ZV']&5X`ǥ[XG?~ H#Z˜TγJL O9_zf]:d0APJ;TWwI xPq&%>)5 zf}mZ%Vh2 +q:(GIrdrkJyظj!̀py{P9 93R5Py"mEf;ffgG~'IdrB>8t/uVE#QJB'uu 2ZhC v pv'yP*4_tDI x}u7e .j&kMAq}ܥ M's` ZF#` 5  Zqig4HF~X'?Seh?n (x%9)(Pg5%B!|5pXfooBG|t8 ՆOH}~mp5S3B" |qbIʑr4c2S)R ^^5`Yy yP h9 8(H CPtfd7dfXAt!]"9hIvAQٱڐgp40x)4J;? qɢ5z AZtE_#%a0 )TmKOA}cQZ7\HVzq?8{f3k2a,e%a5 h90 Y\9`uXfu+?$"9@ڴ\S\nmQ g[<Q<ّTf?0i60btV@~bF'Dho (77gCWv33Hh7F[yTdaWcE^QBskD XɚZu(XB++i"1HXftdDuQm`ב ~q:Ha$IqZxɈ hi:?1?} `oxx h, hQ? y Xsq3p։5GQ#"h#,zu_"[myN `ȡOXyz<KidrC"$q %1T|U{E-aVvs;7tC9G. ⨚! #zM(fI45 BEIqwd;H4CL3%8x8Y ų˲_IֆAsX#ryK(G](QIVr۞!{|snqb{Q<QfQ` ]E RUz$zTyQ!0G@-ar.[ɰ˄wx/ ʢʃ:6GX|@a 984^yфM(MZ#1  Q`Na/XVƇ1+Z|8QB,nhB:HA<(h{)i~ 韌Ijk^i ` EL8x%Kpm(pHQSDsJ)<\3JR @# j؄a\C)&10'I IS/cS$iи3І3p4욭Z!\ 5s Qr5X%|+XUk v!b~+LG:amz!D>@ a*Y,_ 5ɆSa;]1$ֲ0UHQu -QF21W2f΄j% B! Z9s(xaW0P3pz4̫r.4T>FtoexB# Hek=]iBf壇9g g}gesW@ 0RJLTql2Lfp%\buSh!1,عl;:v7yVQd6Y%/ë+95Č 30`~LZע&)J Τ> C9@;̜ 愬^ Fs`9^߀njID>K@qF@ֱTkT ð΋:u"4\?w_{$z--`ɲF x!A}Nd0QBULgVSUi+TZu*T@U IBjV.(r6RJ Z2އ }jq/М1>#GJ ƌ9fj<#h5F<ըY}r}ץ_c*9oƮ!u tޔk k$ Un7y͛oJ ~8sPpL2*tSIܲ>jK`Î3B74Q }Ѭ`&鷕SM}|c7MA~k!_`'FNX1DgvW_{vWxm/$*XL_bBٯ0Ad p@iLQD꧖tY> h(v[z1RX˰U'|z~v\h)d7bZȟ~=г-JF^ :ze+, st( I3g$"鞃-4L5в#t%4 tGI;` v]3:ن 57^v*(z1_Ѩk+|K IܗM=zPq4N]f b7Rw>SZNKØq=Al\9sv  !(&J_0)W2w Yi"X_u; b]nĺ )',3z(>.9N&G d(,J"Q8BƂ"P.qz`e FaCHRlbGbW9ب3"#bɬ,_R"yQ" Qau1r]BȤd!sRA8 R84?D:Yjɇf;N-eVi;CT VIU9 %KI ЇY7 ;<ӚVd:J 'fHJDb$ F .{ݒ*x3GF]D&-)tJB<VeTD{s@R>>NgSŎ.2VŃp$,86%sׯX/$p'A2G=jCD+m}/_ Xb ,c^5m95̪V\S n6i5Vk&C]SէS][/u %I>`N#k=ȡ 7 z\p͚ c+r/2I G8j21[ߞH0/R' /r$b,CL[ʘԡI&g$k],"zAKw'-saG8v !)Gmgda0ҷJK +kM]Ofnja INN-.BˌCX{8rӳQPm߳|qE٣2\dZFub"c+^ᩀ9ݻئ!-TE.l4h.n6AP'#VvLnbLe,ST}ڃImGY#h,y z㈴NSMIKF鱴rA`F4 3\䯾l۵Q>OE̋cbN|7^NWC.z/SFGmmqp4Dup8~m: ) I4#s-UKۭY7 Zx P@Q1VY @++݉쬻(tQ@mJ& I =9pQ{9@TRUqtJ5 $ c { Q=(a n5/j1~N4 K$2 m۔$IԝwL%+%ۃec ,]Y%V-؈wXe($(Lręy2w >6 ,yμԥ* 5k#rL6jkiНR DAT Tu1ž5"2']r56 ׁ5NQeS&3NIm%'_E8J vQHs0A$h@yY }a [͚:{`w#K h?tD*I'zޤ{#zFj8ɗ8d]B ׳s`%6i8\촀 BO јVB(Dq }j"~B~ІEoq@3poP6iC?HoQ@UR^;\*5RY?L ;2]ixP>!+uYꋫ"-80VbAM *QS؃2 R㈗Ě(91k1DED4N}li^H^̃O za_~k|5C5YֻfgoD `3c6_wĸk` [-Uұ(d*??Y0mpfȰ sMH_ J`5_ ؼaVkGefn~8 P?(D?OeR?BԴ*foG `)$1 D9 >kN$50 %ܪ!y[J'ʶ3& )!VSNtSl ,N"*k`^Z0Tބg'ҡu#/HM=2u9#]kAO, AѮ)ܵ33D.KM!QdneZV?S6YXee{/HyN<=OoF vahccO>pL2mZVt2mk(i0 c '1g1HD ka9@3Cn>M F"Mu_Z {5E7skؿLݲkr8[Fᦦ@O\C,%߰TZjLIS'B,Ը"5 kHQt41-5hX^`$9|YcK[!|=` "9ܭo-\/-́$mܴP^J. s7{E-z~^v\Vx,0֮I3q"-\[LApV#}VHu[Wŋ:Պ /,LL TQFǏ/ b1QjgN:#T:)ZiΘ!DX4!B +dÖ눕ɄZ>>էuDӉqιq& NBRlyWĖ&wʕkPXI_8AR-r)xvsB'7' з)2;d +wBU^ޜA{ǚ]4diKIf`u_O ;7{[ݹu{ts?,Dr|1Y$\(KVGl5uPdݣ A5\fqUTUrYbO5yI[bYR;Ӕc ^1 9XN?:`M}]rvbNڽX%ISGY9XInwKiduG5T_ 9aQ9B-oVRi5gYhB=`O=aK%_Q_L*$EIZj~މaM9e%WOfX4L04_X lPH"Hj,NE: [1`_qeTX:5XI<+"Q1Ζ=s(6feVe# ?hٓ V~&Ǟ Fv8;e-DNlՑC5C/x.uaG4A4ihKf3;eI9״o]ִlkNb!{نsu֑2@ԲXΔAT*XRWm;FlZ!1o}ox"^TeEY%Rj12B %%h{:7oYWH}n&\|kNJfâM.:sRX1,qF3Oܠq_ٹF?iNA E5#A_G>5H'wmBsbf"bgF8 =E#frf#p9B4!M K^6%!:ݱd] +@" 3;}Vg>b@\ H]B"($'cI:a@cվ KvtR$NjN&!X} *$$%(!R$5PP|鿈(AQ#* V,V/CW#P0*14zI$ՙ$Q#4P xX)|2נU0DXDQ9qK u]״Nm\ǓZXE512sĚq؞6lc;7S NHhH%F]-<$]d#X#SEki"666v)mpf$:}W,Xk:Ef°L4<'J(LX*7!b|TKG/b.Ά2zP \(;FALJY9ʔémOlCz h)N}7%>;n\pu'L]/:4xIf3J0[IB1]%M$a P0p`wxAԨE2JW!ly0M!ZHzY HhpPOO(M͕G(ߍQXE !UlÎP=uĺPLѿ(=Q< P֕æ\Śd@U FhLP0HXJY1NKXtpZ]eT (B#9ȗT%EuDT ՝ =ħKN"Fކ-!mP-KhG8뼑\L{b !hht`@ mY$2Goo[A(}F?xH LֱTw 9ʌǶޛ]!YkJNH1 FJP DZ  :$%Xa2:Shd2P%DW"8eܓZ"K !֙Vm9S1ڮHQ 9˺YN枙FdinIa z$2 !&z sfVˆat\cKP儒جlxP Hky"}]< pkmeЪVUwޢ9"}w2l&؋p8֭D F&Syc?$zA$}ɣkK&L!]2lϒDdUIlD0WBgN(2 AU#bR1٬P5 N]h) EL LGE)]:eYFXTj$Je'֩h:1OH1YEKq4*d): b@<@1~Jz 'L)Y#D1LG<]5'4ʓQa)Hv4 '*#V']ԑ:i_n'r|ĜGf0"x9 )Y 9DvE>oi9 ՛4Ke`c.p#D cNF~UIdjyhƋJ:IsH iY%\2(&B?hod ]uYb%SECRKQSTAhZ4QERY 5EW*SA`'ׁ,*,&XpzxYDPD&,. j)A }g*N_m\vi*:GVajED4 QHL{`be\Ji+Haґdr܆=NTAUbr`<1pPK_NM5 BvxIE(i@@cw6E -~EN *w}%`BM$*.:Gd,C)⯆a? lCM4:A1Vix|)T(}*a-"G\m,\Zގ֡^Xc R3^􊨈^E"Gb`ME2NFXm9 \] xD4H0bO\wf"0≶ʒhqY\F9Xh Ԥ ʫ1qQ< e8yRtFSDC#B̍:(#i=ǭ+t|↚$1,,{*^ ,hjţF ]c&0HTFTUdӉt2TK]l,Q^!_XLΗY@,ɷ)MǬ9cVl$Ԛ"o2ȡ\LIƘF\Lܕ]:P$.KeaHT!:M q[IXXXP+Bi$9jjn3B! Y u/ₒd rA5nsG1ԴH. '/X.Ty0!װ5ax;Fg}XE6G&PzlyH]gru& jv-xiF[+%G-5MɲFKQDXB9\L5gYn,xQhtIfA 4RC'5M:XN_Wm4MQֶ~!W|4_:AU k[G2H^Ckycy'wGJ$ݎ1d&\e5yIIA$2qeG6QXODNH 5W3~:F6 OԎoNB\ M]=Bj%>G7ydImwQg;H0ܨqEleP1]1p< 33.h.4sYDLb<5v8@$oVH{y p;Ud1kь6 W: x<^+y 0UL3e dN2~ QS n 25˲0]͜ŎЅy5o)F(`5$H3mwl얉 TI[;:WEip6|ʞq3DNz\Ezw B˰G&iY4vٟ:{{gqh͋|$^{OPo/G$,l` idat͍Okj+~{wYZ]ItΠo}{':Tպ7"X"? .9F \:!1gּ3f|Hj*7hCVڙvm۷!Qj\(p 3@pcƐC#*76f..PoҰA'172ݤ=秿t?뇘{tyZ rTРΦJ©d0> 5˰>\>aP+>~* Ƌ@2Ƈ, %~ !|QHwjawk.r ;r, m ꋭ4*z tK`;qb1c М|ȓG}q.rJ)J+ap])rʁr/IuR-QLoVHҒ/vs!LbV(*gkiZ*^0MEAC.0KΉ%2CH*ežh;þL7]OO O?@#=JYveޙm6[L ׊ zC̽Pc>rO3sҫ{kԱI+k09%,Gna)hVrTWGRRK/;K HK1Ln4*DZSQl_M"(3-hDTZB-ܳ2So34SE?.pISYrI%˺A\Y!M-ӬZiE'stⅉ:^cV>0٤Q9,JhI*KWtەtX%^rU+0N .ԝ4F1dRXӈĂ,8}Yk O5a}] cFf8 p|,6!͎xmhK̺2!, MəЏB4zo@5 ul:6**9V8j))iĬ1)*RRު%Gn!QR &e"k5UtLEalb{8jЂ֍Qߺxr|L곶L+gBT[^@eS\hg-~1rSB[r^U.E)m"V 0 K4hhP*A @|2L"BMa?5PD&$q ]H{*d밆נ󧁪D:hp6.u )1C2ђ)1y!`8Ь턊j@&!$ A1 $W4Yͬ1Wukd7|L& Dh!p V4VlkҚsH I X TǧXވƐ*PlbY5e%TXOoC3VȠkjțNcאa ݝT#(~h"# +aTpQ+v=A*%v|a@$L:*MԢ Un^pypsn>)L{y<󝔬<ͭG ITuKhJj,"\&‰'{Hj5R} WqhD#.t,9+LDFbf]9H"1@aM`E]*u3dhjX ݄P$U)μzΘ2,%SGWyV9۰6Z54EխJ]3E9J|ReWb&R ,HO z(G<͚dA=0s/%3YU~7uF-;;K\w7}GMT9Dr9,Rjp$HBWeYN<1n%-U[]Vյ4( —^|FQU6cenf(6޾)Q@oȐ1`I(j[:}˟FAq!5 Ʈm*D33-q3Әǒ1N1hFgp(FKb=ޜ2Lwl;c͂J$lk7"Gw9̗Iu)҄hυ<]p5s|y8L`b  ψ`8ɑKTu6M,vn?߭{-X{ml*BY14 Um %$,K eG,!v\QX[*,fxǝ[6u5^zC%vB^&)ɛ\v|OnDp&tV&`f f0o,P!.nZF&| jƑ̧&`^,P^09#:"ݐrnAx,|P~nMIJė0B0$C*#/vtجdXzP⪖*Έn«xngdE8D4vmC"98WN ".j0 '!BLBl$-l\jbb !`EIL^g4jA@o~Mj.GB1/00gX@$bL#+âƄW~H;!4B//z|\I7QINRċ 5H#.f8JH^ fk`Hͬ%1X#1!*H1 gTΡF?fWXnC,!lrI[||DU~wҀ~0 #cfntc"Ȁ4A@ޏ .Ԏ+jI~ ]-CP^ς&o.?xLMr`J^:-I +HSRENsd//3:X%XĬB0Hp&;h4c+~51A5FM˄2*DBبinGzzrlO'bs9z.1N-1P2q4x"T$/"HG.af;*01#ž$/c:3ec=hd@ӥeA{&~ %t-JbS\(/j5.?*=\΅ *C%hjƌ~,RGp+f +|0? GIthF&IS!%J$+$[ hnbB%!+.Yϐ@۳/_r el,GOA`RJ\5EQ5KmmpF)Tb}$vDRI-Us1ΑsU:ō~8"!enxY TAk4h%tIBA.lCI+6IZI BsRAt!9#rfƲ+鵀FG+s~df@r-- .)I*t$"ģ\ AJc3Ҷ0 +Y`G@k&\ # MAq3HQq43tojO17wmSP6@i!՜n`iAo<[cpP!F!415SVUwV#7Vo/Pg;Q;UW;q'T|Z,p7ufHo[㖥F %AACTɐtA &u> T1/Vnt9BjBCB WsR>6 >Ţ jl,u'GtG9de2,/WʲwIeI4JW4kI >.M."E=>QGBDL@ku)u'FBxȥPQ9.Qat{%6XSsJ.w_LUB7z}c4 Izqeura5s8+7E;oָWWy(upsc% zbwG~hi[c`/`&'n@Z ŅpZuy glGG A@vHl fVgw*KJ(ӊ$l e:lfMKks[lYLџ]Q_4qvVzmNeBz/4zq"D54`#d6 uX[!Ѧ[׻،lGrxs\ w3ЫLT7:kvc4r?\"bwEcJƀ~yd%ƲW;/&~E~4fAcq+SۮH{edTc9aeZ&HFe|"{$KNKl;;+kkWp֑nUUڸw~Y9(쪄QUjH1/}nu7܋ٶqyVY-sl3ʱy򛍝ց>7wsZ)lWI9:16⪝#V)!9wzBʩ)s~wZ}^GYZL0&q6C5 z]p+F5șPcǰpbj}̧!>C`D˪8ȊI:؍,PJA-F$l=+T;dZ]r~Io!4MW%B_CطmSxXի1.\h6+3RtC3)Wbn[#xd+G3$_W<= 1?=#˕.4rez^ ʼn,zB燆Tғ\\ )XߧCVyRsuC|?;;#)w.eAVS* #MjHF8GΨLU}D(<5 |:՞.Nп#yddrrs=QEi5^dSR^{X( zwrVbF9ji$/2Y2ʏ'Gx /4U&H 꼨c'PAOҤF ̉ UgτGzTNGWŴО3Vp7/޽N,?Ɲ ? NɓReÈ7 seѤKO3*{s4ٴgǶ.ܴ+f7ᭉ >j, (КeRXl?/n{YpqK 2^;Ͼ_;?_X7 x= u tY1LN` mXt\87a$EEt 8ShAuфT:>ES\4uVrI?YP!Y ڐS^iYhZf%g^P9KfHjQFymOu)g\pLUVC:xDB;HĚEnDJ^R(mjd MQOrzWuOv\ =/DUބ(VљJPz%U_zc/X_d ^&gnIZ~[\G.&I[F/qT&T\)$(nɀfbi7w^yՂby|fT_V}rm+r=:Xʾ( >lOrъ(3A+=ɪ! -b;IƵ wAA`{)b9Rc:#PJdK*rcIv׍wSF\y$ktRĦfl2gČE [ \5WrO٪X֢rj9T&#Oxᖦv4=ӌu tH-/SJPUΓb5Q$.KQ?8= 7]Zrׅ5VecKhwˮ H Y|*@  PD qyރZ!i C #*LQg'@18U$MUnJ?-(c'E (=D_""22dU@[x$F|y\`4hH~^x67IZ^tY3{ե"I53 @aT#/h++X=M'QwW:L*j8AKS'qJ4)O].eW:.qK\j吋L*4#mmӊOclǛI Ӿ1_ [O~ .?)#jX`6^ @&Njd/aŰB"䘱3YG_$Q,3!+J ,7 Sz0;)Bm×=$S CCQd)`j$H-9H*Uh%hAFᗲ)}<vֺ2B7A)tͣPF1BQ_H_v `5"{ĉr#zh~2Ia€ ESb5+ՐbO I[SGŀz="&셓C5E9$ Y6MU-fv14''/.փ6S./y)X 2g7XI&@Z4`Y(=A/`at&Syx< |,"2|/ j9& H'ڔh&k82mUq4>X:zb/;2k\@V8J}+t[28(H P ɡүt" &IE-ʐ| %| D9ʤsePuJ2 ]LC,$11)؋< M0+ )V&[J/I~2[󼮵¶]X/&!3kҺMn^ԁd/kƲY4Y섈)5~U1 _b !`{u16Mwxt9l!AP Dy㚏 h.X5 šȁWpU򮚤''535GB rJGis2ܭ*mQ-.\~i26Ei'5%5i "IP-5Э.v$aXri*TUE X(ܶ]sR1Qr U,ЌN f ˃7_g%,LTF"k4ߦu&i^t_z=a)kj%j8÷yv_o^"(^w@qdk~oH7BЙ*˟M_$xx fq<_4qq狚?^cw^rDy$1Wi6hW8s2770K8I%9$XeK <Ht-Xt&K5H(cQ+bQFWtdW@A'vZhI0 8ZY$7uUFAiؑ7x4Ax{jާ!)_xkYOqEw^2.m]|V`I_w Xapsʅɑ=a?qe?l5etky..ΓuDI%5 @#$v9 '#Qe/CifVa"hT|Sw|C‡(F8zƈvI\b!axzaʴ*_1cn5*d''^JrBZrJ.*sHg~&ju+ ahI#E)ۍy۰p /` _(`1x$t1w2A>%(xȥ u-fN6OZ`(k֩I^i=b/KV4r !5ERZW랆C v8:fGXC ?R(|#cגQhh閽2視V誒YJsUyP hNPvHЛ[KYH Qi֎+ Xemɦ8k Ge7B.G鳦 ڥ?A.]ȩaJzn|*.*LC5cqnzA/kDњkP ԫX8Y@ cF&A_5*'@WDsq &*pz•d(w' XXIt>Hh2Dpud-1'O @ ^vh ]eq2޴f #v!>d\V4Wl+o,*,>BcY$$9g>k;BKtbZ BbY@xXzR7P&9X!/G[zp/,Jjo#e/aYzkWՒʱPGD܋3rhs-r#{)5̂h4-&¤rD̦t*iZ8Br&!(0-YEC1mşŘYš=oZں(0+@IIkj+ѡFjԙ-C)(m1=6q<R 2;嶠񔱇ou#B~o~,R kY_%/1n(3\ޛq =[ 6R"O1JUg%gz^)<͋Y~2ZJڥ$C9(qK(A; mB`R [AAT){ХݏhUQ+=8wq7jm$oۥ x,jy)}F:j8? ȝe=sd^׀'{X>F&f3%*o* |֨X)638Xp&;^qK`4#R+eq;uJ۸x ])?eܕ*=M҇솺 _CBU9: X[eR]z-|(o^BL;LI|D?qz}٬4ꄩ8W<JZ0~{_A(I*|cs,MC&n\-(9ΚqWn\-ˣ!yx}xͩIntq䑌 N[5qȕ^^yrCN):|A1JkE_s˖gE3cLy+|ڟp-hT? \&0B 'd 3pC9PR*$$R$1$Tj)KZ@2 ] )*E yQ$(&jTLq"*dJ%ąԒʹl$q͔>bLpΛꤳ/p"*OP|1O@т*BǪ /(Lt -ܒt*u J-tӻ(dSK!fDJ]m$HZsnjd#í>d%OHmbW~n{E7ja ZaU6^ZlEW맲Q.kU"^MWgY;X!%Pf dm9ٟ{6ok>zCU($k\w%j~y1ۯ3ޥ> w@~G|4ɞ EU,o P'ww یBO=J#͌iE ~5Hp"° j,a!LB:&b}hxæP2!|7 6*Qv˛28$MRHd"4=1JLm„8VrJW\/U<2uÍ(:HnDհ8WN[٢wV܅2)auH]^E/̄w8r${&'N2eg!S^hbFJѤSU8ƉB)P@2i)\r@ 5Dw EaDɂFъkLh<GObc@P2?kx[iaA}h%tTѽ5ʑ*.&)md\G՘Fϑt5b}΋̬z}#{xQ񌼸Q=UazG\J/XHɶ{&-|Wr}v+l҅,53xtOj\_D)g 2s;/.*eC֝'5gTL X1 I%m|}tW CY+QhsePl4HR51&q9.9)7HTVht}ařd*KeOG#&I >]~gw.yJ=>Uށծk-ᷢRpe]9ahGL&eWm*!:IŢ14~1wGR@$F~ь}XyF )k(E`[uVmm[ܯԅQJ(YΝJln*CzCau+Z*eN8ŨrB/E.aܴI1<":.9+qT;ܹhQ v^KO^mz^. R (5tv 7[.]!5}^I!-a[2뱔(i5? B5K" 2o)/ ""zB( C?X{At6JlSïyQ";;OT ceE@;3QC &AkwB'! JFkEH`z'́)h{&yhBkD<=|'Cr|8(|G ==<(|ԔB#.88MX B { b`_i `.,Y)DCAx~0v$4-6CD \9I{ȇ _1G4:`kIICN k;d+@h맺s DEK' ]+Au*b\Kڟ';AA{ 4nnI4Z,IBT=<޲B١ݓ(/|LD; @M6 ])4_YR6$XHر3T8͖?8ڄMt18Z;ɲcJK\KYOD;4E;ˉ_rũM ` Ȏ2!cAO^ \O67`lb,ձQDmOysF}c7rRG 371''`L*LLy S{VJQ6UTj(ȓ"ꣾ::RiBI]{XݬR$Cތ2"S/c 2Q;NIM@ӡIiKMNbs@PPz lr"tD9^BBTf׼ZLs"LqTB{"̲D8P$닪|=-SюC (0̛HL sr!RJX\DTq# muneC׬i}M\ADt/P*G$w9“JNS}׵S69) ڞ*J /x3HB.NMS -XA~<=@m ,zK۬MԇUTF p03U=Ust=c*k yUƼ]njUL U^}v8=V6KOˉC)e͢"ư>@=@3RnZ)-&êCS+ 9[Nu85\}`''Wb\@'E1Ȉ ؍͠R+=l*Yh=V};fٕ] Q%1ݵ3Y(ѹYTZ+Z &Hx⡅.3`%h9/" )ơI/E[/vI0BC54>MdSQ_Wc%%R,a-0K`BT+;6i#oҙZxCTϭ3$PVI% ڵ BXZ -G 5F/%v6;Lf32V,> [[*MiRD*c3bP^e[oζWNd>Yb-dx..~aNPŋ*1`gF$=H2Z2rLa1Y&aVYcUwnh  N33~{ ZeQFb7fN\V$~Mi{勮CΟh_̪H௨?N!>/IȜ5Q,5~\_6oVӞT:\&g95%Dža[gxDV+@-]%y[kkcr vcg>eS%T=JۍŜ [ٿeX|_^b6f"\ݒ(6H]Em:Km:b㚋m킬moD%\tå7%;،P'vżnhFovp hYx$Q+"ǽ]VUB>`FbeQc_f6~cjx?IܛF+:՞%qVUnז'΋JAR% -׽g"$7'X reܽXUQ}rYDp/\G\q16ZD3m6x5q:qvenNCnhqnriXrY]u\ugvQ}\.mQ(╮iQ _^kc߆9J-.saq-MZT RNyu~htt+Ѯ\*S Qi6sOnJ4.ӁM*K/S~; ޹+PbZ&Ɲ:Xƒ-‰ 8w40MmJg ACƇ _Mp e03\Z;7ʑam͗׉8*ҨY+?xڻ+o)1*wW׿|C_xu( zr%vH/ݤA<@)S@S=YaBWUĖ'~"]Q*HV," `!_|>(]B: G}$%Iא+dkiqh(mɸpo rXFm$ш#g#1CF7V3^ 9dѣ>uT4Z:x[w酙y^SaXt%Xket}f8"le#efoH!Tu:H?Ϟj4ԟ@AaQ\_b;PiNC\jZ2xkkwd"j,jzˢ*E$Jt~ڳ(xm7Knڰ*Uj8)<ѱ[*:,)wjNtL<վ~ {Q:QH:@(dz%a ,؉0RFuXD'ZGɎHۑ{x_5iIKR#*y' VӮֵM-N&ʒ$aبTyFZD/kZyyS] vSܣӨExUUEy+n"AM WaüRvl"[=ցKT9)×٠+[Ҕ[51gO|RjWŋCBU^jV.o$@ڒzMQۮoAw Uѻ֬c+_#p3b=sXjZNE߸_|]Nm&<몡ɷO{7`JOEM詟u ^9ܣ pҖO(7[w$3]݂ze ^gIT9OasZT!im!iV .AĞuf[HKF Ոu[9Tc-LU|rKܝM pGKD0/BaJ"5KV\]peZ)NrW5NUg:U|(tPYZKAP8!9f^^|єքv`%\tͱ^e bZ"Zu=<f|#: vW_r/@+nk 9_)RTE~G),ޡ<>aBfbER/:VR]Ii&Hcq hfeZPza5 )PfmPSaG0FoU^#H;FIsvzNN ܥ%=ƨɼ t{j)T=VjdtKG@hN u]I\ΩW(Z"KUZht h=h)n o<¡Z˽!hMPyhkkXn#Wh!Z.VaNki9,yO\)&.-.#)ڏfVVZn [9\!SrbtYl²ک eb<-p|_\Mن ZS$%ɞm$ȎO,\T FJ> Xh6k&+#fjlGjKܠ>jFjQHz:VD MՆTR뤶ڽ2!nb"+;ڡ|V$Xa*f nTJEߚȂ, DZ>1c-L6TfF y<+ŅݔjVz\ƮHIR̍BVOr=mԲs-sΉ")Y؂\J`-慒OߔMvؽ,j} )Y+SHtng>6n<Jn//ԇ*zF+wqH'%vh2Dj^f-ʉ^ O/ؚ-w: nتvݹPnhpƿ@'ۙj_.oFiڗlpę[`*^o kie͌h슮ybp2Xt@Y5e晤Up7ޗc7psk2/gJ =+n1|0Dڌȭ|[6f1Z{ |V@C IYg J$/F@st~n3+{j||Vg3RNN%N"{n8 %"u[p!Ep)ΰl>݆ erNPκ&pH\R笟\C0uΰ^A Q sK1 ݻk7+ Ɩ9s ֨"n<෺g6']M&b|vSHV/ac)T uG?&2եiDC10 q#(~-#W.Gg15IP8GtШ nivBoChsJ㯟;)ۘ  y1{xС~cxҏgck|۷7x]hĬ$sygg |7w9Wj3QmQ>< }.EۉDµzOMqW`]e@DJ zv$::1?cd97wc}~͸@5Cu>5g <$/f:=Wj,5o}';ù[Z/̪6&Z;Ȼx- n{B+vņߋweݼC4s[ל4瓧 o93Gyԫٛ c$˶*oyn|ɸp 8Q{8sEi+wrron~ØQLS>B|~47{'Q{'y!<#<9=[=DTH):*|܇ /2xq`A d0C )>hQC9vbȌ/jIr$F?&K0et&N^OA5ZQI.uu^z5j֥r]3bXcŖ%{֬׉TxhگPžhw\p[\x`ZĂcǐ!OrO;wjcєG,3g3MtҐe& l uc#Ս: :..aď˙7_#tu@ձt69߱y'N|ؚS]xاӷ_?h=/*4@CL켹j- +A 5"tϬ ;5, S4,2<[m'_,'hl ՄEqGL+"|(*ovUnG GFvFaMiBcHn8Pfˠ *ΨL$ZwwRUb #"W=*ola)M"7/uHI%eokyT`TU>om:&'G9bG2G* $$<}sI'7Cg6 Jje 'ҦRPH1,ra~pq^GH趉"Jɉy[lK)XxƦ (d䖷h*IEU(ZlfV>L7(9>UIuj9U12Vav&c ؠ}Ln?2~<+Sx6rY:tc|B'o^|F8ԗ_}YOt[/y~?Ty˿s\q;̡s|k9 ~wvձvz~xk`{Չr/3/:OݮO~|wv?}MzӞM8q{׾AWϹ?_sꥏ=_oigNsG]߿5ǏAzK?o7z.Ϸ{=OΏvoN:oN0*o PLpq ^Pg0OlsPw{P0 !!,@   !"###$#$#$#$#'#5#D#G$G$G$G%G)C48A,I$K%K&J.L?SGMGHGHHHHHHGMHjRHnTHlTGkTGkTHlTHlTImOLrE\BgMkTkTlTlTrTTTTPF:z/x+w-}3UAUpGUlGUlGUlGTlGTk?Tk5Tj,Ta*TQ%TI$TH$TG$TE&Q?.F;5>>=A@@CEEMGGTHHTIITHHTGGTGGTGGT$GT$GT$GT$GT#GT#GT#GT#GTFT 4U'U$U!UUUUU##U##U##U##U#$U#$U$$U$$U&&Z>G;GAGGHGHGHGHGHGHGcEkGlHkHkHkbak`lglklklk|jivmlllluͫ뱳ŽϤעצתתשששששתתH*TgiPD=ZD3b 8B肣&Q1%$RRP89 9>p%R@hL$CcXIa&OV!ȓEA:""s*B Z'T}` 6Wo HĪStspvϽ9&':Z-`,`khOQ Gie48Ԓ @!z!dL/~;T}T5cg4Vv!ڛ =LR s;ZHv`{4m-U\WO&n&SX_%>EUQ^UkcAjCmJAE]/p`1WH-~=VO>nFPՖ-S1 G0Laqv1P6Gɿs`J,eB9l7P XuEyH>'=DxҲ =YRh|7{4).4;ON EB[IZY4Eh`³1yDyQ^2lG:jhf!F2Z68/<\%$FKy!8iͅwlrOP9ܐ[L,,|XEBjHD&Ͳ@K"S֒KvU9u!0UaE*t%0JEOz(JVR2 *pL$x,:`H,,h +s^R5<y9!u'EJ.xb +{7"K4hd -vcbHE/&0!P5$.+[FnI3GmoK)X( 1B\#G..LN#'1i'f42?#va#HgY涞;d'IDujV՜@NMzZtK*yD?Iy@;Ρ6haaQMZ)&D7yv;`f(ͨ$ŮHzSpϥ'KڢTD9hINø4AągF>6tf( :D(Lbr3kD,=`_F_P4ۑ9ځcu# pD(0\'\ Pj*;x([HJjZҮL|M[Y^aͧ]`؍hl2MjQ&CAZa2HVUpr͐}{S:׼Vq@IA:ْwR u: CƥR˭ JE5~$&ryWaKl+KؚzaA#U 2lkQ8綨Y5Lvw/\d5k<3#x oo>Y'X96{X1K,QvX;.hHv;44 (yq,bH56CZ㼰ԭSҶ2c"Ҭ>,ܣDY ^k2aVv`F܅ \FJa4琸@'l9ȩ ] ;Y{&MC&W?ŗIVB`r:mGrOMwT.xwU}WL3=h;gO.eF5~nm>B#8yF b[g\^{ }0a9Vhǹ{2~>ܕ @Ms}?dBW }X+*1\qL) !ŷu #!As?%rxXYΚ̊Ρnf`4TLZ@_@Yp LpcP!}fpxvXq`SmrrH͗'v3"JB'v71!Dh68v_`=gWMFysu[ w [}we-R%19y*Zsgp l|>x3yxc`e_Z@K(AP Y@(A [>P)Hk(k~>#Pwv&QE!T@AA0nnJ'M1VtSrsFK)alSwpH+#hLfIHQq9g4@mV ,gUg`p[8nYt(d98&g#3^fgtLFUTہEp,(,lYG28XM(PY Khǃ Y1Nx=]}XBZW6B*r*1&x 1)nȍ>J-5B7 HKdLsZ(_4 Ƀfw^,mv=z-^А!1.0 p8Ձd !38vZw8=A*"TBŀwHM$8I‚ʘd;OCH((!I, 4$D&lYpܙ [Zq31"r%'q'6|%WLk{QJ!(F`BGH0 QZqv-8b0a>&:Ţ0i@P Y`X Z@[t h&BY+/3Bjx5RS;$E&Շyyrf[zpv%zѤyۦ08 xu  F ~Q!r S( IiIbCI@ i5v*'p$EHx `Pp8nkH'9ƊXHipep 94s&bɀΚ顝9o1so2W*CFs)h&rCt 5~21!@J}jڠJ*AGz; a}XL%9_aztR*8<$PT9PoȇLQ Զ<; uzjz0w5а!\ևH @KHNUx-.k",O(Ŧ6{Ӧ_.~2YG7p pF }z!u-Y |AtZ(v6DN?380%D@4S/-z 2ay16GW#T0%|R/$2D5I=zȊ~h۬*L$  PP GL@2 "/bdUc pIg/2-'N` VZ{ji+tvJQ@5   |02P,r);**K# P A" *"t;Z@T>j)&J=JuxրXdwHxȥI}8 _ǥs-G 2ZyNQ.A7-Py`H{l`n}mI,l{'6 B|0?0ajy j} @ 7 rt"fg(l#@% 23B{)|Lq|`ʵкҩIYdIȁ89R<7rY i/z wxɼa2@fvClۢ_`0 4 |=a͆>R$o5I̼4ˉAou`zQQC -}?̦ z/Y@VZ>F[ =Eό0X W-40<'J@>3_!݂K?צ>ZHL8a X,HKLU{1TTKd@[]%k/2AB &=V;-U7K%KȌ|4˃A?}(BX:|*="7Yr-c$uxu@holMù>%D }@D |yZF52p X̻ШR<]iIDt)mbB57r xEtqҹt5d2FƧ#PXur?}^&^@kr|TάXav@uљ|d<5QB`YPwӑ< JyEpWr>f\*rv\> W0op 1<K ) #>fYх![T?S&+C3<` Lŭ[ڎ\C}13Or X8^K<Yj$XAhI1p#J:+=} ;/#RDV>h!.@cZdv@ԄQѾ4>.nlLE;*C>giMA5rӤ ʀOQ\ NKћ4MK@mz P>yS99"=SK ڿȆa T{1G` 4q‘ >s7)aȑ4q0 B>DR94E=4Z֤ RZ͚ʬ]E: M=6#(UkbK][~%9JQAT((^VRPBeI)&l|֩Szr*I1 ōCA̩m:=8 T. 4Yn-5 Vɕ_uUɜxpj Y&;K/y޻^޼~9B,꛵;y*˂ ?Oy{+F@.;RI[Q vq nhȅ$P#4<gB 2>3ĺJᡕ,(hvh8 QGB -*#d$ȭ$[ تkI(Vʽ8ſPK&joE893M4ׄM(qx4*,:϶̲3tEuv##R砣R LQ #/(.a!7ӑ;IU:kRhT@9+R2_唄-6EX4P}6T R݂Z@,K#H}UjA Zժ zE d˄–ߨ-ІKrqP!pA}ȐCC(+.ZfCB!HA Dď}iKd3Te+nJfLqbӮ< 4M 9İe0sc(1%AHd+kPƟd}eiY@F5oaX4 v}XdNE[rg~2TW~S¹Ǚ]3:ND<@7HD2+ &$* xM5YMFlٝZ6y*y,g)2B jkh⯋鬗b˥kX4ږJ(u?=l;ؤt6s8B2:X(۸%Ei X}sK~;#6T62dM֤fʵL(X Ƣ].ݻskm;e&tMOZΨsMb;q|y8 6hpwPq4G+9Z(~ёP^!4 31~Ѹªq N0R(j b'2Z 9cXG٨ht+$2)qӮ))@3(8ȪhA,":*! !7z*)@=<; IC*!Ȁ Pb?>OD3:/頥A_Js $Y;"T2> h@ὦ"?, ʘN! pPZ-)%͸&`^/y'9bSx0CFv=H4/TPU<$#Ȉ7@R2>;pܡa@Ua*ڙOd;I+zA!&$'a>TrK>6D*j;k:2Œ:*iK4kC13<# ||H!w+68wxpxh9Pv'8L"G (.GDe["LRr "9Rdu˒IR [K6E{-u$ג9+>נ.ۜN#CRk.ٙ`cF9ILw ^C: {ϟ5m $Dܜht$ss0M7`w@<PThuQ!T+̍"O;I 9iaR(Gh߄dJ|FOTOϩɥpD4]t+u4wĤ%'C{5*dM\ J\A)뼉^ Ćpw[[̈hW8Fc `ypHuM~P'Iv`ZeTX(ʅ]|ۅRT籼R q qP^5ޛ4<+S)o}kɅjMqfIC;2ީO-{ ඹ!y9'-?ɬ>Q}yTDϦP9z1ٝy"l㊾Y'ټHfpvhUWu pv@WU QP(n>LLu8n^F>A$V%譼Y g(H.hƍV~뵙ŋMΉi "IO6]_"yM5 ZbR%^!ؒ,[.%JMwpw Pu(r=Mjx  ȯ`mM$~gbdR d8#NɨQK:h ZA,,Qu%R|Whqxd zyJw79J َVM/xNMz!\ 밟M_С3˕cMc[]G \{bI.}ͮ Y[rf Hr6NRx:NҰFiW)\IqTᨦZ)ʀI"P zFZgo:TaVvu;䷋ XzMegj5n~q"怂5@U= VN qpVrGaGsU]x"Psf8]7dP8A)q 9QNE"Р)JwF\ ё@Qܵ4x K:x0&]%!V[ʉР:W j#|t[*yXH=ַcSf9sI"Be:K**rxX-=FNz<4х&kZhН-?[PtAߨv.INC44 N:t9Mrj X8PN-y 4 b1r8 qW,Lb)WC%R_%6 ^A]N &Qn D[p8}@聏843ˇspb:fE#9މ(TjP+%Y4s=1%FdCjuBL!}>DB`A4 OtuB(?4#%bEk)Nqj[]HqVuJ(wJQ7rNBPMx#RʍF'΁zMĥPlّjMxur͸8䪋&YoXuIiuյӵQZ!»[AtKgz&[aijnQj]0df6RkyȂdVK4-4=5qU7݃ 54fIP! ~z.=F zƊNgSU&&8VҙiwDK>s)wIT>ؔ.=P*F""D-4paQzayџ2Fk™ E]RS5^DYJU5̑k8g4;tP!TAJ@U0>H,Ԇ$1 7yڑR{g67G"MvT@)4dk:O3sAVLh\0 ̢N0A$YѬY׻ 1NO&)?ٞ(Wq7aE\UxYH|ɿE_'lSH1x8rfLIĩMa)c=0|}ΖϥHuD9 65A_HYO6Q(a]nPdzcF*5J+%ZǢdO j쮺A<Ϲ+=t˰ǔPd|ٚS9U9*|)x^~sq"ղfu+aS5FZЄ<;繙«J:؉*{z BM)Ⱦte K~)s4RTK1Q%fTG\dKmg3RFP YK% zy8 6Ll6-bKZq sܢm ت.f0cMZR1N$Iq ΂vrO`R:q'J!OQbXAJDE ZGN_K Xhz@)t,WNh恣 bOS >"XvUPb>AdHϸws 嬰zQ *3PT3)~'E`8,4I-TəR>+~e/?ty&BCޔ,.AHn~,UHC Opm9ziMU?jё`_6"b<4\qe8j7ʽ(gKv[ pm8VR S=|{u{T`l!7%E> OHK-^}AiXVYWL!X vU=ħMG؍PBˁ5戋_OlתD]EHIˇ͞5II GGS=EDKIWmDQlJ^d3IIiD ,"t\Q܁ X EZ4GgQ ]#I3aFtmM8xsWmLsE\8xVZ+MpBN#Gڮ@@y $ØD)H|\kS*[)P4\^TĄlV!.W lIWHmL/0"=* N:XbYUjI4 J%˖`Oҭ `ݔX  tOdф$:Pp 5НiQaFXW\BD @@T ~E@eKLTKHߙ4t_LQ:V وIkь_E/ Hޅ I W)"Փ! Hޟi"1ZUXZjVM|kQrK\lXsF)DTSEIAc|zAPКQl"(fQHLi6 ^{ɠ,CTN `=FJٟEI8Hs({EwΘPqT0T q8UxO .` ! ,\hKY %KhhDkH\/ ĉKc aP,Fg YU0ʦ`F^D!PEf&*T c 4K+q^RZ]O&jC NUz fFU,J+\,FUV뵗.jCr9^n$lk:'-RوZx\Nlql@[Pꦖ~Nr t%&ER4hۀ6&`sR=:'6=2GP_U?TnՋd́ ,dl!Z1y#}a\E] ZdpֵĐTziAܧ)RhRP\D"*a Ĩ.S.#BڌgFdÇiI`h&B)<,-kP* @!mȌO([iU<H"՞tA .u@gkjtZ5VIҚp- [eH[ \+,aZ/!ܰNZD&XpZ_G>'(F֫mnDݓj!*p1|]S`$.]btJ_>'\NpkJ5ɺR)Fnp&%>fm2sf$mJ!/Дl赗,ҨUW[λzн]qq$O`/POopv.d,ۣ9 ~Q Ȇ@QC8'ܞhEP0]QdP[  YUo^T1GXljA!Fjm^0jfFG2:~JZD`0qG ˕c0+sg u,D`MBB.Qq|_Abxf}ViQ*L'AJ$L hhl9QTqFb][W7m_N$Ĵȵ ]kLDX S<[ fiJ XG-O14jKMȜ$5M.́*n D[ ZRi]@8SM3tZLTOIq(oDiZ%BٛSJ<UUGoιJ|(WyJjύx$^X)񞃳?}jmM"ַ+ ߢWi@1g4gC=48Qbʼn)B8EBQ$Ɋ%9LI#D=9*ՊSRYJ]?fN<* (#~F -2%0R( @ ͫ/H3rj(|=f]D ]\Ǵũ|#+󠠡jh#0P-?tŅ!((*ܒ5n6ڐD8" ;Q4&+)ܨ% IA/߆)'CYuXՖVfJq\QM!BuàƳ;l9f'h YSjů[ ʤ&Şjʄhg==*I$ {('%D ieA?Q|$>)FFq,VylP mP'Jbʩ@.<Cj QL,.(%UYdG>yӬ0MWj:^r~GkH]rhZwq3qiAmtuf'#E gEOBuڅB8? X0$Ũ#O46.`PdOx4%Dk@dp2@iY^F)N4P';q g"D$Qis"X q,MQl 4-BZEI &Bx$GK81*eyj$KJZѳI`;SRCdxG`sJV&=]—Vh btºEer% +TC!)H^'cF%*-E4Zv|G V $xƃb7yc>,.#97A.K,Ex懰^1}f-P>zJN.#h!-b$bg% ?G|8 {σp@qC$Yb9gØyip){a.;HGp_: Ţ6@V]83B`rInzD# 09ƺD8@:bիb8A]qUCj0pDZNg¦b~Υ#j>nž**I:;rɸ0+윌° I͞ [Hh<$C2Plf#iAM'g~G*QtlP. DbO*F-O+qp0gNoRHi ¾H,Nl봭oUUYp1AZT3B\ܥbn(lFQγ6%p lKڰ&۲ڴ\mQ4&xaDs ޲㭖>','M- l . #7`ξ(! &.J"g2,㍘{G0.`! O8x,YbqfzdW%5hj0 b\tr}ĢUg${*|槶ny l] rp ŰɖQ * 1f+R`C\TjrwU96B︆K(ZbVm:/#VoKUnQ+J/jb  ,қ4CLYnuKjEYΌ\[kWA'IdqjGWtblGQE`46y6D>V3dv!#Dt$cbF*wTbʠG鷅J)act2a&L5T6Oj89xpwpOp wqKxhrխ)3=Gq3Τ 'ˎxDui9Wpvz5'iwgͮdxsO'ʴث<"^b6eYj{vfCzRTTtַ~ *3~ct& 9 ;,r4(iҲj#5C1wJ DyV[8̵q 132N đ(4T+CvA?lLE.P49kyu($V%57hJڃ''HQk[U~:'i(Vu)|x'!/s<7$co'p9᜶m"Md<35`X wRd}Q|=p-NHVE(ݺ!:}<5Ƥ){ ;0G!csAH㕴 8/S cNcQCyl:(hBg%xDDÚ1ji-#vKs#bwsSfqk tzsW{{E/QU0QöY15|˻]\U[m_qQWYFsQj*p§!f&RH$"܏zR>`tݩc.4B3b=I?hcʜ_(w'&8gg(2Ar_QSX3k%)E[=O 8?#Nyi:=lʻ}8[nXQ]-X8E ES'ĢX:Q!2iQ) k9'5\Üag#ow/#ħb'ʰȟҗ ׽Yg>nށX\8z^a}.0b`s3*]?;)2ᓙTE?.ʻ,W9(ݢ3 e\ 1BL ) jM#uj1uk wՏ{b,JA0aB(4pjJV8vqȌ$51⮕,7ECJ|:y3hODj+*PJm m4(ј+X^9zZQlYtH9qN UV^V,xA# o0[dҕ#ɔ'[Q 4-lnyKg5 [~ ;٭Җ=vcP2&pԨW<9rˋTs =*V[SCbE# J[0QWFD%Οu9Qq &2\+MWYaUZT鑇6 b\hQgq4ab+%T8"#u=6WᘒN6 hPn1}b)BRFeT5&afU&Y4o;s.j.zo0q(c 5X 'A17[2PtU#Ӏ8XTH6y4Kh& Wvvwc_wX"$m]+bw/NPSO4ӊqxSgpR䢋C*b6~7h5D N%ޞ4(+` K$I8SMhd|B'QMAS)< '4LE_,uMeQ`ΒQIWB.67qYf55)_rU6PLsAڃ nPy" H+`u 30JVyOom S0+"xb3S=aj?(>,U;` T0H(F{TR3u)gSPBgD\YzÃ$#cBve&oORRC"NM_&H*niLO}ɷZ;e(vBIp;dJ#h8͡ O@B Zgw3K*SҪ)j%TI`;C+ȱAM,X[먢e}±6ŃSL",aY +[A:ⷉ2  *М+5Dv~}55//~'#SL%3ha FM CB##T,ZA N#-+̈́0DgJTHI*&Z=i| jrMV& pHG>DY6&HI:kX(QI#th)c2%wc>֢ FJVԜiN~!`+]tZ bdɒ8$+rJZH->אF8a怎D؂);%jK\NIIͯ]I~[x|>%"{ב%Cu2 1he. ֠ hl`4Jl[0lÉ8ɉ' 0T(N1  *b2-ze1D=iE| p`Mh15Uע>QD> $!BYt؝w2KO WԨCyk{LFeP%Sj3cݜ`Z3q3g!ɘBN\zT)z}.qV^JS+Kx #vɊ#VK;]=sCʭ ZYsVu51 t|z8T7`w|<\ Ґ*[Z紂MNO:hw54Ik n+r0nF=';PUI!/(a& @9I(8G=ȍ{ŴT54`T{NSxҐǥ[hx7 CUƦV+2 p+T5ckYŰ=Ϛ[Ivz,4XYvqԬc Os.Q*c0F.'`5GZv%lO# qz btv}U^hWNaS0Z23Tџ (b7c<`0$(d8h% wM3pgR$vT-8)tٍXt?Z|PCHCJyHbYGYC;gL8UDҥ<ʤKℕ<"I׳+j):viEwI]vZxjvD! _Z9'8ņh„uz4,Cxmyu\mgA3fnT%7 n+ 8y}#oqٟ'oJUVVH;4ʬڟpw G1Vtޑ/T#֓BGGFAIheKN +3*-nBN=AUAeHiheZGŦI[VW۩$@ uIM*uCufFJh*]7qϹn'GVh `k${=H"i]X8!i{ɱD> bI<$xz|/۲1+e:ttuX6 AQNj!@pFabyV1DŽ!DAë؊q)q:'- i[jU Alɖ2UH^e犙rnu)fiQ Pz_M=h@a=lޔ"Lx/ShAg<3O8]䱻K9Y{ڻ6-t]#23gީT?u8c@b5[v&q /ѳ `5:oQ}E7Dk03*rM勜|e9_5\ 7B~˜oklE@6,D|#1Z fdշHt&,H$,uɜ7`$ &b:=1[/E?Xiz4vbQ)>9Jixk]jZZXZxh_GThCK!!E=z۹%Ud3{ J&gQ@곇~6F@d(6P;!&l EHmyAx .ׂ-![\ɴ(ϊzQh_ L b31_޳!ll1{H'|pv̌ΌI1gBLa +{΋lA6TKv1Q xz"yZ_ū+V g/׭ʤ,h,ۼF(̂lU~,Q| 6*Rq=h[?ښӬ!<P8A*u_~ƍZ\תs?}O_K.@TP.8kA0B 5NB2 Ⱐ>  2J, %($jkFkGN!D4!r^ܱF&qđFzȡTɆhL&GR򈥙,T9Jg̥YC3EN<@jϸJ,jTA-"QJ=.E)ij+5;̤F[.U$^k3N3/rE #Xaۥ=0jEM1uWPneֽ8+ͺV89J6p X[>GSW7Sջx-R7@}_|V@Q(a&'1M;qT9lbEQ;>2l"lY"L(!hh0VH@HA82D'seY6zJi%ۛ⢘R$R 5[z{0笳&Jlϩm>)=8XԪK oF+51TtqJxp3`4L0Ifkh.~VYi̚u8O=vI-1NxVt[=Z\:Z9.p3ReZ7>$UJ`ݷ%x} e}Ƕpx0p҆cR:aMғsmB]Ү$LF qF&](g8&JS"aB-i)[Lh2$ؙs&1%hO^ UV-p,E=p[84_$wQsVRIX@ºJxEd+m!}w[ݳi 11d/8'V*N$i'VB|g.ZsdI{Y//y+bu >j,r2r]DrRm\Эiu6),7#/ kY֐H:&8s,U3%V]Lя`UEsYsa-9yhE=U&G ?=R I󶷔tWb{zRe djbͥuaE(r0'jx_²Щu%)zSGlyåK%bQs+TZpp%(kR݄CuA7W _S4UkQA- 툚\.ԡ,CݲMG\bQ#N7a3ʔ&SdVq:ۥ4wM.$XbѽxY彧^1S:]5=͙&LaTnvUsJVf6Ux*J#7H+QE:eqx'ͩCmpT|t7,w-c"g*x>Z6Syܭ+cM槢HN󭸟{M/ѷG ?k#\q, Dnq1z"ytG3RM%.&=KW-_-ۆ!㍾%3WIfﺧ>ȺRq 맥)7갺[R?Xo)6ۙhQ!cqW@Ktcx6Jn7}7{%8[PA2y yܲ2;۰@!ӂ, >ýB*\y3&L†-5'>J"(:i´4z*j@l)D™D{5O•<5+BR /5;u)ęMRxABRA 5ēAtS IӼ`1!acZ782%ĭsrBhBt*SFX':4{>Qa0{=mLp)s0>Gშ$ȏyBFS{?5H?BQIy2D,&K) tpꒅҕo< 5(WS#Ko ذSo ̫WD[C¬]PŪ,7Rz@EJ0aFz3|,D\K@$cK 4ZFlt#x$)L7+DC8rLKþTjz. !7,3H(Թϔ4:=h"{aJ/ FEd:#ٰY5#=0I:#LNLNVE$İj<݄v[AY:xCڨ,˴`&M>ԴZ:Yݡ])T5.%=ETc6OJȡPV:ӌ=B&[ SpQ.5Y`WVia _x5_[[D-T뢨}46\q|9FWPA ;V.RUѬ;3bna>UÉMم:E2 cJa&h]F!S\]x'D.JU*S^.SRΥ?u3c%f64Dɹ߾h^_ݱY -LNF56##Ћ߃ԭUYO^(OȩPhahQn"ܽa$ET^MǨ)jW=ޢcO@N $J\6UIV)RDN:/[ch"1[gdfi^Af[uKf& S8DFgK`0L!$kg7 ДDU]=:2ל+뒂MVMOCnGtlCoap%m:a7l\^qnqOfmΏn]Ru )BAَr m6Y37 C ޾4knnn%rh%t=qrFfdk1( r^Mq6F)ʊ_6KЈ#7n0$|Af*W&Zfrjep^k5ֈU?s6g{>Rמl >o"kqkrwHhs?t] \o>o^3Evv™A!Hyx;_$>\_rgx]mpjj_|sIpd,sm pvs_O-:oWsAWw>7tVws@Kሶ]GqdG_tc:6֧/PWlg&_jQߚŗiU`` J `kUJ+FQ؃wX"Ęi"Bp](,b-xcZ?$uAɣfpEUoцW-wAmIr!$TZ:CƉdb4HMx]ɞOg ZnI@JY@ zvuRIMIuf4_OR: L~\MV_ց#zijt؉kU檯c#ЭǦ6#Jv!ECuIIvVZYX\JIIŁ{%sәЅhsQ}DbǧHq٠#ph R=eV_7ߩq*B~)jɞHa+>f3[&3F/x;Ȣ%b'CKKaƪgL=ٖj\mNߓ1tN) ϭ+LV/DB7/v(NקF2GRhiW}ikջnꀥLWh{3]^w>;π4Q΂elіfURa'@O2PnVeoUMn:g[Qrnruߜl]D;dMuWQ◴D' L֔/G2 c8:ANUY1JD,9 3áLudwLp%a*0,#!1.?L"S'u!|+V/`9H)_(& [e]Ѩ7wUI >RkJ"&& `x & Qfa\na$+CBesG.I n"~0}<+WЅ-g3ىpZ*";!fiD;"1C M 0dÊY$'waE  |CNsIAa%NmSG-) &{6ei0؊YDN`4Xq"';]p]RY@1dPb(apJɂ9JCӥOFRbPq2X'BSKØbiQ*k(Lire^r]z ֱFN_D%h$[F^Zm!i 䟊 Yz!*-'0vD \QChEZQ4)I 'X<&Li 9Sb#Y%k#X&yqRQot9^W7rEm88(D,|=ٹ.h]~n<xGR+Fv[ ݶշiZWΟzVP1_{f=j*TU+'/6~s/eO%ћޞ]:õ|^ƒf6qcF ,|<njҔ$Mvl$hK#IJbĨGAĎ@.p(o]w)<0;%O[)O&1{Zgs:=QM9DX5HAqgtR1]l]799JN6?jJOgo}ۯ. v]Êd61 0(F.]xVG_|Γ(sG^ܒ%`k@UqَV(^YuY9Rl]MNI`Yl YݙMbEeס` { ]Q͈IX !}h֡O1E Dt)'MhNBO0RtQYޮuYq^֎Oݎœ!UMEah zSGZ@5Xc*AO!ɛ8KQe!iSAC6c'm%vA E0,T5F Yb`z#7͑##4eU[^!E@!q/VP"jmZK[Š  1 AaF޹ TEG!HHZGaICX$DymG%ZPNbaGeP 3֟n a6:es~^T%&j:SH[X^Xy}DFԅ[-"5]~D[L$_+&`J09GD6j9C.'0_y>^+Q.eQcܒ[+=c6TE;Ҕj~%] 3a%O8m*Pq%q&iY֣"BB@AdqfBvv,VI͵v"G_u`IQ,&_܋2g{xV݂ K>ay`U(}_0#&pfQ Ayb= o֓uɑp`9bY4Q@oF~y)B1h\*2ĸݕ]"(4LdK ibF΢ Yc^cjasN5VIuH9Š.`cXEIF6߰s)n3uk(&("j`IEu2W٥ƙzF]=jYw~r'|'ۿMDX$S_}g'F.c^vj\uiTlQȼ}iufDskDkp}(XNƲnϮ& ǾޮƤϒYC۾TRJ0b.IA!dpޅB^ٺSPN.XU>0f^qӚoωWܰ]1gq.qz g#eٙ/Ps)ʅ-;hqu1.rg[Ms%23A׿Q]K3~r@ڐ;p {稾* $_,.6zxx3Y0ae7uNF%lo*rZn*T>/rB~ɴ|uf[ g YpfM2kH0 $/H\ re)y s#Jg!gouAo2{[ݐ{Oȵ6kt~Sur][u3[- Մ7 JGs3S]waGV%g5B6FGd8x_&;7s>.7iG@^͂7Wum-XkqliO`Uq+{}r\4o}t5qJ7躸: dt -bkگGtLh9i/{/w&+ZU3w}j8VX][q:-*^br: 5^{ Ǡ‚jyEBI6gwfI(?ou+9/;Z+EFClavrkz{{AU1<ڽT:=P–7{A'"?Dv7O{$zXJKYDWwzz{To%`pF |t-KL%R-#xDcM4t<+4 YBJud3MWh_{Rce垧9G*y A̸C ϴ[8M4sLs$v ln8[Auw߲-P `GWkaO,!rC3X-_] $Z*hYwt[Yc]9؛XdJҝfhv;/v(1x<5nZO]'|;`.xbXDDЯ'iA̙sMb>ơqN$)L#%8%A8hAhJ̫ƻ :0i |B/ Ci[˳@8VGMzt2Ͱm&Yƥ/o^a·Y8Ҋ~G8L2j H%.J0җ6SSr@(KJS`2)gP'kUC+V i;IQg$AEY+9~N5yd^mqV$ Q0IQ;/X"z4zR,݈Q5Q[b9?Q ȵ.~yg9EFXMH-d#uv%ٸjm\ Be=gd{P;1[j&U3ZuÐnD$el)Cbt kR{^0![S%tbeRe"hI[ZӞUjYZ׾li[[ny[p[\Ur\>ѕt[]^v]~x[^Uz^|[_wЯiKZ[Zo`0m#:N-+_; ^0a i+a+X~|`86u<K8YK>a'@񀇼&-f]b#[y,&kmX03\g-Iv|0s8Un\(ff1|c.78\2keA9ƀs#gEKy%ügr:ўsAUe]jV98N]fW0.Y\gQ3Өݻ[mWm$ڮݵKT׈G=d#=F5=s𭵸m=n2c܁7HEHGHGUGiEkHlHlHkRajXq]zhpklklllnllll|Ҫť֫תששתԮҵH*T8ˌ{̂(b0303G3q\ r0@.hF(mS`O32w4C@g7WTP _0&OXbjbUezTlћ_M}FMgRAЕa=6(.}Á; UYb3ף&m7jlRFZu3~6j iwD#UV/cpő=dqܡmNHBسkΝnj4Fܣ`O q:v~)i'rfp4"_oamfm K8H&( 9lgz'n4P}(۬ mw .YݴN8v,6:06lZv>\r%.ubq=uZo-4PWEeK95)gƚOWDmtP+eD#ED2pm=رlc<5OC#?q&#a\jV%USoƶs߻[ b5_ s"I_`(h: -las~ YD<O&8&4->I S&Ö&Pdc]:bl+JzUlE*L lXfyIBi"mFLbt&0g,8И P _Doz)B'dv \9 Hjs27yii\ SB?eavqnp`SE@'b9 ='ubݭ…OlTE?wRҊӚId¬Q:3)e(% Va%<(SvRcX`lemsLUS\ۄr9{AdAe' 84Nʠ=)d"n,MqH2fR\F-H eΔH!54Rz('#Ӻ١( ND )SDň0B L_B`gNo_˔(%V 5KH%qg We}nq)tӥCu |#73@ʎĵ#YXaˈ.0I}Hˆ3$f'zpe+T)p6TYKBOᗄ0olN>aǾ2zdT"KJ..ŴM+)00%e _ x5 z\f&ؓԙ! ت)b#=S31ǀeߏC&4܁:ya)o"9]xp0㰨JK2}T %AQs:ڋH)$>uKb35;XEE1Wwg}6ocml2^ Z/n2'c[ 4+"GY_$#3S-:!Pa!Y*u8SLRC"{+Y5SIJ^xX Q ?[Q)5.hv*Rx(ka.@1PYLyMiVaxj]2򮁱`Nk:@By;ˑr:Ϧ/fKT!}rXg{+ 6p9#0i R6"N7ՠIfn'I_-_d:CS&k&S p 0ب; wj"'4"|6;C򤚣z`%n'iF[<˫Q!qkxJba:kP`IBMxUi#o*bcd`iˎLhH"}rmqII0"a +@Q)IF pheǠ1nt)#-Oci:s0;pJI p[h;%0^PzD7lt+{ޠkF̳aҡ `/;[7;jF4ޠ 2 k!D96 C}KWfǁ CWcqIy۾1"iY #`P7>vQV0]$@ >@K2mqʰr(&(C9A |0mx@fG>;L-xUY ~ @$Ԉ@lk@7 )yD#!IDuǮ}zoI, 0%~[ +`ڗ,l{72ec"M[(:S0,EEʌ .A >ǰO[SųK|GE`,B&呎 ޫ 2A@ Ylx"ի;a   64]PGk|+q$N$NN}06>'qMc2CyXYp`#P\b+!*>M&Z:;\\-(   V yO՚ ,:jq),<D1M@:]MD xԸ@,?|-u`˒1QǷ~.80]${1W: X ޠ1$"i$QAZJxiIm4 '.=$mBLPfU c}z;:5 M~ غ\w K  py+ӉB4ocrU|-c9Ƴx`{x1,1 "쑘̳P >qh\xYo;Wo6!"Q IDgIgYޗU1[^C63 rAmQ5b[F:t^| ރ"]:9"rPgッ^L ^0K@:I[IKve_3ZO$."캭'Gl77Ի!.zz˂Ew{貳Pyx#LDj#f:(S`&@3 :c=I,^ĘLv\Sd#.!)bE)XQ$fش`,3Ԟa a0ʊv{F-ݰ[03 \|Bul7͝'=+Rg!aӧos7o R@昃60C?.0;ed!*ۋJ~ (畱Gs1o(*](ǖS[X58m)+!įXVOl"UKPel5"N^!Z۳dXf+BV֤X Td,CXp&:Bg, XCΓ && RTAeaIMF, rcZs(2LS_y2K f 2Br&7[cXu.RlB%30'IT2Jd&)DrY2\u0t'gXknhq.z`nkڄڛm5 Gs'k a=0djP*CvB(H| o·9g]gĻ#AWRI?OUS%*wP,|xJ7<)jĢ!U'!P[u[ݎk@ZqmJXnah:FG-X6ݨN< \d ˖bellFrh\Q~N1 G:bbm.OWf b=f +pc t`Aj<0e@ +-4lϦ-xՊ$G=wgn5t^ O Ajb hvjE{,L: uu&QR~5P;C$>kvDqp<!q)W3PG]FSwVC8_j6˴NrQ\Ё-!6d7zp;Xc䮅KY#a<AٲcK'nv[VzU17LssthKڨsmѨ5 4'Bj9i5t?[ ¶!0#`"@,H4[! ۊD蘈 TSR aKq\E<skr *8Ԉ`BzQD/l|$/8t,&/X3p"r $ H9e&*RLôd5s#Qd׸ù1xI,.H"=X 5's63=YI ը*X +<ʻ cb*ʨ1I=;Fˠ<; D"Td> llAtX"h+.hpn,nH3Xth=ȰL(C=͋3e/+z0"! ʆH{a1Ӊ Yh7½YԼ]Ftk \K;DC_l̼R >_. !C+,5䋮VS/lcj#P PhhuhxvHtHjXϹ>s݀1=#AdAj0},eB! ˅P9۸(Bd4\Kݑaʪ0t| R_#I `(`3-㉍:j@A  Xʊ,G2`א(M٣t  2XCXu؂v3Hu]̍Pnzt%ʁʙ[K,ˠ0Й | lX\-e@ 3W ;Č cRԙcN˳DCFdȝN⣷ei}SY} eM))P4W&Ը MpUpܨCɂ/+uYXق, 1 Se| J7yhQx !TˋBʑnI 0J4<˧dJtRBAћBWAmp99(;T,@l8gS]ٖ zD0DC԰7t"%)ˌZ0S\`S]_,MK d3_݃LL_W91* _rHnjb̍HhhH-PVuL$XHuPMUhJv1^ԛ,}\ 3'"n#L#a,Q杭;9~lPSq5(≧Q#aPj$"]upՇ Ȭ9 3ߴ"e]`hMpU* !khpx<ȚЌ؈;|8u؊>u؈J+/Xin&Jگ-rV8Y~5l&< Y~#Ty_8@~a)#%Z=lxuqJ(S q=wQ5*sKst>Xr-/s'-w\~V(d`kEX(iSuc7nc;??dHf䋖؇cdGcFE،ca?vKИ٤`fMn,'lW g!-IQ6n[s6=Ex-su exz'Oi%J1,ӭ ssb߻fdQ-"Y/vm|@=٨,%IU^Cvpng0bEߙXܜk0 Dy {o&,U`8Ѣ.zq[ lK[X0~hnlxS>atH*e‹K3N':A!-1'-gRP7t(] 7#㸣ۊy_QǠ|*!1.&POElK@u%h-`_0d-l/!Qv5TfiWIe-tF9i\#m my"Q; Enb)"1w:[L%1cgRF6P & 7fllb(#K2+uE\QqVиhIdí.1I&)E*,$MVDnx|F=Vrg@D%AQ "@P09Bt0,b{ !bR> h񒉹e-;K%t ACTإ&f 3. wI$iTSӞ7(Aå@o#?I%NɃ(U/-3d?BPp1Ċ~ žaAL'[U*Etx3%K #:OTIBQ5:%┥ldIBVЛ62e~.tR~c { wWHx'#g [UHYh'(ևGALh"&-8Yh6cYhg8Sy L@6 QE,/G ^{LxF㘠 LelA 򒨙`f% BkUǑ.(`%\ bQ&͕w\ܺj$TDGLn9WmQbeMXeJ`Ug|a~yrgEfLQ;.$,iV" )ՑZT t"yc1Fps}J֭(ȋA& A>k&45FBYDҠTBGѝ6$&,r "DHDװ\=Q0e FֆjQ}RqcY ڏqRuh~ 'Ց6'QM\((RaX ~vʓW^dNZ}}-%E](Dd`S`?^E܉&?B2o^aoMd eHa%ǟaڙgOmZ5ǻm)wjq  z4ڪ߳a $}ūY*2\!&pAPE(k]k i #zO„`ՎZ mp\vaޜYrp|)ׄ|d̝HO>=`dCO_/mR~LϹawmpfX`H̢a [T2씵VG_N#עעjA1Gg%Ujw`kf+-&W?`k"X|ߒj,=]ƸL0 UCPɤF*ҡ"v"qxze _cFIe$mߜ%$XI䲙~r$i#KVHх 7  ,nOCz0UU%sKFԋ>h8=fzhFVHteF8@eDOخaX"IiϖoJCHFUO=P*(C$0rO!D_A09Vo}%3wF젮?[]%:G<*,0j@I0qQL[4f2LfҗmQ0#ǵk;vR#KfL.I))oU_E ƼGV;*n-xR#,gZTa[{+;&y'wXr7Fj_`U(S@v5F`΋3`& SG,cg݆NeXЋJldm|*R)ϴ`הow/.pg2Ϛhopea$Lȉ v9Se qEblMMTQJ׭}M=EÚSP,*Gaj.5[ܟnLiwaN@4BN<? zqT}Hz ʔ1B *Q@43&ݷ9+&L| @򈾃L7?HC3 fnQ0Qqꁍ`\R9( <ᎹD%y@'6э7t}9*dGh|HXVqȇaY%ieIl "`7/W)PeEf)5@1Vr AnB|cNP|2C, (8u);vopr|44\)5m[fyTYBcEk})btamYFԣDHA~kJDZ&-6ic/QԨ ssԺo;s$3ȱﴓP$YOqzt@Ei%4&|F<{:`&R ًT@Db)ނ -8hgnfbB*$gqVBYCcrCYs/qdcBU+:%e Z9|E[b&!礣]>*4LN r *P݁H+e ߅+r Ð Wh^$N{3W-JBAjf+sϠn|H\dK2#S!-rDԊӘgPWQ( HGMՐQIs4+D!b "C/6f1$$D7%++l+ȌXuUMUX5Ȋ:f:p:S¯LkPd%fƎ3@l*?G'8z2J)[TVrOu{ك,%$ e.bB34RBr'Adb5T.ĢbRgPaIA6nQ4"~Pk3XeBy4NrF.G)}GF(<¬ZFN:%CqP(4Xi#0PB=2k93vPk ! Ml6vk*r-/`$,:ȦVS ɘqKxbzs?0&iy Q7sdpBIrS%I{XucuSYȚuG5#Z-HvmF- [)r( Fcu?F-yky_q `)ٰM-䄇P`}7wH$7 N_YyOdH]85_ T!z?*td6id@d0.Gr@u@Z'9!p+a'ĥ[!xyY!oA0 Fb58(N4†w8{:u: |U:!*Me 9V/ݢ* e)^jd"# -RegIF*2on1$oxxpAGr32US8fO  ,EX}>žuGpɚ%r!om|v1@!}\Nl9YȧP"'`_K&&wr('CSc{ܙPc9CovaBf~ Gp6z-{&@& yrA3l,x2r8aYdڳgVƍc1#ȑK|h2%H&%:|9@̙Լi3M:BJ1KG|‡,kH`u`%TtTAJUY](υn!Tl6XH"Y\.fD )vYԘ3gw^u y.PdV!NiVVZf>ZņM=7HMG{/3P3grʹP1퉦rf~2Dh>$Y-JD]TF%R)JGPdӁ̅. KKEm ԧ0)U(gXqg09!6Ps,56GGNumf֘^JeKڮfnb6)g9ȃ ]:k%YwvuP-_.'msm\~m `>J|1C&(^yCfgm|Z- 2  ތ,.T7{"VaH/eS!v3?h1EM jF8Xc5Y HTS$B5t]&meh]ꝷ|U*]d!d籑Y3ׁg6we.yԄ^Q,aZ)첫;¦{,ttf9iʟaPjU+<(ED!QB  ""(hSپ1(SEaXpgٍw=EAғR7[!KLےvG/eIF4u/yxs;\SD6@.Kkr1=PL|`6׽YdPL"³耑)[rSrJU:mjU`k~(_T ΄f⊮W"UX=0CR\=g)$| Q7/~8R4ʔk߼v^ܱyLpGAUa.:B 40rC %/0A9 \rGgRG@Cu)+ E,YlØlfyܞFElLYە4UI{F6$)ʭh|_ HPDl| l@Z.EjjS&԰ dަ*^jEѦB`#CK==DMyHF9 I4ECL8ZOFqKzpiv([򎖵hqyePxcK9[b6xSykg<"s;̉&J-nn1{9CmSZ]`jGw ٳ=)!~ lj`*Ӭex@{Є6-Dj֡+"UF: >5lE@ r8(c ǹ%YR2뉟dZnJ [)kXf$1%+y>Eǖ+悡gGvl|<2$UoYאj3;A'^<+RL=q@#z귔3pz55/A{@źylk=K/L"E=]~ j T?O`%.,'g쓀_/1Ću-پ˱l'ܷvy m0rLF=DrMi?ʟ>~  ˣYU$tFGQgPLwTII+ay7yriG G9,WܬE1#D.%F+ rT2&ATh3(ffi6tg@5j:egu̕JQJ]gK. rh>4hT1 @ v3iǔ?Nwi>L4HoXUi,f٥?E(@,?6OքFOi  q[G"zD]3慞l֖;_zJWPms22n,Sam&&U!Hh7n029aJQ7SHU[Vl4̧DQ%Et?4X1ء>F%vVk#vx/]"iPQ2!%m-2RI{I2RCnkc>$|?9~!ҕOc"md\\4!!EbC< c!B~#j!bŊ2VW|XbBoGV%rgeHOx3o4("'_nythXa\(9Fs)v;X;eJ[u};iTHyLQN xVw[ZS8K.+Ӑ/b0sZEՑVv'0zFnC" FaC.n6Q|.b.4&3bGS: IIIpzw`͇4HE 7EiDQF$7bf%l|"xLRQq s8IDxY gח)4zg9K正5kX_sjxV.P#H$x)gkFbNik@4`$|Kz!)m˙fVm ˝r8hi+52X{֘x3,'r9)d$X%4: *"7꟩OYp=#8zx%VJGVV5pGv%"F:{t%j/)8˪hnwȷ{o~l%!4ğXV&{=X[v(ڢfT춀 Lg*Y[J.ÅQx,f څ chƦL̔Ù^hzՂLĻ@?:uҰazvmT,AK`FAa 8j6 a=%ܪ'b9 EKE&눀cF67GTV$ʈLxG\ |PΣFPa9 Mèc%mɈsk Ϛתԣ\Ϊ\꣼ <(NVxdHej*>pv-N[hxò9ͽf ^󴶡ٰ}>= q Ϻ/C*1gk/S9#me͇Y-W67Vq6q;o@5"A:SK#BB` V Ғ܈am܍ɷ}X%s1iVY 8w{eIܿ\g\ߪաSPW{sc/c}.ȄSԡFK2,i<%%~ZU8NpQ5ޜ&i{6aq3,aM !F9#|:'jS&JƽH"h9#]! ]ҋ| 'S"j,!-KasC ^}"BmDݖE}tm"12M ~#ZMewh䫓9(_2< ا !. i$uیo࿅ ^\qǕ&ys N!u[f^Ya)/'?yvџ7_9a<*Te+0ß`Ɋn+O=D= \c)wBYKϝgADoAK1=ѻ.WDQyq+FS`&e("壦 2frR&(goJ*GQ+$KӤŒhL3"6Z)C:RiN:]BN<.N=30 42ʄl2F)3'4 ]z.l0eAPP uVbQS76ӜrUlIXDŽ U=s7nCF3ݬ39׹p}n8tK7#ueW;$S^N:w!(ŋ/=BtG(c|d:LBT413FAl(TxJP4d0Sc[eUbz)'cQy r2VIaiLi*zZL$6 躈4-l\ΉNPJ$<뵻څ.( ڜzp꬛•eV 'u>a+5U@h |-PIe ZO%0R'LuWwJ$%֬BiϔaVҪxh{ժR)5ըw{]^yս>U||/&Tzj,m I~#= Bf? e1֢9pe.zGw{_+5>te'}1>k}!,(eE"&}n&&e3t(/005 *f D †ߞ nb_`1!SKSX H LS]6&;HX䑣g:%Oilֶ.ϔ*j.\9C_Iٗv ?P# |$C*=GR (c'>uK:8A}eD-Xa6/Aa|BK3i8Cpt4]SD%$ZS(ugiݺu;p$2c8e si jf2!7%.ƙ:^}A3M*Tr$y΂Ȗ`Z]Ց2kxevȩprZRugIv^ڀ֊|s}X,:Xs>,dPCI`.Yєx3w-QZ~ G -1ѩO C WRթ0MQի \Un[TV Ƣx0*׸rZȆkG[{ŗ` Xg:TP100"Xl?UCa0vV}R^Ot=Z7U|*|/@4Sù  XپMG#䛐434_#NIF<|M5+aB H Fb:(@NQ%0Omۥdϫ,J E,K &P>"4t,!$P'E uK{Z8T5urvĚɈjy$5{=~TH-L3(BϤAA#;a;̈́>&:,*v:t{9iͳXҍԉb jLG 5*-#o DIgiI*?;)s+L9DX6JV@@ D48AZ "KJHMOu|Nt42HL !z.w,.I,%#+"5)è.LMlk"Wm@UR8?t#.ERjG'My a\o\VV)ݺ2IL3M?NY$ zu;|DT9c3R,X jY؃2qCO}i 'XOXM'L ѴPeB M QvdG˻4](وUYB((>-M[4MaeWeR 5/e?¯q^DRAV[c|p9-"K*2)6%ʗ{?D̤ӵS;T;%DXh>}\M3LH8\,ԢT]8q|PKU:)K(O],ʊ݈#.WmZԬ=Q܈34`^mZZ=^4\Y8:x8I&\i@Z֚mo[Ix*a+^w"ܩY+N\Y=WWͫ=YqE]$1eY~F܉xE= "əDIm Q eŕPua :WU={Q2\\'[.WWb^~iAb~ozD$Vm;N-nJ0(5%ʷ)eC9"[}S ;@dS5\Ff SBF KҥR HBڑm=*"(Hߢ%tL~Q{iZF@߷WBbfT>,*F' .ڢM^s2eE#U[ NEg6.Cؚ5`G&ɭULA.sP=H2T`:=NAn`0L(IOB'Utt,e)|\]c#b%^#6^]uחB̛Q{b,RYXK:=$EKDB}j~t5iWQ<[=&Mcۿ-:!dƫgŽg* MZdnd{eh֙|s՝$|A4 EL3B>@}aQ]ƞ~ Q9ݽ8-i` Dž|^[C6ZcFf+C^39b}@0$=D$gwu.uv~S-y~vOwife.>s"nٳi*(}oz=bE=Xi`.A鬎vko.bš^Zix`:Faڛnӂ?i9:<ȱ9UW4_:IkQk|FXy4n>1Re񪄯n8~]RhXvuB~!Ue+eX=,n1m_>)U8 oJ17ub.d>(t^wt=SV)Tl@%I1rmksK1f at=vü#uT i &XNi&z$) #2T 7f^m jv0|pꮶu:1g shqBJlcgxf@=\h4wˋkVK/W.x>x6avl &-wՃxu-"3x^؉$mW4ֶee>sXCnL720_61Pw䦫rt>V2C"M.٧n^{WCVӁOYɄ?hO1 ";KNSx.3rZg#/n np~@y)Fzǟ}(X; o=v=^99sp7tsw\tA;;pم |~t5t$_$7?&|L)J&ru3ru\o0ϬQs;GJQ>&jy l|CaG|(ʩ}0G  "<0Y g 3 Z\H1#Ã~H0$ɑOJrH[L2Y"eԔ)Xʢ,MR{*I)U3W^UyuMF;K,ٮck3,ډ r)xF-ϱkzͻvoڪ,cLaP EX=#xs]̬93+9'閦_nNiծ5c~-@0L(SC,GG3pK{GD8D_bز!b/2vٙ@o+{So)ܺ˅; !Q TJQXUiّ_&dmoIT#nX"u+HUVmW2~uTY4ƈY8#\)PMPQ2(E>&z|]j0=Lp]pfQV ) W[P%xPT2fnCCLPz`#6| b[8>|Wپi UGL#SLNlsǃGb3S xZ#ё A=gT$IMl@z+#5=Ws5=`3''9Im[ #PN e) XbF  4ņgCۍЂ&)5̑RxR:n[QTN"bk% o I>U8U*ZЌ[n|4Wۜޱ>ǎ M{zh9JꌖGY(+ %Sċ.bI\O!`wȄYC_a݌sޤIћMAf)EDt. ѡbvԨ2^[\vԨr}F1wkg7ăF*y6v즠:>-f3I (ðA#z@ȇj7eS-d>)\}*' `qU|Dئ7aEN@v<.T5)㓂7Tʹ%y QbefNfרs~̥e4s'YM"ݼw%uNoj@~J28d2 T&t&43 u10.𜅊qRV/5rc7Q BYa)_+)}ٺ-" *‡q=ʏӓ 167;I7A8tFIao}Nz*.V1d/7v_W-G{`X}fuaqȝ-Q\`@X͘x![nَ!=O0  J^n]ՉP]ӐQURx]q` Pz[o_dP LtȓL QLJLmDKLf9!%֝2^ E`9dIe]R  ի8LAxH.4UV% Y=e[ xr`5&"ZϺQ6ZMe5}WmEL0=W¹\fM`\~X|X#)c5ڟ35Z4XIavQHUT&mPC5RRVbMedOm@Czm5P$:bEbN )ѥ)P%,bK *&Fa}(4yF&Y`^ʜXJ"Wa?iL/fМ[r(|*ŏ;ߞgdL#mje#b.ߥ8 gpȍ!}^9:Z^v%E>d=BF&ι$A _}Bfv gFH\7b]f?ITo4J߼aObh!} `ņraS܃ އncPgHU Ia\6x9(!Ix衖AlI-`9]Zi^b{Jv$bn0)c N-Ђa$7 hn_iݼd)1`yS<:~mt4>ҹ<1&':bGf25c+9cn(Ihhj\]e ABCʋQD[$RE&1u{}vFg.ݞ "=CaIb+$OY@ƱUdԋD|Dƹ6_+eZk^!ZTԋh΂恔bemxIǁlՂ~iNgr\)F]jl]nHfil_Z`E~&&uG,: *"kHlD"-~5t{靎a]<&-=՗+&\` F#+Ĥl8rq#DX8Bxmgcjb z*L*"i8ZA LLFCD Ҳ Tֲ} +$ҨWHeZj뵢{DY2ƹ\R]\E`nTrkCe.r-&MJĨxi"'aΥx`OZ>m_ Ǣ]oE-M ^eBbܚ(i>F[8+=#jӗ $2ss2*c oB!_;Ig ܩHlZj'!ؚK6-1j:jqXPPЀT)9XuDp*i׈ibALj8K܄!Hhk&+m#Yf-~*gήkrgC挓E\,*~Jyd_4EO* .߳*"3%C\U֩iVhTF`js n*Bs}{\RpÈ h l(席 p>'>cWj j4D0v[N$lV/z% +TG$2 .sљ 'oƜ+pN2ǽ"G fkb̪c#zI὆(#\ 3:SMi9jjpLx iA˚F[ot-J]-Ϩ}ƒ4I;zI8q8-ӴftEߘm~O!mrs#1^/Snj۔@3 FTqm([9'M1-sێUNsg _uBUQkL"RL߷Ky|.AKM-;EI7^Sk; Ԗ%$w-:LB;Cd4>Yqb+kW- p˯5;5-Sw\v8.N -:tix撣sc)cHj&y.Ƕ3o+=C6׺|)*!3 \<[h(^xoC#YuKbnvc !޸9%tϣc[Ť9Iuy /owyzQZ=[@&SGho[| ٷCKm &z{̋$.{En{c7+ݵ\!ΛOdJC;;D*:u~|:;Rr򒭧Xus?lv:髳T׻cǻuܣ<>|4D?0ͫA WYi+,ws7!*ۃr fF̖u7;R(el+Z=t13g2HpOCPXEVdF!IXɇfX!2eL WL%΄, !PA 5O6t*ƨE ]YS[^Uί^:-L6=q b[m+QCn?|p]vbǥbKXrfѕm4-V1VvZg׳SLM g96iٮk =pNjܜ6sĿr!v^lZŗ'ƤHD>eV/JqU Y־ JK,LRA -0 ݢ =찰 =\¶L41Dp%rqBz(tk$\rG29[E#>-'>0;x2j+P 5]MҚSJls>at.,2k4N[DO1KQUndtҌd֖zZ4߬ۉ5&qu,]-\3W}$=蠵R6|v] k;U/d$pz5͕x"!]z"|tt~Qtm2I+Đ?$C>bJ/ŇPZ O17NP_Uֱ\ȍm mɪ8+u]Fi̢N֣_Ѩow$ԄϬgM@ x벱vѼR# /StH4jVmV&BZ6كU`6ʞuedv/`CAy']+Gv~Zpm@Vzݝ<FpYL sƮ 7_m3¶wTYcy}ݯ0q0t> y:[O7VdƲ&(,,: X h>UzG;F0f{}"D6IX eZa e6 j ᆘ".Vd>&m[ӓ Nv qg=yKW!JeE^eJDĹq\@$n58Q薥3Չ>|YoIJHs%܊Ox&)][3eu^(T:Г',wma"2H "e4E1*L/˴+%4I͌\3vє=:ɏ Jn(M8wę!$`ufHI{{~5BD?')5yi/aWZFˠ:L( *}\\ ~x zosbH!c-2KݪU-f548ӊJc8#g2[\!O7;rvJQU͓5rCz+Jj09X(k1`g"/#R4*u ٹs-jhC@xJ_CL\[䚄Y;O7ǣgs穞vK2D=iaAmVŵ^e6 OPlg?і]mk_mo]nsVnw]o{o ^p Wp?)^q_9q!oȗv<%7yəre$Ga76QNs>9?^2ʉt:w6ωVz]C_zصn]eh}nOً^eWNw73oy՟}K;t?Nw{I'y9xSu=ct|sϽ>x~|9 zcgV`RK-рR ( J 4ւ<рZ-MՓF-xmb"CaEQvbukvb׀ QH!\r ڤJ_ssD `V>5TF!nEd0XhuVbV`ɆCPITY+Zm}AWo laЮ`'hZ4@`D:jA hRoQSZ7}fܻc(=$Hr[M=!;UqfXi/饗C6 /#8lݜfɞs-/f;֙|EbXԦ~> J-&]4g` e@Nx!>IՆ/z ]|øK$K6b_;(ϡILHDӂ%H~]Ԣ)8Yf(U}GS\] pYϥށif D@4jqu8.I\V%QH)Im]h؊[;a"FLQn*5$eW9bL8n#deC\l+o0y.J9p a^\r/5}a|J`:@p@rH>$|҈pfXYhTux !r^ZN 8B[)48$+↿;e EV9F9 K#=IB;*#u1dwj}P5BLoY×DD'ZXHkAÁ@-pu|!1ga޼RY^xqvI/t[lT*+%Q"+&(C I݊VJNtC0*kV<-, XgmBUoaE0Rt8;"{ ljɣň Pu0 ICF%P0A$|tQ2h(c)Vfv(A=_\ʕth8Q1%N.!4&&pU _Hs 7*ٲtWn GuQHV%=QbI]2qh"N8[νnQQ# r: ?a:@a$|-F"0&D,,T0WT;2 '9nq_F/NWF6&!YԼ~Aۨha8yiNuq #hxG.@4lU.> 6@ڜ7,dnz  UUP: 0Db{0}T!o ujT-cLa':W\bdIKJ(gj嘄V#.s:Sz(/)h#%EBB4']+ĠQ4PA'1;}d(ε03,2i$)0ic NT@LBIJ) 4֐C&[JڴN1 tR/\*4FR;sR&Ro23nJ$qMaQğŕ09HrfBC;%4eע!߲uMB7[S{^ 0VЁճB"" + TAC4CD՗lQ&A1[4+BbEbc8,Q$ScFЏE}3\hd)ymjsf%%AdۅˊLtY\@fGUu_1gI@q44C#s(E$>)e%я~4KkiK_dh/(P:SԦ.un.4^hR%a\c_E`@\[R ӥk\AZn?p Hߊo>1(_7z-4 yCYܗ#p @ sS݄,SC{B#aАA9T&0/|/nqS2>b%4M[Mu! )[QX 툪VVy4+ʻRla@sy5eѰT ;C?CKѵ;EOtg8F'@"CfHB11!{vd, @K6TP;0Xgf cZVc1Y&ur-Gy V UjDwu*o!.\^G̡M"+ eAflנ]FA0 AT@ Ah H'+8\Dz1h,)Ef!&0 1. :2(#R'!уH{+*iKa0.DYu[Ac0m٣@};)PAx 汚 ꧮ0SwD:< RxAA8< !@!9cRBh3$]iwA&wk۱ ({Adpzdcи"1!2@,qGr"MB0ɵ5+O20$^ @ q閳=<ݹsd#Ԃ96T7FT"d9`HK 恽1KH[+kT.RhkFPG $k(XhQ|9HU7"@nѰY{0 pZ9:06n!r= K/D_D1 N;OK„j ? .&lĀ wIfsu+kVbA^;ڽjJCl,r \hĐ F@a;@ ͓WCd"G:Eq!Ǎwɖ 0qirAYcYh:ZY;95߅#kQNJKReѐF U6'OqI)+<  01`P@oyBd"af'ht'*T{G90: L*"聵# Zi8eP1נaz3Dcg,9CPJ~.DgfPh)1) G\X@KjZА~\rL^ʔF(Yw,>J J`KPOΥ`Na?U~k!-`F{4PaAEq@A *gje"P$+>Ok#F uU_ R5>wX<383K[`7_pq܏R7JR^<:AC H= (uҩ)}&xiQA$$isU$]"PNN*FPxlZ<a'V|g$a|EfJ|f|yϡ݊XqH?ulЄ{B#R[}z=_} ~3{zKd`F)2QhX;9cFۍ[~̞wɔvv'u@4䥏#?P^+c;(ocWT(adB;T|P!Ç ~A%! i|RHLDƿ&\wL,[N2I 9\ؙR4EZF44:`Zj,cV^Ѻ*:8* ~TB Ss펅T\4X%{&ĈbVFR)$FL0ɮ9P:칯X%#^jJHӏJ:ER΂Qx` ;~8\;W#bV呢VZgQi*D:t>~g!l HH *\1h@;(|Dž-h rb$ hb D6XQ+^4B!*jCtyr 밭#S«M<04ʄ2 03D ! pT$(2B1O?$STZO:⢲P될)bSS4{k3HY"deˡTU !UG! ǃ8Ta= e(XFTP*Vhu$r.klh[iH>hlp Q_Ltr1hDޜZlW(ՒFXJZS^2*94Cj$ u)4+/x(!-/2S^B*WZNM49L17d3@ wcmdfCz: .8}S4¿Ϻ6l={~EYU ﺷfմs= w8 AeqXEiN NY(*6 ݈$dJ;N("CϏJ7s331VR6bT*MgSPq6*2N.KYjPky*=yO?jh,{86@D^.5!{z+FU0Cb oN IB!X B .NaDB'' ؜I"$ ,áH[pR 5JSV $f0IrstlGkR bfZ1>aYfv(-,8Y_8t#DKY&gH,Btd-9G5Y4Z)"%(Ai/,CROYYa MBLLjSU)Ð{2N4dEAT3Mr| 2]LbD3XŽE6Xa|eL`5 |#SpY"tL- sȃ tݦ# 7|cJX1 ѨbjT0b#xa^ q1]L 5T%'5yI(VSpk~-qe؈ I5dnX^gd9r+ K.,,K!s%hO}uBc,qSR/˹.$aJF*PL5ŵXG䣁ªzlG 8ŖN퐙,rC6y kiQQ<%m)p\^.zYLۡ@V(g$t(/.Ҥ W[;Iօz8w'^sק Ǥ;Ew"6_`ԧKK@rD폢[| אQ#xK8C+F _P )~Qfh˂޼;:s&*)rSƂ(4Rfa{%%lkɤ[ qFav2>Mˢ͛֯iX*P0hcnx\麍16>)Yib*şo,-{a]80Iir>92%عҕJTͻc;Z &0%!j0`E1 #r[+6hh9EX# ީ7>XQ=Iɬ4=SZ _BI'DA>:$ 3 rI ;37I!وR(cr j.0KA PЕL--4C@n$I"tU'mz!2a12(~h~M̕hzd"Z,-=yĒAOx4.' h ӴڍiҝC񊴛ٽ<MtNK-,,DJ] N>~K=RMPdG*5+@> yGCbl5 ;OZΌ9h9M[ CXYj +xȿiiB#.8H2pW 0|LȊhxMeRm-R30a8+B 5(CR']ZQ֑R㌏HYGs=<~)éG3㔬xZ0:dIK|A-LG*TX,| }0{0EWjͫsI+W: +lPlHK;1PV*=C% 1*K\#3,\J5CzׇM\ ]DJWQ>H[QB+;~۫J[ XNLW[IJn?gp̬h_#1 M֨Ӱ #T-;P']ppz4Z̄C-38Q;1}#qJIe$H& !7==:x;1-,-3m2* \ [_8~i@ =闈xUC[}X}XO+itg@V9:ER 9-3WݩtV;;'kO, IREa{j.y9=US*KlO3hZ.㡽 \/5j HTOS"=20c. )_,5铋R-P#SzQVҔ/I!~ B?G.B؁sdNMؐ]dlS-ьʍMipΓsZף4nlhOZztX3]{_W @VЇtH* 5,ԉ-yC#_ć^\reLygoZ uUׄݺ"Gysju9:8_ܨ.Q_8eo"\H1' 8 j6&[Sؘ}^Fj^0X@^u q$(VC!Rl߻μگnӴ YYyj3ja/aĵ\Z[tFzEWFYЭ OLeg8y熩dPUq9]Yy2m|khШC W[NJ9H{%#*"jb4JhaX‡!"#7,ڵtX `- !X<8":unOh2sF4bL!å -fTf\G^ HkJp](۷*(mt/KR 0R*0bV ѱOꄬR4rp~&]Wh3nx^ʼng#ضbJFp^ɂ+.S.A+*x.:]Q1]"AQ9lD4ԢpEhtRڡ.C}Րai6P&me5DK%WG`Sφ،(]""DuYPug\q4؆ЋI#t#*6GNJ7dIFE+Xz|-N;SNYIד $PT!UQV"5F>MY%LH1#ŋM>TzQ1gsJg VA]!bJ(PLhP-fZ=e؜`6TDunu=# բuҐ3PrZ6uhVFə2C&$nPB瞽ySY 6`MF&Jђ!Ζ~ PɵB|kQ Ň֪՜ _E)]| '^fG7K<F(< ċx]ZnC1~,'b9eaq-XǛcd=Wn7SRcbYzN$ԂY]Jb!z˭bQQGhfs"KbDYj0w[[ڧN IV6+ՙUnʛ fIlUITTC:tEy&FZhEclYP51GxpiǑ]dffwD^g؄:m)K,XU(@^䤄'heW-ll@>_('2\ƓvgsQ>3]<\dʼ$ȯQ >W G0?.2̪PTMT[axB:n%1H2 M y6~7,6=r9ś^FO7N!HQ}#m{J%>9,ٙ$?0˹$&7r/C:C-́!:LP)괨*}dof=_:`>\yBͲ%-# 4jYt&zQNjneCFD:|˥DY5Dš*K:{}`ڂ^p jc`9SF.P+A{Blh|̙U| c_.M[0&g8ֽFa܈],*YqCePiuqLe(hՖH2uMXT .KNmacmvIMZhי[MXr K +K"EqCLęye9Ӱ9c.l+^TuH&ϼ{J݆3xehX2!}«uX@SAGѐ0iBPַDA^5}{@ĺc$G6!ZPʂlD$HQМ|ҷ ӌtѸG E ḀØiPN WDGTʽ`W MYIQX=_`AА nD7ΘʵDC NrXfY%bPeXHZGL$RUJyd˺IhY%x5ްpHj`4hF`,iH^fd[؍E]l fdE]C/:0zyцrxTްDK(jexVȧ`WPk ftVuC 񖷜c5m HL5& KEN&„zN=WE6Yܰ _U i~އ$02ѿIcT*Z0m~Iuj_ح//Df$)U`ga֬!2Fp}/q8ǿg RE̜+`c,afږzg&}f3oLQ 2Va d`]uˠ 5mf!XgR"EqqVh}5,IE`F`, mƾh3I,iƇKu˅S6ONIļʘhٷ0hD-|H~e*HQڝ\D6Kvp6m-YGQS\Ҧ)VQ~3h:܁XDz?-`]4rR'v"B fp'wL&6MKZԭe&sEl[p#etjHx5`KV1~D޴JG`Q(M$;*X[rK#ȵAr$Vx$'"ZcFJO" EVjz:ݗ !F^OE-ί¨#(B@Л΅ Ϛ"toąahirYA4>f d2 1 )Ԣr  U"ypJkp𒝽LLԄT w$ W,^^`.1 |u, pP+gnpK*L`_MNn1m\8G*WFYzt^?\.y9Xx8JxYV_xNa[)gi+F~,SfQĵ+_2 F/W"E&$ IKNW6W*h_DUH/$Tu#!~/tUY 5 JrX˛:T_ sr!+EqUHP7dpEbЕ zsTǡ)8#GjB/SHOֺBL-j+9v\$p 846%p ōרG.g`cgAΑ99FjxFz$ l{̋r䔵H7 bA96FUZNdO!K] f}'9fϠ'tRsCsG.T6?JSouIR!KWeDY5ޯH}z#7&w?Jm$;. TFS!ODta>a3yE{yU_|EkL)'%Z x罂 mX*s .a##sИtEz! Y3z%;lV8o~ Edr #A|",ڴŋ>)`D'gdJC_[Hp}EY:5| ߑ%_ID6d(jڛ9uhIXUᐆk M~ӁGWa{zOU:z?@ԡQG ZjՅZʔaSm"D@#FA~1FhND@<.4p dNOa$!P=qBLK(єԁ@ PE Y^jU.ᔁRaLK3o_UJI&%280,}h2QA92xѻ 5jzs̸T? a?H\?z蹸jF&xA(', Ad$ N\ É*4j0襕JG4&` NI+? ȏr 3 ʪDP?X)1Tɤ.\ †,,t9;)H"nlI@[*P3 C$O~3z,Zl H LATvrmCVT""(r P:IqIDZ5"OX颋Jl0NbDtp6 z2 'j͜*%gܨIX7[ v9ކay3R{e%h&`:;{~kWwV"S/@qh%J?HI@'PfgY@%i<éγjq(C{hE\qq7N)ElЩ5+˘;506^>J'(䑆khL%0Z),In*Zg4В+^os[pPX!^p(TsB7sDAg &I+kԳ|Z&AeeB +qZdU .CRϵ/,v^Z%Mo#z ją`$h5eq/&, SqMì eq 'CZx/,o T&& A zrXo(e=Nl=Rr.,Dh]8\f;-H4";,ـF3!l0Y[N-CM3ڸ:љt/jV=*)-EP-FT$^`>Pm)H+QŅ&+ 0F ]V?O >49DFC& \I/I*Pc g9mP#ӍN&΅hOn@ڍMaIT Z^"55ḌIë9OFS ʎBOC<~MWJzRB>(~)#syM=$|HO\Ӭ$5ËI ԒOPXe|UXQrb Q#S T5gFeu|ŋX4\@$'r?T'.Kc8fůuS8 j"S L#DX{R&Ĕ9UR4f/ݸU PqT&vf5K ibɯf>slᾭ.=r$ˆ+chYd 2PB˚}]Q*!Ghqꁧz\]$Kpo[#zp<l/1@Ƒ  ';HE%o*wq\I\;hiw`(T-[]a{"C.BF"߃n'a0\h-*"'(ZL0J D.y$nI8'&IGjImƋad N^|L鄼)ԣ ĕV3%? L BF< gDpKK >@Z^&SvmR-SJET5S:,,n:6ʊ߼Xd F(ܞ_zBfdrbfPcCno/co%])x9&n.f=愱)~T$ }C(! RVkBTKW~e0I*)`fʔHI ?3jJ Me6[k>X1̀(sP j2MW>g-VҢ'_B`t,DnMXQ5d@'0Wl%)`64Kk4E.557Ss}1"`BO3_$FoQ-0bb,׶6EL uTE"~ƥ\'ѬR)i6!X2.Hg "a6&'b^SNE#k"@_])&~_16(J:hTF2$paD."*CdkcGdgrd+5|di_#ńD~c E2a.զnVCg%9tċ#FIV'^fN1 JVeJ;F4?LҤ-6Twf&Z 6>4VNa6JBnv!6CzU&.q`H愝NQ07uQzs?gG!8O{bRD}C^3RUFw3k)8س:ey0/Q[͌tiY>e0B> P4"2rn^ x|n͗,M+$o㷛ך "Ckp&gR!!Npnic=dKNzBFC~"V".KV(::~#Ix ΢! ԖgʮgFY,NJ^er8K0fJ`jfΰCK% 7#_g->5H|xvr BnROO:WnvUT\mVq2ഋ ԚS y;SSNsJ 6@xvDdzi)4b5_1wu(G}[bu9jC6M]=yډ )> u.П{]y!/o!NB`@C yjt` X`=_H_,(Ĝ}dXBkWbQ݁_j!8)J\!\!&&٤'KX F#o)/8Cڇoxb4̠&<\7+{=Qb(|>ƚr9݉*UŷI;F]| OgMBZe@ɋ:SzZSrW]R!EZH:x_ w$^Lh!(yPFnōuEUvuR|3&YDɗ7&=khS.򜂴O0ԓ9q-_^A=絵{Y=]e2UT4V,2=@nS{k 2?]|Ήp+h]slo۫ܗx5=0F֐# ;>t&2D@b03!3k-(Q/U qXۺ9sá\f̬א"KgJ|qP~khkC5Ysu2H#%Cswc |"\paw0!BlhaDl X0Eex2:4DdH4*EեVF^yhSMeq2Vh@u!LcFPh.FH ŁQ!C\*A`Ú ۦ:kA)a ͦh2չ.Fyiҭຄ-JptFl%+3*{#QyJ:h=M4ԥ[~M2iiv]Zlh@^;x޾u}7/}VWNؤs"y*mlkT T$pp;~g)aY + ά`Iӂ&hv {_\q`ywtY+^LףԣO80[2\!If/vNƨe=QטYǘene48i]!mZ'1i䇇T+MZRUXa%CQfDooJ% yHF PEղa+fqJV >eU=h5BUR]w}dXbj {cҭLLi:bŅ0oTK` לb$~l ]Ђl@Q$FsrLEn C |?J6m ے"hD 0B]4 g,bPt,(i!*65^dB5?F`T֭%):rX%@]RB@o|S489)L.8@E{`'ĕ$](R+=z(Rz̪ ІzɔZDÉP$,v;QҎ4iKmj&9ZT  4R"ԍbHG77wNlA% |KS O3pA W<9.%%-GI;Ap$d>xt,H-JaMR2t;2BQP(*E9 btJKyaQ6%bX\̊P=;]oEK8YiSE CƜ84ȘuOpg]Ĥ#OdB.6'@[4TB!zA2t]v>hji )9@#C=EJHt[D #dd;R$DP,2aJ]F#b"[D Y jhQq$]aݪ)x$|J#/pe[! 8F&wLqS%K'P++Jjze( >VmEB)#h`kI,Q<:ŵX.[V괜; 蛌Ц,{,mKU kWISQ(S w ` DIXF_,%sb' 0JF/4zl`@;xtD/g~Kf{&pQT \i7Åڿ FbWvYcIY@D3lm$aOnWsNn1,ZX"NL),\<5W1a.rF,4e/kžv;m:hEڅ# & uvMr{л}dhYtȥIv]1\sFį5g8 _Y;b -,,XU(Tx `zt(L3y6bjTȢ9F XhZ'e싍CFc8Cz>ZFVn9 3w_nJzg1UA9ntSi8Z#F)u!Mt=d=rvR)1`m6NQw?v-EwqWG&Ql– 5*|u_:l6lQAA s Tm+2dRh`J@EgzEMoUC?No5-PBR4To`mq|WT QЁ3v /R}Uؗq'VtZ}#!7pH~8GH@1g~3'&3XсicQCF+r tዟgP)UQ)UOqq*=i(ыCv=l'\j(Y B'v1iG](^1x,-/-hxN83xd~h?yAycYlz!!/BAķEА',&j v$R]YHf%XwO"3IM{ MҤvjed9it(ku]TKkRx.d/8;;uy@C<Y9IiOtu\D1. `1vlSaom8DW|2EfwϩTpj'1qTYSi)6vrBgոX\]l8\X8gJ.PrNx]A^>('(7[̶A Da(Y9 m)yOd\r,2Qs?Cm2fms+xBhQY4TXvTX|u 1R6kWdC xhWHmHoeJ8F4_'$*3hF9g(k14r-Τ(A=ф{&v)[ J_0Tt5)\YAz[ڍ:e(u'9ĤR'1XOJTURW 0Y~{ nB#R~hY`yv rFΕ7|"KIzIp!zɗ22zY$UB:J_dɩ>kc2BrEeH$)VIW(Gl87TW2yc[D-?5uh4R55ٛߪ[5<ŬJn\Ӻ2zv,¢gqvf'Mε(8]Iw-AxI7PFXx֥Rczb2PuK50q4 nA{6ԛrTfS)~:DUzrȒoټ6@TP\-51թޗ$GHPirLiW['MGS~Sxv2<<:zbBcjBB l:}ɗ$,H!?@ 'YYMxܷhGJ@w14JcJT(&/ OAk(iNAkOJ\Z$o)%Ah62wW 7f.- BCM<u, NCk|jw1Q7զD£80 dzIYVfrr'Ws2\IV[mȓsN\]3̎j(Vگ79B"jAD dc?4,зR2DTRL"CͼjpЙVGZ{X"34A뱓q.<4Ȉ|ȍWa8=0-\}&@b C|]22v^Q±̡UM̪ 2Lg[ ,-*1*[ Ju4ZlnؕW5 Xr!>BPum8"$VR٫;CIM SZ|ExGe1So iK&- L޲M i02Z3q/DFq]Kh@Y&''FH|/sDsdSӔtJna%'y+# 1T0~JZ4EֈEW,di6Ga[dIkጩ]FO0 I;؅]$Al(l_a`BDg!2oʙEO9J%&D'ͼ͜uHQ%<< x"?{%i$=ݔ 9'X Cɰ+Lnu-L?lb1v,sD:g? WL(NeKw 6z>@>u빎lnTa,_0sVEƟb ] }F\)t&KVZ_5@/Ǥ f#{]5hn}9c7(46"z>ƒ= \cy+i޼W*Md[h-@Ʌ5<$ZqsfL/s"6'ŃQټ\{KVj)sW`z*LXoÆ6b:l BܸbZX(eu` lHeØ991Ϙ Ykȑ4T-N+:Uƪ((%hAJW^Ţ+VYdѰbVmٷjzF4hp߾{ݫW0`ćfaǑ!\ʄ)sg}EȤihfk-YbsiKUр"6o4Efū)ׯ?NH6L׮:ғ)r;ER̽|y֥C={^p]N/r0@%{4$4*B {B2Ip7;C K$DKW|E_DqgtqDs|l(c?r :PR"T6&[j%RF 8@Jl"j"pMQƨ g 5ԓ&>> %"9E+P8Ԫl@^ʫ#QOkԸJ,QS%F⋳0X q2]-s3`v ;,¾ 6Zێ:Zj+mC O3\sM:Z.]N}_ԭZ@yc +8j.ϩoꂕ u ;06vP., DcLYƕ[nq]K?yg^%"+:s"'Dz֮ZN:PJ+"h"k{i"4-#1駮(wIi)QbjZDqȸ iNV,UE,ӼTrKLhAV{%=+W4ϩ]NZґht'0?V6 +PrիG\sNR.7Phw[_zW]nznةxbI~d%u+r "ɨF2CYo4&0*{Ѐ3 +h>u"bRSLHME˒Ʋ!d_zM1 $hnr(h+šO2TUp?+R6'e0lR$E"SUTBW1U .S+u?YG@uLъwbl7-(dIv'en0 $_!{6hC`=KEp 2Ȇ-,:m@ Xa? 2!Q&8L L&bMose|$qrJ;J;?$0ewQ2٠0mQd!cbp;WMdQGqD5(*'}J&`K"o(a)$hlS+UV -T2}cM)pEs |*qt|4$ H .EQ?F9у6c–'5Y!m@H]FY[+uVĵ9ckCrOb JW9ُbafEd-[JP|7=k jp=RdHnP݊дFm&D=)F!lZBYIS& m f2Sq P1,tYEخƸ!3%TcA+(˓HH9 Z^p3>EaE?29Ö!\.4 Hj,twxADC/SFdc:2s:;-ǤD?V #;BIotJX 찼c򈻩X瘫Y+|6A%".ˢ11+i Fjb 8 0 2 {BL묠sG+ {9Y=؄"K.|͑te B!K$ ĝ DͩML+D"PZ4/4ʬH>tD+5\Iz8 ϨD =E|꺦: dŢ XjQ b Pj\A,;chހµE$@2(tT=sL=As|4F/2Q#}Z 4l3L!I aJR4 ҡF\dRJI-=O[9Q/ũT??6E DX5U0]4'T0WO,YJ;` %\EKJ [٨ĤK'=pP`Ʋ ޻hQT>ka+ 'tt&SaxObQ[]")\%Q8׋%LǓ'RCBT"u))(iNimV. "*M VP-IwjHΙ8-Kl'LM/{{*<G:U*S|;Lµb?m@)^+Z :1YЪ Ou1] a ,t13Z(d]P$30O:Lͬet=1[G ̀уǣ5E6y،Z XT!pZ C+H,D2m{[HI.5ٹR!ӹ5:SH6/;(\=S ",%\*;$hJ ~!KuJ M|@}]؝IYyD~UdL]"'UeYZ^G~Ǥ5UQFQ>۬lM(B4a7(ZXԁ,R}MjټtLB»Dx9}S?N9WM{?L0S<5% jr=F>E@P#&QjH;]1PT )c%mPKLu %-{Lb\-9LBJ_Y5օ[ѽ徠7[_MZ[7"c4A8M 9FCͼ-ڼu[ҷ=C#`9ӻBɿu5Eܢ``SԉG vdJ̐\Pv 5OzE5ݑT5jy9l۷\^^e_7`Uݼ"u e$E.lg/-_嬻 .8_4RZrVcA+aN+e Τ x55P d|nnD: {կaU\ f Wܼۏ/! M X` otbUcF&N#b;FbivLiՋC: \u_4N4w.=k,yN?۬c44.[ DӽEdӟ##;]JH9uf@d"$dkGK| A ƽFSє5Sf^^ޗF[UQ/iΠ՞8}8`fu@~/.f?C:cDBĊgseWKi=nj1F`>|)Z OOiŸVimcGhSO#* M`LNS<|$fC^ol-Z&Fb%VĽ*mx Z n-͗L0AcNk.=rg d3ދ[d\1d?d-om֌f/ɸO?bi@nlXm_*lӐ57mdι*UjpԖL&r>jm m B2+LgߗSn){~:vW^6h8]qJ70dvLh#kPȥt^Jm[Җ i^pL&&Gs~GKm5_i_YgNCgnXg chvn}?h亀q`ikrRӼSо6tKkMk*r?o>p .\gSro< n V'[,K99$bC++u"ɄqM%o$b/s2@wMΪvw&WAr Wz:7QSMOYNb=s!D{koF S&^W{lfb"Ѳ>|9mfDm6Y|5M8C;V';vmvjSOz6?57qn4ݣ\'wqXKx&$H`ڳ_FWɹ05Sl"|x~+r GG^ǷZoꑐa=ڐw|`pqN3C  ÄiHqD4/ZxQ -rq$EMJR ˕ 90C4m֬sΛ3u”yS'FiBTt)SFl QJb52jRX  +%eAY"W[ߺu˵[mрR.ܫb,Xi션1Ӽ,taF/S͌yΜ?w*SE,0u*IwnqjE6*l]xro+)akqԝ,+j?]Cu+ ~z;֢}J%?,кxudTLVLGyVX >Հ ƅ Zm,AnUbSx(~Ja/mVyheIV;~W=2棑E"IdYtJZKd9"Sa陖RYYriffzQ&WAG[rBkw)$`s}}e(Fn*>)>NP=)SA$SQeUFW`}^נ~'F\+!e׌jtYJNQ2,SQ%WdYgiVɅTrY:wZµ^&6tou.'oux|IJ0l'5_R=R}9!GUEjQ҄Oqƌl O^I2*JlK3~5* -PNyd?. MKi$dT+4=ibeHNk4ͨl&H6t>vtu6jWXρI#.,qSةP&%[k^虮 DylzXx@uWdz5;'ek^h4Fm䇶ϛioV[s/Y;qA>'~jv3WK ݷn&~8F;a `\c!orѡN-0_zO* )cbΦ MM,bvU)W)aB]{VL\hH j\-"LtiEȞB)@O["x`Z\&X\WgF3\DX)v |{y&ҤZ"8W79W R`R:F: TX8v2[j,$4Ɇ3LxwBO24J2X|Θ$e8<­xHG4x eS7c0Kj#5F/bs=5i>_AyJPW sR A*/jVLwmuDf8Ȃ* H!1* h,InG''Jmp8AƨnD2꭪$-cx>oZPJ@CEglr6E,xIH˛| EVoB- 4oA{H䱏E=@lKXAVh&lIb*Wj UxHٟ-kz1ŹZ՞E؊%72@.=}{ l L䧰K8Fjƺlu*Ŭc6[z"i25Z)8cΆӦ>2./'RiwL[z¿_T^F7cjL' ڐD̅e[iJW "ZnhXiVS`S խE36 ޶@R& e<2|gwI(l:Wزɬ|utpx2s 6w'di3Hn6 OJXJIݳ`Eb EGыRe~!K[S :\(4*A,"clqRVۚ=tؽa鬫faө9m1t:Q¬pưs1#SBjs-U'C ^y]#/;.Y6 /}s~o_dC=z+h,G 6L֑ NvI, dQS`9"/d SJ&QA`AYER8e@HEEM኶N ZNUZ4dO" Y4`8eAP1m$UJxEck= #ް9"&[*cNZ"HGy%S&B%r'"(?uQ]EbP~y^T#@D$.`#- f1d3`@c R 5i6 `J$opa7}V8#fZ RGim XpXW"C?~%t @Og&v^V("ue'ۭb8$1HpJ&X|JaQ lXe x:iHxAOʀXfP9n:2tR8U##`KƮNSW?W ]A[Je]hEĨd[X& fEY[L+Bf.g~'Ae _-qE1 fVMi)ڋN$QN$(T9F ooaep(!<(䉴݊'bZY@ jgg-Avvci/d=O%NW(ժ>iYmma]Naѡ]^c-9ϐGI*=.*((.jtَ[hS %%2[2tZfBJv߫ c.ؖBȀ%jUW\ɾfj ƈ ɜ̪UmvfDQϲFPz-Y^\۾\eU r+9yFZvQf6Ag B*n bbv!|,}A,IBH}6 iP$Ph&R+E@k.߲νU,췶G!Ar^[jZيBL*༓+%1藂,(ҫ`Ɵ,! :)/ZJ^*J ` 8%}v"|/^]˾b İtj "e!hR!l.&NFm?Mtvk*M뜍+ӢAI䞤*(Dڢ-v -EdYobr.'6gFH.Rl|V]eGS%B}apxxQ{n<]١.Xo,0mٺ*dJP|‚_[GIaS\Wh9DI"ovfl$֎O&(_&_l'H^p!H$rțZ bkԊU}"[Mn nꔅ% ӎ XP+r2 jD,/b,1 Lq!g, g7~$-kp TDE>mq4~Ǿ\ o70mtj3~e^JY _+Iur끞IZ2PDD#"!o/@"cc²-SPRSwTL"ld$O6r)&ZG5+gf\l%W{wTrgJpr1rՅNt^3X-330\04bq B9G_ԡiR/fçǹ!FWU 2fHxPu-kj+{Yt^5VfW 3WYWeG H`/aG7`#6cJ65!?Ws"ӆ+3gd.Jj+i&P3.up_{gev O&T쇽 o]K5i/qf-Gx(r{[6H27`_An4vdGEtk qd{wx?݊4Ϫmpo-ҕmٮj78OCsNT0V7mky'үib>ȩtW (Xtu Gwh6^RW0&!ɸ NP7/!v~HEI&%cz PipOAYT$G"v"ofM˅޶Z[ 2xx~^ey/9URcHmi5Ei/!gt]U):fz5m{V3©3SE/Y1HS7 ?rmvyI':fw^5Ф^z~2T_ɇ:P,u#|<=o R[`&1}O#ۢI4TDb w[}7紏kӞH;k=WwN19J!g;ۣ;G82Svq0dv#f0/AMѯu~6#愂İ+<[3y Û4Ftψhi9kk}Kxm*zLTszf|i'~{cuYD?i/}rx{l')`2F{^']}_>]ׇ -u3KpwX n`Eϻ}D $(`:ؐFh0XE&V("HINّcH+WfBÒe3eyfΕ2wO<5j'Ph2ysaTPtzhV[% *NV$ZBf Fx+z4Xn^{o`&|. %,_4xo͙*)OrmY1ssċ,/ʧ^vfN{mו麶wؿV@\^F3>!B!/jK=ѓ )ˏS<3Dߕ+dR1МZȭJ3$­ Ӌˆ.|DbC;o Bɸ!{al܌FI|ǪR4Ն12؂%lJ#yLMIv+7$h Yn9/t(%#ŝL=͆kKꤓ<=OȤ '0k:2QbD-4tL5 P4ÊKijk((0:e|UKXe/ 1J$+7"Ў|uW_u]vQm5B!mYjMvli 12ݨ9p3\%W<3:Ɠ; ç# PĂ'<*/?$R4M +S;xSB3IdS]cuP{uuU#טsYg)R0#:$Yg]Ӳ 2MJKz̮Sa0zk5<:5ikٮ:'emRK2VSj)xo ;UT^1}FzV:=Wq#Υ9t[g\<+[ז0%А_ dusݲvlq6WׅO[y=q>AG^D0Dn/bAB|KOb!:) -K w"B0~C) E3c)EJ餥4ahG8BZN+;xmy[JFv.lSKz0ljk2&GZ&([Ij_ hd~[T/JaG1Wc)°NxѠj651+R::01ЦȠwXQ H]0N6҄|-SnzU.W{uz%[֫E= <SbRDW66..?Qд"EF(d {&0`4K/ ~pbh(36VF+֍+}.d=9PXO&Hw )JRbڷ@IFJ&M1MvVrE4ǼvgE˛ Myy,~ e6%8:~r5'ek^%B ^E:QuF $[Ϟs%D5ij?oWЪ Ou,hD"6\bL\MhI0E]|X2̚'廈0}0@eV) j↚M۪nڍIDTN BMJɊ DfU#A3xOEdfJ\M$;JM w5L[^袅W _yESvx)$N\"4b;sޙ,OMnyJ[F8F6 l0_Urt,( ![׼kPxH1 ]<Q\e+_Ye/a\f3iVf7q\g;yg?Ё ]hCщVhG?ґ)]iK_ә9iOԡSKP6?jUZQvaMTֵgk^׭βL*:ؤV[6c_O9ɦuln+:kz[7Qm\Z۩}ef=kWݵn l}|  xa.35땿:mc;0gy6W9Cms3KOywgԵ;Aɮq{\#uȹ-vꢦڍ<_C|\:_wS /W|ҭc<-_v{} g Pg>tKGo6uS=?NxG&{W7>կ}_~W!!,@#GU#GU#GU#GU#GU#GU#GU#GU#GU#JU$KT$IT$HT$HT#GT"FT+T%T TTTTT T!T##T##T##T##T##T$$T$$T''; *      ""######!$#$#$#&#5#B#G#G#G$G%G(F48D+I%L&M*K9HGHGHGHGHGOHVH^HZKWWVoUw Ru%Mq.Lr6Ks>JtJHlTGlTGlTGlTGlTGlTGlTGlTGkTGkTGkTGhTGHTGHTGHTGHTHHTIITHHTGGTEEMCCGD;IF+PG%TH$TH$TH$TL%TZ'Td+Tj+Tk3Uk>UlGUlGUlGUlGUqDU?U9U=UGUVU_UeUiUykUlkUlkUkkUkkUkkUkkUklUkxUlTlTlTlTlTlQpBs5x2=MSWcu}vevOnHlGlElGkGkDPXƇ7i;Y1)Y3ж5m!}xגʞ=bC-R m?a8{<^ܶHoAسkΝ;HU;lőxw^{(sRNˡ7Y˟{\$]D-}G0r)&^i#ZQVUZUOgU'EDbU&c1V#|Z#*|ZgU3_j5=\=vՔT%+fݖע"tS},љ9C%E,Wtz ݞ݅@G)F$ҡ-CkEVxCMETq \ZQcԀB XL%P`E_\B]pupUdl_ Fb3-#*):K [ʥ&m LϡiU!KB.r+fֿ \2򼣰YyV11vO(N*Gٽc딀40V[?ZWZlpHRO_+^2l Xwk=Yj[h TgE%W2ftk!x%wMM,l m\a+8P <ZgGb:R6JT]+xi^H"YMN9TJV@j.x;nSDܽگ`cI d9#~XZ[V6 ܾfTզfləqH)|їF⁒ @w ΅ Ӗf4 vzd`Sb-9!>RXd&Xu YjHV_E*ӻ !Lx vi/Yt#tjR0bCȳ$ H4 Y Uge)R~"2f\J{2 +<_ "s}QU*_뉔-9Habـan kK"%Ƕ걉y$?ʰNxSTƭ= \I`(jY/b1B%ѯ˔DbZQ\jV'kFX9ԧb5qnweSnZ]QhN'o.[I^9Q,5vVUҜ}SjJF;@7Me{K_tP<(tOpx<y`nK# &Dwb@|p9D)CJYHb,4ijUhhYd-nZ#'(N$8SBJGuG? N򱗾K|+TF/=} e(GR!xdw89Q#F\J%OIqTX0#8XĔ EI_ORKN{*ڡ68J$).IOy7͊7qؚaq O,& f=7" 4|'9vrnXvg>I2̃yEdY3q2OeUwOS f>]Mdlp{&Pni2ʛuN3C֌"Ynِ!ծ=r TIיunn7T;.UqEq7WP߳.8i,@"5%% ;! jF$46TP]oiiiOWCa/f#*?cp~UYU٤L+~u1܂t?]WѦo+Џ2eȝ_>]_U3y;F J8XBфFNO6Tq׾Į\?i51ACFLU=UqI+E?sCMiHFnޙ8kJReqp pyDveo|id"DfI'f". fQ#I 9'|&ZNs 6pb.8ZΣM qlX!aZWg/}&wJwjiyLybCV$e]V0 P0 Jp7~e5#Gz'R3q'bzA.tEQ7QW RoX $BxsntWyRxMw~pp14ؗԇ},p"?9Qj2PiG=EbqE&w1NQd/3ghPxhf#u8xcB!(Co37AMetY!q'IGňuv0I|bYET U o%v1ieeS8eġW ('ZTkH( /uu))qxk! lߘXU YU>0%_ .Jev/i;^znI_>@"i-!?!I g1Y@9Z@`4PG@Qcy#TE7V#1:"4\c Aq(W!q `y ?bqWnSj&GGbw*#&LBW{1H.D*6a Hx8~Pa!Ԏ"GjERafOG`2IH7 7 %U:frhv<((|xĒ+)*Y?g+>pHw"*YH.uCCƉyJJ 醫DU_@b VvAa)V*^&z&ʟ-@e 1Gu+s8J8`{_ N3q9/7l&iot4M&ݩTT‚1$RB*9tͩ: %C 6b񁌊Q?*ڨ1q c!P Y@1j7p/LZEFA. 1z/_j+x?M[0a(Z iDY]m'# :ygA'h/qxDYDe3Q8z 7x& dqGDp P Hy:Dj-a%"_jm _^uwL^u{֡ZZ G@*3FQ `VB:86-&;6&-tF%ABxcgT4Ƭn[S' GN;zs>ZI@ĜP);K6ŀ ` tpPs5rnH@GKY ߆ v ɵ-@Pp-W[z 5cOuyۢײ*@HW1bɄ3[:4mJkPAhw8mBA~4@KZA2FhP!;"{~0x@UQCtyq6g@  `-;aPV *d-ga 5^Q; "!{3Og8Bz&j'H ágmJԱe+YV0eln[AQ%b]`{7*}7R3 T7$8q/EvoIrp nH¦k+~`̕Us;H:sĤ˕@L P A-8in2%XD1Ixå,B#*叻` kJԁKQc>ΤZ18b4R<௟Q)#)k,%4AL:=$Ұj GxAYe)qq-' "L~@S}< ô;D.Og*[s rpb Vd %ADLgMַ-q'__m'\ iq-z'!9jgZJQ"_bY$7,a-:a2%ùUĝ\8(!D b6oc`\`bctG / Gl  kX}꽺+L"ΨNee\c_ͻ|= X x*:x&i(D"'E q[cXzz!!: ˢi͛YL2S?d ER eUL:!U0D0u K+},iKPam4JD.N1)!Y= 0{S]<լJU Y؁Q > ]- 4\-%K&(bUUwmZP`7v¥b@`ʗA1 e˨cݷAVl͊Ň>P n}jg3Liw iۛU~s8.  )0Rg Ӥ.ztr+;V8!; #@ >zP{Ÿ[1 Q> 4}ڎeaRTpΟ[8Dŀ5 'x.?{jI I m\hA"?s Mpz؄ Gd f)U!B.{$08PtHT>KEX g\KzI.t![ɴ  K",{KPͣ7" h+JB:@R|@^=_D HCn2DtxaX F Q@TӺoi۳XڠR Bp<.+X!z"k"fCGywXsOPC a Fo'(?8뼳(,Zmq dZb'.% X¤3,)Z̒<ft[FžDz "䖪M¶\Z%0 ͂,),GC BT*̪jD1:h!3,O2ijb v49O* ϧȴJh T!J7[TU)V YQXm}N/TWXPYmJD1}"$Bт.]S5`o i!BUHۯti2pp !<0x%)_,ͷp92 ̪*-vʧ|ޣ|X1T`<!À 20({3<4[V%pt͵Jb99̃H90PsZShsbF ;=Rt[HHS ?^"d.H?ifm Bh$}5ؤrL'_R)rB*,s)5 )2|^3i"N8/<-r*FrJ 1awl"IF#L6,ް"{ "Pe?gLV7)joqUnqUiZgGf?BE1bT-.znze*${5KIJU)*AC!8OU@VU!&\ =%$?qZ.b>WQoOLpphBᔰ E~h ;9Ti٘Z:%x<"F:&@YO ,T-,!30 qΨ_1(Ҫkأ*xP;|TڟN3-oDIjVK}Zg,1;B~dFq%0 &NuQd%4W) #Q\fge i"iAt܍)j; pzԖc$8%B^diGҸ;-bXb5i%0 ; O H1gB*g0^ l*{GRE8ʊCj%Tڱ/ZkAQ\pii'Q]D E?dmEV!SBpՎhqhK"E8%R; d8̗BdI)k+^+ᐈS_[خ5L$ #9By)&u6N& :)A3Zg)cf*Z`= NZZAYMl&O:ZVkVJo^"6R;}C/s) X`(01ZE%,#~]egz[A䓚qWD\Q8*>ɕE%SP9IR,p1=L$eLyT6Z(0["V!:bi**k5AP5)"F+Ql|D(H)lQ# ߚ#ŖV,x GV9Q7`鶂:swlE|h(3ڙ& CUll~ FI+BY c"05u jMl6Vh$k/eijvo %`As\ʭF/*V'E:5T|)X(H{)Hs87yp'nidӄשo*`S_-p+`WAm1{-]U#Qf=u}NN>I[Xmc#5R)uk$- _P`(lbo?n%QPSB*S0vGFġKKWIcڄsBH~(/bbZ;x bͷ+g_*A=J\=:"KEp ;+kcuKM_ׁ&x|z2|9L`M5;);?fS$!*kMM& $gU)KRIJB&)?+CC-,940y+06K?H> i - 졁Ȉ,dwh9J5zG!`{؄B0j&jnS~!h"gQ Th k-hy*#RVK.Jh33$x:d&D!,H+c/&Ba+( -[b-=JRE:`[iяvCKT 4g S`s5u\q8|' rs ðXթG3Y91!,a L{ u,>Ca$i#IOŀwǨzz8y(Rx`l67G1::'[ *~pt?)3<b4>{ȊA$ʦD.:NDӦ5tð*;b/Ⱦ+ID&83 9A@| C( HdK; .B4,Y yRJ N]\xNTx ( tۈ6Cz, dE*A# `"~`#L!C=+70@/kۻH,ok<#Oz+Jĩ}2>m"Tº"  T`%2@s|dql6ƈxydMzb84T172{8`{9lJMP4;"!=A^r-1 LLܺ24+KTZ ea-+<ǙIIa+cxS#;&8i6TD"ړ4 123d1a9 :((Y5mUB+$^3i,T$Y.DKqlJnd XUl:O 2p>z ]kc.ͭ-LR@B\вJLa+&]S>QpXqbh[ 9 Ӑ AH#YHi(+Өd%-XD󐲄@;b2nTp*WiV{ԩ};*^>ӈ,[%%(MZ"7U#C :*2 Nӷ1!1d1Hʄ2_2PI!:c9Am]+1P xy9ҫz`J(9 ѸE6sNG#XtZE kQ\[Ҕ@c:)ٺAPM@h4QtT]Whuck Tu nOAaW3?YP* W pxz`N f^ȲDkXm.aøEyiR)y()]A% 1~hxkN6AA+L]%ھLTeDڨJQ%CUcmUe˟JM+CKmltd^IUl}ba8`(A1?9*Q4ԩOY]ۼB\HHɑf`N*`NaC+9yffk`@ovkɢbh]oR>)%(iRҀ&yI:]>iO j_NLǶ0Fm8"YJɂ0eY^֑@5bParv`[ΙBa‘Y3+!TF#)qaVa`9nՐVR;qG!AҺ"L2&-pb!F@%c.ӣVbnjV,VMt^@1>TZ\V&D%FYL|gVE[P3$4Fq[`kF}N)inݔ뚣" Xw q# ;u9E$FA!f]f5oeex LNt؉(raW1u9j9./>m q|u]\uEu3A>+v KF@ k#Ͳ \_ౡp.@xPW~|*V餪~8-W`XƱa>qhW;s4[ˬ`Uw BJ&*5hB-vj`meWHnP[@x*ŝ<99'>.+wdf8hΓW|BրiFd0CBxX8/pVah'B$gs6YW; / ʦ agCQ}0b[`#/qD2$hI) Kv<Tǃ8>"'bŜݺ)EŏT)L!GRIqQyHD*IH_ld`U<:smSXx!"#omU&\Z ԸkՌ3ڻf͓*ԤP?2(1qPm*ObBRd5 I([w4u8Zt͞P#X#Tcb~P`b''}1ėm_ȃG]?v  v'UKRIDKtS%8 U`BWG>y 'C6~wHyt qTEac̈RNM`17bZ-H !F HJ1Z'(#mIL?ߨ#euQmB1fU|mm"8a9e7~CeVS|%B I*P[#|ٕ}qÍ3PvmjEjulNU(P)NG%s>vZ(2V?XByTQLwf\ feTW%S(XF[mD\A_FMgeo`a֜~Uȝ19Ls 0Gׁ4i*PC ~!zhaVfMDXdeۇ20oJ3{7@aLoJ+ 5xY-c=d}>J(ldYQ/jx4~Ѧ4b#7PDykVvxOJ#M* f%d*7u8aBR 5Y?7s(iC١Ab{W)a2ݢTA ƍ8ԈyuW1 wu[~9tu鸍[•Rb.wz,#I9M~hc㔫NBFtD_bJr֫O*["@!$ UXbZmyn HfLr!A@ڷs.|cRe? *KJء!|!% L(X3 DHJ]5,~V3"G? )QED[dVI\0]9 mPj2Pi鎺o4Z(|RZc"LZm1P ;1Q/vCJȁ#Yd8 N2M}ޓ6sr*D`&"ES0UL fo>N| YQ[z5ŀ*zAG`2fѦWlEZx<&b'a? \#)fS+PRv(f f S\ Uq zgx4T!SUS" #,jӏb$W}X%?dtHb܈J4Y $e j+p~KBB2X|2"3G:S"|Nx$Ie`C,)[6m1udBmwSxȷD1W#9=URf5̄YhRLtܥ&J9#[~kެIAhq$˴$._2>gZTvSC#!R sƧF2 Z-?$C#W\a N+tniƕѦT a2kSqC[c@EdjKy:J9k,-z*SI!t@\~sE[91|d&D##ečkw˙kdc-Yʭ"蒂yvaNhq ;4CŸibD̵ 5iqhQLRQLlVb=wce9?)RSJٌ2iסÄqdRꚣxLr`cLDVx:EqZ;. C2+ɵ*ክA6fg8Q,kgMԾD /kJRǔǞw_{=*X*<Ô ީ~Llӳn<i -F;Ϻ\'f7駛f:$:^Օ4Sx] n0t;XLMv @ hF]CǼXEh4~u}] ʈ9UFUpid#:eL_IuLNՉ/M5UfǦ [pC~@P! ZCDD9dI( XӲ M)Y!GO~L9:ܣɌ }Y!JI Y, tHs^t}O蕥SPBLl؁E&QidL>Z$g ZZ_ʮS]L< >qH Z FRyӸy#؈`PDB%Y۰M#laIMrhDI&!̡6J{W4P1GȇPɱ!]l P0 `DfّA. ;y P#55dXQ%d@MR&~(Q{cweȈI\րCEL5+™^eU-kf)y T Lu56ݕRzwX\bjQ;tTUI&q(PIGE\J*)"[!QlCL#[DFp(fqaYF 1Ӂ ԀU0 &Z ڸ|ǔ bQ,@%16 LIGƇyR0}$z&M>J|){!(-L5]e#tSapCGV&Hr;.( *{#]cS/=}Af qjGFѱUPt;ǂ5GLuHn  ٟJ$I(HO]c87 ݉V]hir&'r.b"[ U )(th\ޡB5f0NEb݋31Qpaqbh.n!ۓ5:<̧ U1`llhFp&Ls)rJ<#!(A(NT}BhݐT̀eh<5 āgg K++62]0 ٙL+Hq'\(}bς>J|JH sٞAAlҜ0IEnR/iߙmr .Q<_$2'y&EHzʆa%HS2%GxѯER[l1IHӊV#e]ߨC\M:WpI/6!{"̣ӑy*-qrL.iIY+PsrzIw&4iaHPۙ * eifށY8GA4н7*QOE*EU!^US x rqxm0G YۦYҷ#[zqx|hlbwd6HUU9 ȂPٔ͂>kPB昗"TPpi\H FPFj"?~(sz, I/;(0pcuo76sY x!Zج/!)Z4[nx7 A=7>FZXt/Wb`U.j%(eFC`Ppxh?u8MLmڝ1kYMpQgɭw&z{q:+Ug!';57>[r^-Cz0zp>EvA'va23hm%}Nlq s9@XHdwŶ~7/23Tq4MF})m*!NgjV/ŜmSM݊[ϲk4q)T\\K1F"eu6h[Ը:hrWɈZn6w9C P:tVMhd. {w],n1pYt}JLpJQ9˜*`f. qE"6B&Ť-ZQddD݇G[ A'XB([Rd5 p€lixuRD'ٲ#[~ga@kz<(N2D@i1IH_":J *$ 6w sK"bWP"5LN)BJ Q!E3I ^#OSD^d1DO +7z!V2FĦKzOJQxX1m"`?eQ0V/i=W r6/iƔ^ Ը`t%KS*.Rl; A¨JYEKQI(B&ܒwqؓ@*PɎA;<5B@u ÓE $bD`,D(tڒ*PCj^d:V\K ,"(]haTlCSkX7* }m,> BA OiN/#$f<h mh*ڧ:զrc/s+[ LM( ܊!5Chk3RQ}yHMQL"Ϯ`0J '5av܁}zœM7' 8h6>C")c}&wJXz g 7FD"f`|czF6˝c6TL_R*8_ƍ6-d ,yN,^ nMm< –̨XFȬp:"# t.iB*p˴j5ba&"+|#P*Eh>RF'.dV D$7d6a~Bm`?B$ hPB#<-MJJ5g*o`]# " otsdMfBktLȘn2.\G@ %rb1F-2biLcz馎81ǡMi,RP*Qcy/Y ʁ4mCجbC.'g//6BSr~h6L@Q')0 >VZRF0&?#_n7HdC69 WD cn.xLf2Fz$g-򂆰dT1+ Bn@DL̒Mnm PZmQjnЮ$YQH0c0QD6R4ob"El,<@:bGѱ2«#0G15[QU1rLJ$iL)Hz"?0woFK*%KLh,SIf \v[ذ1T/d-wX` {ޑ=P܀egb ?"Rb;b}D!{`-DKb[-!4D=-J( .##:aDAЁFN&K&Ita_j7>C"#KƇL*4R,G}p#(甠1p=J@lD 6ꔄn*K & hB-<"d MNXQ34LtR7ÎDzO01#h%To%B.A?aFr8D4RSs?U5MT% U'!uEP/NKyrϓV!HbtҴLN#ʴ~N"fBEsZs;i6R1O H*h: ,T:b1೙8g s^g Q?G3XĄ'%`r%D h7nCSBz[~iI tm] 9N0G.GwN?uC&na6`$ )VaC&:GDR6EOPTS6KTM5D)w"W՘5^}2"tt']TeUVH!FDHGxdJLhaN"8y #]w2bEEed9VBW KS6^?o!rara"cG1XG8BBm/f-"$,ȮDnFS'[T^ټ&L+,.QZ ixjaDjnFS6GH’4q530nH"Kt#3XK7}ʂ;"2Oș(NFUTU5j57wT)M&949J'V y5ǐz1v$JbZSThIw]eXZh5Zln̵X^W(ÅEʡkŇ"U6W&"oPWׇDWwR+te'IGV@APb_%;D96D8=36*9Q`'^ A 2&gVط? šBx#C׌lh"&nfkb,r8iTrt-+Vlkn-9gFڅz8QS634:GItoNg_IMdKB is<;rrz"ǘJJTC*HfR&0-mBZ+Qlw2up6"JBbDL[%)ԆeI҉ίʓjzd) 3Lw`g X/6׫a8MoL!" T:FcT1ByS/0b~;"UN xD) c+s-26 L:GMvc%O_bjgCfzKlɨ]fЧJfrצ‡>ht] <-&gT@/#/-ͮW*Dg˦ӫt$ 0V]9u9.SEUDA5- 8TI5NJ7ZOyQɴ,i\u0|Dd FG"(/ h&g9wٶ60' ދb9?c[+5 BH?>RD0G`)oR.t- 5"ÃBb X{;U=؞)$/Zbp.-fļ9#m\ #1T._˼Oq sqeZiRmxZj,OUElڬRD֏=1c0tA,gW!OH9뿛̏ ڕKkʘisrs)*fOO{O L?r1tn{t7M #""b(;Ys?} o< d<'٦ %{;ר4!dIӜ\ڐ.uUxe΍tͩb` d<ٷ~V,!*qða[ª!86,dB` D3nT -$ȐtРkn):B=*TQI"}j_SVzuj9g ]Źy /0k6-õ6G엸cִ+ͼrŋ[R4ز%0k-!<f)3_l94hМGU}=7vִ7n=۶ݨuӶi`o?^גWnܹԅ,VĹRqq0NIX>4_!}ل*Ng+6=5s ՜R5\=`N(!MdXfl"VR^ܙZE$xl.}'`Ylu=c kqdF. ٤vnДVeeZSfn[uGupiTnB'VRI3P9H1q^EV^KC F aa#3aL2TS`f CQ ꧢJ*VҨ~{Uj5yjUJW}ݪ F)P'Y:jfAFAdyoΞ,CI+QD,6j؊ihAmnMvj#Q!t3 R/LTءmEqmܡŘ_}2}䌪R/t)2\/qr"|`;U`sd#/^s=(Hwrކ1}cfXZYCTAd I1&c¥QjW_ߢBPD TR1SHeUg武0F8EY2%ҤSac@A9~ԧ~SUy3"m|C U!]fۮz ϫnWS\ ff{ƞuWxmP1Oz5_nR["b)>8n误vN'ҋzlBr)ȿ"dD` M-D"K4plTit-^ѧDZҖT$Q5k;?5K'դ 񰟌U*XNxd^V2!Քb xi νq~'et(/lN/fkyfZ6xŻVDaxӅeFDH؞F5FfL9&kT8{(S}w2OAakb-wy 士7Mum-F)@RbÉFf=tJSŞ̓ yE1 õJ$LZ'J%B4F5nYJ,rXO$V ; omk ^\ (.#i} :td$8Yyxa9}oT)m:lՂ F" _|Wξw<k-k5 }a.:l h%,@ꤵ1y oy~nŜ]R^g0h|to]).k/=_ Fqc'D2JV0\ .YΜyM\w-\ DrmY 7!a+&xw>>ߤo;b8*o8, (~]24mPU9Wjq+B.0gy!IZS=n$=OzFgFqtT>17tvg"2wN3_exg\Fpw7BT@1q es˵/6i\w/kk. x#?L p.yBMR zeE_5^`%D%cEe`m{kjFcrTvB{-*&y;_oޤJEo6ws}=V>W! ARA1A5M78GF:q \;f:9r\1y/sXfz,gf:gYiY=ѲTX{b8L>l%XhWwB~^2<vBfN|g 6^'@'rNI0RȍvWxG!\1! x?KpWVy3!lWl&Z5זShzWbe{릑nknn2p4G&u2J`rj5|XqP||U7l厄1}'c7'Z! p產R/*'*qWg~[J#D];t5+eI+=R"Ӗ ( Xji8M*1syQwQRJX!#x6/v18\'?șt\+k!xe.yl&E09Y_T!"C^m۶mTigk]mAT`x;g1Q'|q:߰! PoWE'Iʧt8MIhXJ61c}7M DX)H}ኹ]ai<=s勴uH Gg3x!uGYNCW N)Cx 0f%v|Iϡ jw^UE-3iDx(kqxAkswj@FѤ `$! 6iT֒%zetP%W2Pw{300W7|8ea*ɘ$|&hV|u2f7UpwSvd9X8Sre+%6feTsZE-i Tqɖ&UvA9" Pբ`j"3"5iT|Ѥ.DYB׏\ak泚 a"&cɛ)>^8-6)Ynɑ_)$A ~8y wU}q$h E:9z2pv+KHE/}r;=k'#CRj89g<OfL (wtV 5ȵ*>T7+h4qDXeAQ[f*7j3 /!^=Z!3CD /;C,s䊙@X%JG(vUJ`DNHy?lKy=bb(7h L6osH 1J*)?&}e|$ ?<}5*[G>Uߗq!?!y23bנwY}n_Khͤ X 򫌲W/ch0l$q7UJȏB !P&005 ^gNʁ'Ij@XQ H1/0BaD R3_`a]V9; צos[2Z(.˻Vpҽ<ŒOѸ&}&:Y,'Pa$f")wы 춴e>lYI]%iݵj?JM$ɠy6GX?XJeHOZBlb]qWRz1z=bIJx1M* @ʲrOI6 GDc$iO dF,^6>rZ{hN=ec n`1(<޼@^&ļl&4yУ?{ڗʩ~Y9Z.c!c K7W<)MWT꛾ nxVnu~zEE!kw8xvJC"4'a2BIPvG`ә_M\^-C|Bvw7Ha 5s-+> 4 תM k%iaHn~Ȉz  t޷n}AVaCX_n+Z?u!A,'\%ա9pK#WΔ94T ӕdQE\zJ,:JeA2bU1nC JCX6!MV08ʍ kܻu۵+[%7É/Vܘ1㈏O\yrd#nsgЈ9tiԧ7a*gMݵ۴][@c&>8EW`KJ]z鿭kr@څÐa}ճcW=hPn*b 7M-`Y87԰)C)ƒ"<)Z1Y(1F?qlǹrH![$R$r#rFL{ lʒ7:(JZk.bPI+*G"i8iS&gCAJNDMj* ,rz˯nq#tMDd#N(#0$'j.402^s53\H`VY|Ih!p(a Nܛ6b#Tc Dr` o]ۏl#]]qm׸sw/`%X?m7{*=NTA.oPZ,qɥS&0SF_yǙk9fsF'MuqH!*b}cTYZ{h3`d `ӃB/3L3E˘ΘNJt< OPa (7EѦm**GFֽ4Q- +//`eθ+,/tLomY7651#hs3jb7ⷝ-"#Kw227#^UKxM_U0<ěyۿ}=?9bzZ[ec2z2%CbT(1Qr#Qpg:Jf4)Z" a M(JQ:W#v;4ờlbьf8& Qϔ |^%J1q ykl,)]ZOG"tcQn3CcI*㌭j 1+d qå=6e%17]akZg6 VlyfY}@@w( x]5r b u:&jHđhrND !dG)o]}::sVlk\ #,} ^҇Vc_ A@pB8s$jgG 1< FK&lzۢ BD`[+m$ [5ߗefsn!߭SUix% 5 6n%CN2*g^ )d9aF/4Yg>.}Pwy h*2!HУ[pE}sruC?o:~ލ`=Wi\&S4 ?A&Sx;eR [z{q+K/Y 1u1dҗ6œƋ!$1Ԋ ʲ~[-}Ma BY/KiEK9&PB+ >)TqaäBLpC? qKA@,T5 Nr0.b01MP4ՈDH|H$a{2,oM‹sJypă2@{<NJ82ˣ̃u/FA{3pl1Փ ) ғxDa)]½ؒ{ij3A"F2#;BYH/ HR=aPCaCJvQ=åzM*!!Y=d?DLDۭHb3f+&QąAO*3e{ɊiK7cJI2/#|DA #Aъ44V/Q,L1?،I%յ0_㱭+Ι5@xN뿠L?}ɈҫD;J-ESck/J͒ nKocFt;M=uK qKsB RZ0)EUY 1LPĴ2ᢳ5G2C54I/UZ.Լ/S?C>U\N?DN$Db )էFcA\K dV1}NmJv0Vm_<;WJD;^D^| 0"Fʓ;t;Is¼TFA43[1;Pst@ƃ= X P]1Pn/.9ǫД.rQ}YUM7٣#ÖTMZ;-TIJ?d:`MRI;e!R5 Tp-[h WmUS?uJ2?5QoR 5ck~קjVP>m˶,PSUȥK!=~3-LtDE,*QV}@L:i]$ڽM{ܒ>\QY]@2I5G59=J_u%-c6aUޜ!AD*}0}^멮t3~8lRLޓB%ee}QT9Te!bJE$ͬE8vVd]{$\^A7;\i:.3:cËtCFJW`oƻ<]`OSݼkT/+`y.0e` gH!]`g%TDV= H5 4<Н?NE2 B #pdLa^!5\ !X.b"h)ά { N_魳I&6_%q \@h9VJ$\jSq}mFbjonb&De:MD^6fN(mk(p-pNm`yOmxv6X Fn`;\Bh}gqLSꌀ}v֭K\UZƴX~MRlv"5Ȧ;KFlZ6dOp̆ʥ0,Վc9Oz{maVic?~m\㌅͇pA gqSI%/5TN5Ks<uf^Tޱ^^5&VOo7n(_t&pn؎r.zֻ.Wmt ^g\sm۶mzfDt5'9`Xfnj8s숨meSN66ZY RyRx"~eG"'V[=Dܕ] 0 uVocr6@ܭpjL$eXt2CkQ)Rsn<7<>nvv79B9CM[Veg2fP_lZY^frRI])vedx/rp1Qpf ~wF`lN'׷p7۶HowUYu:qqB75  vƭiJ'Oxy1im痱w`2ݔ$u'ڮ"?|'w[~u'n$R*'xvu5p~%x);쮂^vl}Jfwz˅ypܨ7띦XzvC%Vf`&5|W~gSB و}ZlC1~7rmfϏ/Waup2'ޝ3~52_g-|hTg!7n6g[wz?n>7IgAnbIv8FlMwt IJ,xPD/Ƒ@Ƃ <)2$ɑ&KJ9dɏ,AJܸqe/oysf2{SF{~h̠NY! >͊u֮\~pOf5+Rq-lۺ ޕWҷ~~+RÂf.[)SX2ǕeBy3̑;,֔@IcڑZ_Î-;uVèN;)E] m2|9Λ2ubǩ}@.g_)f^%tAh3 >k$ Lp3`zwzX Uk{ȗR{堄 R8V j!_BX"fE֓e1beW!g>(f-Dcd:ze*$GYi/| Rے=iB݆tLb[SEYIUD!MRQ)]yњӽmY'Wҹ[QFyibޟg_)FYKVc5֣Zi|%ꅫ(b!5!ZjJEEdD(}cH<2K&UњDMj*9bނǗfG Ge`Id滯Y-eH~rgJ(NuN˰TšJue>LvoFjZꭓrhr+\!=yIX1XCL4G#=q`DcJA@4+YuVc>5囥}ZMEYnYR C_EWwr6קlUN54] gST׶ l9]'maږ< k~?Yr.vj=hF7g^:$?/׻&TF?(&0&+5vR'<7Yf)8&HhJv `1cL*!Tñ2ld XHЧP `Ñ4SYIi}Cd<Ͳ^O5 -%iQj|'Q1'np HG3gdڮoXUHJd?YP.)W.l"(-Rzʣ&i8vk'Ⱥ9D6Ün-CcucSդ&7^aaV2k*zV2f5텍X؇zV\oǻm6寻&iT8r e+Y":E#;U0{.WBާT:%lA s=T M!8I% )F,aƭ”rcy"CB1~,O{k}kJDH+)Uu5O[84* /ʬp geʑִq5cejG Uox6b 2N {OEՈ%QG:c #\IFrhZ^MNeAsRNԳd5`R:uvZUn\l[xEGqde)Mh)fjk=X{sZL躹7e33G7oȷ(-YH.503y_W_hjAݠKNbn0wbЎg2_|CNLgncyFko͒6Uv jgǑWE5;.ږ^[K'],8`szGuDެ\;'zmw|O^1ӕ50$ {p]Iؗ Ҩ-'g۹-W l6͇.4>6LHM}R&RCwu&Ě_6#.K݊oU~{3|::I>7}?/Z0|f7FKmE,0)Ly9\}1z̮ΪqSޑY|[ y I5][4YY B([D L 0Wyi Cu%ՌؼUT`q覬ir"YQ]u.]pv A+eWxVUiW|~%y!dW|jygy4!~6#0i%g[Uid]I볆!^~M>%$ET/EWCiBT*oƦU(=R) Wh|+["W&A$j֟I.nc"Gdeky ^WƏܦPLho +g ^8e,/5gvOW^fܽ&lJlb<*jpZmj-<(6gp ^gRj=fS]_ҩ*шX-mUp@gȅ&fhrf$zdAMx*_uN$ߡUcAZZn$yH#5lF9mb6ImӢf%.d'U o%䊝M2E}Atx~pFt$waanC,nb"x"9&)~c%)Q1z9^F ^F*vzRֹ&c>`y9^icư~2cM~y^V%",j1ZiY9]%;o(1"hh'K3hhR\lvWTOuVmMz2TSFyv8Xk_p dϹUŋ-2<_4_@ Uuwb8Eic3<3 sDpPǥO;꾦3Tc'5 JHWv ]m9\T`Ȃ@'A3`!ްwI\CxB"_q1n%˲\bk[zvܦ[b7ޖ~# {:&;iW,!lWwȀzLFWGK'v&8!sޜx8G Z*Ï_"z6 m`_o &3j}w˹'7`zvr*ioy SutrHym6H'{)yCS4QV~\1*+:,G|[wtpչx*yw73 ,G|GՋ U41пucJwnmia8 xX"taD%VH Č9^qF#?4 /(4YҠey`˙;m L:)P*eSRB} (PInڵԑTR5kX0'.n:\n]q:CuN[1.8o܅|Vlqǘ7voG2ˡ6[vkճe׎}{u*Q%綹/C;8e傄j uQNl$@7Jrp^À5pVpUTdwqDX5 Ck7`!/Di$QlcgUg5YRz#%]ۤ(Y5 z .I,N;De K8}.1u"%Fivb})N?q}Hնm\a37mkz7Ҳn5+nr_;ݳ5WmZVߍob u֜1pG<w{]j` ǸoӺ ?8+\g/r|Z7y;=~G\ }7a/7EX?y[m}Ԛ7 vɛN=~u[@ǺL{s{_|W!!,@lkUlkUllUllUnm[}m[mZmXsZ{ZmVlUlUmUTTREx5t,l$b^i ^T\KNHHGHGHGHGK?K'H&>/.@%G$G$G$G#G#G#D#5#'#$#$#$!$## "  # T"T#T!TTT#T#T#T##T##T#$T#$T#$T#$T$$T$$T$$T&5O%DP$GT$GT#GT#GT#GT#GT(BM2=A6?B=?BHADWDKbFPkGTkGTkGTlGTlGTlGTuGTFTETDT@TYGkGkGkHkikkkkkkjldlbpb{fgrmlllll{ͩө֩שששתתתԯҳϼמmH*T腒YhD/6D )E,YD}eO*|baCVTIiXQO rCÏE4 EJ€>? 0S+V|Iv[IS,Q8udeϧ!7Y#^Y$azK)rWfnKschDhW)x^AkKܲD[1"%;?}AسkΝ;HEz2 EJޤ8RK4YR˧?Z] Jx.RO,@eKyaOՄO~X869$E E=O~WHµGcb!cddEY + Y0YQ2 Z_% YVK"^%fdޙ'Ki %o䜌 ~DQ 9Jc9FzRwv$:c(}$[LJyYŗC%]FŖRSSq[reGUeUcH%l1d M;nAJj'kء=;3ϝ 2|z')QmN9 KlnջNKq|Io|Bbp `b*<~rC"<9'Y C'YO"(+\dOؓK'P"Q-A3X` tZʪ"RH㣰91a#jF,i~KZR`$-'e܋&W \#zȀ1b"T9݇O{SjbEg?a cb0ny)D604'^vD%(K"V݉.RWHTKeWVV8(} jVbiHf}kΖĄH<1 4"ka9`N X|Nn0q_9\ưll-2%6qىK" fN=%B"zFˡr.~Kd#%T%P8%W^$J_ȡhxJBD)J"ԡ @5l0+&NΧ y1rM {g 4%GISǦv6SVqm',H["MUCJJCrpPW vc.)׉mPW ~yO*@gږbUlOvo-q'!0[RZn2dV3\pv(Eb1_JS0mr˳okD',w@'N-3z]z[hS%,O7zo(l,*sa`l3pK>An_m#tc3[|Wo\Ylܤirt;O ^&$7 tlU<6Om ` ,QrO͑rxQ2Ô=\{M*6g"9qWz5[IɖƑdc۴Z 7FvK;| edUe#|7R8z'fgB724"Jf5,6hQXۈԈWXY'q'5Ox'mE]E 8 vC }T1P0_jP*`Q,9}r >'JxOGut"X)(q59D**q-L0yF'l"8zG:)>G<&;JH fPys 6߈]؅So`p2*(guHK1V s]lnr/|e13@`: xQBt l`XV1{ !R'jt25br*Z걩p)26&`g#n5鎵6M$;QDJ ```ި))a!r4sagtsor%8T-Ÿ11 PJwZ:3`0BxdQ:[$Y--Q au4KS9zpʕP p'o$ȅ3!+c1crsbF(@ vs::Р %3 o$6"v!-c^ju;yF5.PLd;(-)zQd;<0:V"e/qzfq7O2%3 F g(@Tw{@P@PchPX P {ppŠ<3>ca=uV,evz#+z-4f| `P9ꘪi"bFKa݆M:{g NH'! ..`֋c,2u"};_⎾B5np9qv"Z` P al+ŰR썇:{IFgS6??\ٳĪüC2ђf[IޤieQ/ĺ#"RE5 QY|3[׿OƚQQ<7$ V3gst] (@11}J 1X4 m[\ҙPZO"-Lq ;A .*L|l`Jm$d0ЌU\;DY_ B_J嘁yn;Da,qWujѡaA@Xiq #ӳ1[PtD'gFiXXE/V&$=av|¾K߸NO׆zY@qUwL BiV^0ㄸoKԮ6 1_4=F~ Yg(e9!?<(v́bPtO^6~HMȋXiJQGbdSԧ33f|sYo2]DY-0ZtRV4_ae1zIXfՃ0_=Qɵa݊(Vܾz͞r&)g_9ݓXN-.KA B=A ~ }{\ E-QzpoJ (YEs 5gACtu Ǐ̾f(LPabLBzݻR|Z+<ƜgAdN/+J6 ?ڈDѰN2H7ZZ.=Y)5NÓ^IFYFc*L"5/~b!ɚ>%C RkI)MDR`TK0s.7R7j2}*m"4"-…v??S8)@MG#H'L2A/=4SL7b$A m,!M53V%F;3С< @=j-OUwա<3/?(f}%I$(Y:I$J$4)ےfb) f]5vW}%V(M‘]-_9*Yp7k,l$ܭ{Z6wYX'N)cc2AƳd>s4iGr6^ N$84 rȧM> \(58M^=4L u-PTmX9`K=KY T #JdF`A*emk]cWd%,M`ƚMq,Cʞꄑ gu2lJ?Tc8.&nQ3?N1&Ԥ #8] $!8 `S-Щ[J2]w9+ BſK"Bres>lKsKo~4 CͦY# !&unJʘ %,rDTnu;e2( 'BKH,iQֱ4ٯY@-DT\ 39x@7 bqb߇-Cdߦ, bfP)*CԼd,#>aO1//jhJ))y:7561\s~oMrALwRA-} #{F#M?3gN a @,h3 XiR'zrFtUe'X3fU5E3L^@O$ ^GϽ-%WrSJ([ղP3CӨ`7InU+}FCzV FS}r^K ,wf7x%ތdpW#]JO}b/r!O_1Q [nTY@d3#?˼,1[̬Tkc$Kf Xe[e>h R\K4 *n:z_l .Srnn}m*RF&-43w'{uK1;q0x y7[0fZ)E0r9Y"铆8R{@q!3+J6h(ȂO 2c bRJ6`ֱdpg@-֋:. -s0\8/0؉6L97 (q۞RԱ C>!*fqO+ ǨZ(⩢񣣬òr#˛2R쌂>Q2ٯv+{+#H,o+TXmҐxˈqK( YA7vtx(ԉ,6)+i r9C)߀"&Y0Пԓ$TI(Qc "oB4I1n o29m h)2odhԁeJom$oӊgy m@J@6lb1H B-,\;zxJږ#z<̳#<>Cpa,أ0|ZJ9& -"#5ܲ*5&dᛒٻ6HHNΊS  J dK3oHBHKhD6 BPq1%@ȷl 5+z|`D} P2R;%q#+i:<' .zPߊk " . @ ! ,"ʞ`,J@eZdݮꖁXR |C,鮓x%JB "3~lK$'~%HKS97,L(Z PGKL{Ȯ;= Ȍ*;$oA2QĢ ՐQT3_qdA 4q Db("U+U_ *@V F:ò(ţ䠊,ڢH #>3)20xWA$;w]OTP?όЫ99`` Q'.Mu =fB }'ѧqEiAR5b% %UsȜ܀[7S@}DFTU[:Ð3#0yz kלec)I4nUE,L)+:X̔L&P>yުp>rKXKCFXKmJuQ0 .#m+"sțֹ`22 P1lދt/jY!%˛ zkQk+Aϊܖ˹P؅1 ic@n1rRJ8&џşe;{>e2S'm%uH|{P ( !UK&Plp3, NFXyc3H22>F2=XtUc<@34*R4T>*TN<ޏ*򂴋Puɏ]pcM7&xDž ;TȻ2 cKfqtլhUND,C1"2> <^,Sm˲B Kla!֦޹jJ+zeO=֑ߎתu9i,.h$soXSXWB(}(ں8Ʊllj($#C^AoֈT mZyLŊ3Sm uySbv6a1M܄ٻ&^B\]4W;* Ddq).",֝ݳUYET43٢ʹ((ĸ"T:#dNok,^ yORKpgh$'k.J5sgzo@hJ3@B=[(yY {$+s/xZ| s`aQؠ)٭Sr C&X'˿VgbjVY]*&& c_ա<>61G$#r@_2Bs¹h Hi %=.a‰⳥35½F3NW9>t=߃Wv=ucumSFUR*cAN`AM;<{cZd+4M@֐4ijh>2 fi|h(;@mCۖm1]:Rn!SzL=)6w7{%ugNHXkiO8ccd1X7yHC%2sJ%eH=]'bd%BAo7#%>wPZ};[xt_1-|m`o_(ZG~cREy'gIxwYWQ'f_=i*F3׮ u*ި R-Ҷλ[+',Ɠ^6'HES=h;DBҶU&+dްQCqU<@J{wO%+wx,7'\[ꌍxX⬈X2c n_cMAO`0}&b4/p< P^y]};f{`=]xiK3s |Т,&d葒G/!?nI$Ȏ*"ˀW gŒF"lȂ'O4q24Ղ`db˧R |f6s(X#<:Ͱ2Oz%ܨ. '//M3dܸكP3f02_i׃"kY̲z]35~Ҭn ;[W)Z`.=d\+mi V˫)kqHW}&S]~st& 60]X5 ?~`6Ī3e5eFX % 2hh,1DI0єnQ`r#9f ADKlDB]$HZWE5x̀ h;yT1 zA\Z$}hV!i䎊64YցUR xTh##ޙvO:.i.+y=F J-)q yC*Z!&,AIt}"x EL+ 9I= D,pm  +Rm]j.lE;1mu SQcM;Y,`9]4}Wb % NrGe/\oCmUBҤQjhG}Y[*R5c %f풐thH .)oYf5DAF6̙ #ƟdnWe$u\dTdvKn3)،@d̜ґ 1_k$~"^Ńρh$}/Sg~-=` rH6')w.*h(Iׅ>U Po64ah w{; v'N7L}eme^*S`(0 RJ_ڴc#jL̳l3*}DrAk]A [t|IKDz\Ys&yKGe=& R:5Pbs0(NtT# E#ـ@0䄂" q60< ݲYe<x~>q\1hExS3!%2Oih'W^ My%m̸6bD!k|FOF):}͂JU%1sҠN|\܈vLA΅x}e{F%*P SxKLLY&e-k(H8VaP6N)OQu6 r 骂O4l-mie{BHk !#Mx$ml&K2 #?y@zTAG=@ qO)1 喖vǥ;,XiB`4?yl򂰙ƃ `IhEzNDb:fk1y"\U -Ɍ~h~<&|O߫aO( p!4<`=D gQ+F F+/ ]L&^>iJm")BLRdath=~6T"ekfV,hZ['C|2ڙ(F4HjsGVb/q-(\-^NY,ajҬ5W9)SՓϩ))xW>vyCKDE=Ө~@ #q튚u!HV4d0VBl.Ryrgd֌I!pZ|^8E3 UX ;}C#855 UɇLmos%-uupDh,4yt}[,$Ud >SpF!5:kpϿoR>L=eu]uKmPѵsOR+|2QQl ̸!UU7i`d4k%/I2Jj9vwN*]9bA'HfϹSZz¬Mv:iv)]RX0mVoJOEO^"" AF<(L]* (% $">b"杤"DfV9. ]STLL"ڬ˟n"_UbIޚ`ͬwg]6'!ɸĨ7HT P\a2jC>hEvޭ:aNLEK^ꊅ)6޼DbhId5-MhsI]Nmj L_DD6 cܙfNfP S ^|ӤP#+эfNKLv]! i7" i]jM߯(EYFh6^@]CaEE T5Ċ+b^TM4. 1`DXҝ1t2'E!txk$U+vag/DMY$KV۱Yq2c!.z>%meG~h 'Rp pUELjV-k`,G+TN-1& /,cGڠaU%%䧸RG|TFNxH/nۇ!hu`.æᢀ%]ZQ ס*!Z PQĔ8JE**t`I֢X"+8F0ϲe*j7[K5.L jBG9uVW⽌]pI'Zc4RR00qal\%0U*%J^FHNom$cŇ0Tp (GrȨV]#Z(GԂ꫃ 1H~ vIݎOBF({8WXf$zJ1!9:6Xa͎e"sNXdWZ<(Θ/y[Gefy9˚@'+N0!m&`?"!"lx0Yw_ 1{tdΆsU2+b Ȇxǚl"@>= eHa*i(!+_SjՁ|Fp F8xuMcJqiȲD\(:]?p4=Gz4,Od.Yiȓ/䥢4Ҋ&(~O1?3HCUJ)D?pd> ];63T(FϘ#lխn%`j4EpM&nDޙIq= y6؆Qzot{wIiŌ]ONORpnZEj Pd(@b[]3ZONaK 2dE L /Poa=k7O|ˢjK:2P@{@'JzAxҀF|hP"ʼn &pAJY{j]l壋,^`\,&X܈sfY\lzh͘2YTiSJ$_} l׮g,Yg!w- RAgѦUv@ԆaF%6g͚.|t.ikw,3R;ԥ_9YUp* `OAԬКQoV:2_]}N9!32\zh*=ψtfI9wg;rǕ-V|׻͍VF!Ƈ)Qm"I{S6t:PA##>yE <&H\o; (|2谍^1h<%8l `b3Т#K2#b<>((Y9tߴNڐ 2{ K5"d,BB&dxZ 0HDTD\B/ѡS&tI%}Q%tF${j+T: մLuJ6 tVM`D!lњ j,['VLh2H ƥڕ(@"I3 ‚D(3FPp - VK5uW{mvAm業^z7[s!S3N`n\&Ī`Cc?"8$pk"QR=3\܈gjnpJ''Yh{N2h }sJDK(Ǟ>2E.,dlzE #e]"0ҔfH a˺;)9lVm|13\勯&'pܢd?D(ItG\8ݥ :*F+mzC m LUoU ѯb݅b*/ꦹbxEy t(Y@/lzٺ= -3w=C[cw!܊7җo 4N\{+&90aRId17,8c9v42ame-l 1ɴ[G iiDڂB% x@YޅJ"|أG;[1rTS7xdhIْHhFތjNd0&%NO \DR=wjHTHr+V1X ;2{-mKy>9 NPEz ނ̳JVB 3 #^Ul<5y=iK;Rr(V@}ɯv)`䣎zJ7baJ[ 1˓1o2Gz͑k(8D6в?ѠkztԘoCfJ|9"u՚:N6P{ ?%peaGsYZ&2D3QAqpXmU qhԫ*UBDFAߑT%7H(Ws"!4qPcYfzY^㯓h-$WAE5A)Ԗ m( dY8a*yC,)Z7R,e:嶏'-2)AKI3׼A uPs"x$`?>`;Vk#NVt%`Эp*-!ԗY]׼ ݈(-᾵+2PS;^t0}"(զV$ڪp#}*r`(pDl.$?`U籏겏 d:RNԎxEUfbYroKwάK_n v?Y@nQO|eޱT !fP9Eψ=RZZ^RG#5,q7ӓ@a$weX%"hgw&*s(!()^C&r%u%]_H8Hp'kZTɔ\C"!oVWl㍾O^\n6 ^'z |SNK!GA3G4K,ApE6\cD!B$O "[v.4%h18$((feAZ?AJ02˔oqrd.ІF-4V +"D̤JʆTM(.$0`**TVon:g:*xceO" fdD=IX. | $pF2|FE!ɦ*kպ"PЌp(p&o>CZ4ʮ7O ti"^46I"6"ODct|i=(6ǴEǨ! n1nbR6BVu)Ő%NJ)dj咣NeJKi)xfUf%Dݬ-ecdmSV 2|l^S>ڰ0:G`/(F!~H@C]-]:c:|'$]0! ]F'MjoD V@ҥ"2VB ` CِQszD(e%;o 솇,iDdB +fpVbV/e /kCm?0d.DO: C78'@; +bd:FGZpìN/4QOd4' NFr7FkRDH)p Iמ74-܄D4T"GzQu6c#2GZ/rJmbIWhz&: ,;1-jAN$DO>u>kCl3304O? ^V S@uo +hƆꥠFRPOSUS9SIOF"*}MNB Pjtm|Of+=7f314""CO$;44& .b2&CB,vPv'O~nZx)(< T"C%2E^C.J'P(^@d늪 ,9MŴh̒NŴ*S0/vOa3mJ(006t0NBfbvF>rE>4Vض4Gp:NK,Ds5Gobs,n hVafbs\<- Ois;Mv%)ut5c y07&qU7M]tUj%iS6^Ge DD^P"OEǴUQ#! =% L@8vbE0b34SKuLTDbT5jF/dV.? FgYG@@dRTm"vvyNd,dM- #"hЬ6A*i .>bT/N|PgV ̷Kj*Zф Ӷ"GNw$3584Mq5!75x%+"0^# J~jUքO%: kucoԴ$V3"D vc;( tow}wyB[M`&{A2R֯)Ft0>m%k^4( צAXTm}svPIH^[Rk!%,85%5<5AUE\r%6dx7mUWOqZ\D|ʢ{1A(B*KhS;5Us;廾yٌtMt2vaW65Tu6=nC&ӏ2l@s /_t3̜Oڥ]9u=3rbjRTD]e/5JwH5Eݻ6~h9d8hdFb[I}Phq?pmzlG.Xb]d3^[VKWt0k<:%,05 f%)-S4?uQS4AesA4t'=fEͮ )XLUnkqwZc&cYQ#gA. '*h^RD"b=Iƪ0'|];Teo9 ^}cls;xyMrWX'OԜ*w`01`, ;fF]x_xX(bܐTֱpcöX٤5&kSGsp_r-5 oZMl cʮӦxڳ_qCtqdJL5g2_Giv[Rz2'nI<<эx?b4\X&6}+{5M^?IT)B)\2,0|i>noF,Mb ?酰=mhN:dą(ZTXŊ$O>l%K3O)f͚tI&Б#_-صծ{ SBI)$ȭ % %dnlY!׎}[Y뮼K޼,dÂr,&3F6~]m̙s> ЪEYtUf}xj)ʪś:[.J$cg9K9޹2rW|ٟgsO|5悓{[ H]Xe+IJ0D7aTQIXJmEW_5XX_m [bPB" 2EZh[6ވJ'c=ؖYIF\H7SR>ChsVb鐖\feM)ՔRbRbInbX^.Rs Uf+,-@ϤDA&Q=h=4)DPȴ#ӎ3ӧ9u:8Pʤ#MDeJgSI5^V\p[ҒWlg\aW%V,Au]hfZIMmR"(%UKVAr)+tƉR](|ǝwܡhɇGm1Gqs]~cO>_z-`0#H4rgQGT_)ceXd}h$bٸV*%ݤlSLugxL|zM=f>tUA=jlN݂z1WoaXIV_=e( kBPƨŗaha<:<" /YIt2pXgWqq]\ )'#ia֣ƐcSϹjgc69Te @BjF!g;Ss. %+ Ԋ$#(E)dt#ujX Ș#FV@'2Jb3DG/5#Lw* )IUᦶDP,ЍHg Pn<³:J^T)P"&ҠgCJʂUr' hG*ox1&v/p \MouV35FYʲ)oIdВ>a/{ G"H.|`k0N8JYJKD8N^J>,87Y+ 4 Ġ MIXdѐ~ldը=FvKOqaUt!fG)x1A͑jEFZZbTF,F$j&ڢ8Dbpu5q qd"BVЏ4+ :1HŬ ݸ@pӐ<'LP| (C Qu3*r(mc6_GPURw%CKVd9j^TѠ7%j-3$d?IMό+;aq>gdL>57'\ -k*AX}11CF #: cD1plH#]0 ;3VCy//3h͘ @"$K-@HME`4bG2bjj@ik4k-Q[pĴF $κXMVmHz$gpKǦ6ՠoY~XA4'BB ] X#&jg)\vxJj}{ĉb|eɗ(,St3 Zo8@cX,#V ScfQUoo:,AWQɞn#]2.NyҏNF&@u);Vp"τ~x?njf+&.D.KYJ"΁f՞m9a%ឮ#ˏ1Y]+4?u][\n2N}|[=UCRbܞx^EvH m,U?gfa.x'4ҥ@ :{[ (35+Dp?mZЅ__3gMU*ʒ-1{gE7F.(09L [8)Kd4~BNkmY" zWO!kR8JFR{gs1B3*{g)€Gt@x#[dE+iUiLn25!Xvȥk6IJvU6?K1<T@yw$mwNQȆhRNCL:$:w\CrCͶlWR##Wq),x.swnWn PvS{nkH{+4AT[d5TW^ã66v|c5bcb:bpusS8ơ'sA kȈq~7~P7 Z$r؉(Hs':s;;gsXRffZF7Z,E*RW8(PN5i\$X#Tv̔vfg8'()(\my!%PA}Alw5 I`x}'xqqA(=a`J~ׄw"]Q`Y21[mQz Elz)7 a) np(\FhU5IWch}HF<wf3WGPH&JZr)`GX}pQrQqhVBG0~cf`g9(V)[xs8H5gDg*nzFȗח6+U'ixf$>(ɘ@YKPقQR/j)cwu!g(8}GkYk&y=v$-h6]5r!#y#SWN"ÖW7|/ن.3y1 ,YS&{j8{%U*3U4TioXFh|?ipb,㹝ߙ|(5!s841@9hl 'p(s8s퀕J~w%EY Pk5QdIf}7CDI(;u1Zt{9x[v#U8"Nva\꘣T4B%4?Ԝ];@ NhYʏHʚ24yxGQ.YBz6Dy.4W02oGB! Iy4b5L*6#6Y ?U&ç##5%@!(0O^੠: &IQI&Bd>(k *ff77J dQ"(%ǗzIZ*X!h~٬SF7[ibYN܊Rf[ʄ%Y!F6Sali@IG'+>ȃtE'78jS蛞mqf1q),HaPDD[{{h;5ɞM5U6{UlA}(#gf% dz)($&a&QX%nIq-7QGӠh- ]fcs`s2V[;%*~[CyVr.;(4RMcGDb:uEiA0m Ґ,dvXJ\\A!uʹ栵O`>dgʦҵ씺y1@yY3NF48Ւ۱9I!Fxp"z|Z6qé^y@1V ѡє%}(}%(}CG hyi9)Trq^ a!R.}٢ȇ:*dtxƊr{7CzMߊ\\ܘݸ8$A߱j5% n6ClQ ;ق;Tz4_ر'uW1<&2[&1AV&џ3viEM43ej!^|0Kc2kp;ٞg4;f"1Pxc(W7(űS\i~fS6d7ff J^[qH9gkE%D aaQ q7ix)OGZ̺L\:@hl~L@ڣ˖4DU=hPBfGDM1`1jDŽSE+clcjj Ꜧ 26O$& ? _reʸ+QHn[DY&F|@| p(wpɼ{WX U_x:xثj!Ld*`O{7 % 𥳐3m`fD{ K ! ,rQ+ gMܢ,{[l:\/VvՉ+\3y?(VL3R)*|,j)i@~R- {mRDL&ڨ1 QmX^ۺ]דFj*j_Xwm9 TC ˂%W@e&f9y∍@lN},D$ a U-UfTw%+-.˓FFiX }F7& Zd^%m%ɗ|O1%u"::wlM$äcsvTbųt|>nrHvD㈣ XS)HBI k9&HzFdY]Wjf%/rpQa('~y*.S!'(\7;@-=-0d\#[KFTj{U#N($TM8<(Mam.sʉߋןPp%d3]ݘEP!V d,c ,O- -մ苙po,MϏo2CSbV O»~?? }a] 3<5` [QrqTAKG}Ǝ:1խcJ;*[c| Pa  *DA .Ȑċ#Qa„9.EO{fN[ɴ7L8kٳ`>Rѣ(P`ϐsfͫUfS:j꾆ZvW>S,yެIj]v]{QE,ܞsA޵`Lϡ;6hCG>]`JeǦ={@ظ?*M[oߵ-\GѡsT0 v js~|!$HXI&4h,BJ)hrK.K/+:ȅ0tKR#QvK+8Ϻ̡Ζ%Oeʪ8eJPQsp(܌,HSOR.#jH:[r՜,l͈)5=sM#Rm)QP"\?45.9zsfevg69V:n3 %pNCFt%܋]2D /~Oڥ_-h|#.7Ĉ)x0.P-W\&ktlu,\Ikmvk36vcMZȨ~YmG#{[ :p(dO;7 L dqV>nV\C[l}b܋ul|׈(v"H@Q;2$3T5|L~L3{F3*MIYaֶV&P3t)% Ǣ M&Q^F(9-e(ϽWB\[% ]ȝ1TjeE]*)!O$c2ԽjVX+"ռXRLU!B RWBk!/Ғ$u-oz^'C:/Te t6$! j^GN0=N;jQJ;'CxC,ecdb/aH*~A>n^铙@KLz 4+hVS=vO1k\zZ=c6j`#(SHMPyBF&9MI C<*:L( n,*]TK9Q,S&J, vBZ$񈥢 R?7;a4KU9yɪ&/89d^%IVOa]1OOZ;֝VÃ|$N7"VpBNȰMlcuJfO4YT@ֵݾ͹m: Sw ]ʕm| $KndjԠMPtQ;^PMsD:Ft5a*a>0J;vԶf EUÎV{Cgdݍ&7lh3>$O5g3n$*ǝ0*]K7;#'#Ö~[=& *}:{-9׽ Ia \%j-#o-N5<_ЉƃB*&LŝSLP0^(^y4j3H0>/~0}?:KѸ򼛆Ϡځ7#2tz[䢕CE9(^AB^JݵR=*ӝ~E3dGn*H~ց5F;6+*ng\*ʐA6 73&jY{ibқt*·;@ڶu{<-Sӫԛ2k5=(!2 3ʽ*雖9щ;B>$>&5A5B۩?˜c3/r84{"Zqp (#D {{kS@ Cz91~QLt:7!#pY#,Ẕӷp.aR 8;#=$+s'u\oq=rL3D4!+SڡQ Ù9BA @`j> *ï"KS>BTCK:rV 1d5;/Cҙ?뻏(2YD3q:@/I4dCD$, Jh{6A UtFglU7+>"~,kKJбJV* K #:QF,!_4!D'F@QMYѢ`D 4l!LFٰ@,uA (3A(RE?`[%5au%_Ie0䔖)M),4RSK179Վ9׺SbB2}JY+m2]# Ğv K BD=sXFPH=γ+n> ]ΛZ?m(܉лxTUmTS:*XiľZ X2[ݔ!dɰaq6K-縔L_ {2h]S:&e׼MKWLm …m\V͞=XXXO3Sy=T[L'\|hL8C~-@ц*]ѐЖY~Zm 5%ߍ&DPRU; :#ޓZTޭZ*Z)[-Nj>Cݰ.n6J B X1GU8W<W<6N[eA!+cm-Tm5,yRJLK>b.dG-A]AaRA:~l5|e@*\9bLZHZVbf2-2+8$T0^#[@nVؓHRׅ M{c:Vxru˲Thd-8Ɖkd? Y ,Yqh[ 0]$M!(n$")fNa,1vtt0E=g+*RjD3FOwAN`S h2nuF-YwµGFLيinKol"Yn4ovꞾ* ޅ~xDVj+2f[ngopƭ׾ pݮm>s/Gg,-&XnxᏀ@ˈC-I}rOXJkdK,q/ozi)ZQi:`toVm0j"\.Vr *MpSjfL*sx_ '!r-bh{ <'(pJv0jҥLznf3k]>^M)LC V/xeF+KbVK0ʏ/{l93g̞;sFyhOE]ˀ7,1o{ !nY|-<=-bJev8bϮ}{?^.bmeW# _iM?Ki V[P~nŖ] * ^&Y95u`eн PCeTG4P"5Db18ch6Hj=#<:$cZ&ZQrDypYMdP=AE)4fBOV%otJmԒz@6Isuq)ޝG螎LIӢ9K9(߄Pij~Rؗ:xbcbwQ:C X*5ٯxc/&la+a.fm&9dƅn zre[`1w%q[kc>Quک%Un j,bj\pv~4PzLpW%`FO}wAjܯ%?Q W _GXݐΆ<%qHʨ,B޼s/sPsNTeV>s}[p"&`VT.%QD&FrpðF}*SG/(34TgUjN|h87@]QbR' _ر頂k\[}jڭ2LZv?/7I{W?w&9^4S`qO(/2e@0aA=| _>v!XV0U[!"H+Iv)ݮtl=Na$d5 `.R ZGp'.i2=]x3 :xIZVF-hlRg7io|Xn*A>̏*9J=&|TAB+!9@K a r`+W|?&\倈R@!3O`7;ȏ[W -œni! A.$%ZJ `"pzW%qgp/Z'58m-m ;Èr1fP^!_ΎWG44$->$zPL) |Vx6̱Q4|F0,*>temKk0w^a!NwkmxWb_;u<5C:rڵb4jbY`(G7I-t;[X62r]hسMq$\Xфq~5.Pjp$&z0^;D`zyM]s<$ 鞾EhIhz"E3>QT 6Rz~okJ 3:MPZ-R"zFL-&3 WmFGG;-$%g029%m7 F^*T[3`YL4Y8›l`R Vp(E]ז6ԉ,?jrDzP/d&۱d >uKC(6ׇEv|U#CYGFZ{iYJԜNJzQ2c"Xa.p=aj's^B3kY 岋"*s-/(ᰆ# ^r-`zrYKLEA$/nkc&ֺM&j1fM/I /f=oDqu lYu|[q ~νny^!8#h(7LJ+ #i,՗OqJ̽x [:q4f4V!?>XD [~䗫X=6̏$p1cJu[b^$W\m%qz*f `ִ̝W|gXֹ~OY#e!hy<Ĝ%S RQr%݅{M@# SZXu-:u_4M:̵R?x== '8{t.V+!Dee%V:~uTd+W?w׷p;o?~;]g\48 _R*]1P:VEP ШV S\ MaDh[͹\]i EVO<i8z#E%ExDѕAhMQ}!ٝD LĀGoP]ZV!g͏E!MaD^aHQQ_tHV fEN^ Π-FrX@Ru!C3♛D0DƌWȗ\n5p(—-Lb/#.Q`݊,N.|҆Vy=cuP JL-HO0!Lؚ:#ĭ"Z=V(>NN)WULXm^!dљWYV]ٹϘ[\E=A Q/XM)НUaKbaݽdJ_IݜHԟƏ^!OB#Ahix7*FRB@JĎc>f Scq \UWtٖ'f"%q`,Õ W0 ^5 az8߫P]"f0OQ橛bM[v\d_HSaNV*v#9v^9L:0`m.mЉ V#4=c QcEϒ`n%'ts6fV'DMX_ YqϹM$yRHdIݾѧeM]z! vyZH(5hyT`NkETPf$O&TY%&X]WpF?~(YR$~PZ[IBaYr帹"VO?Re|Ka|pg4RcݓBv#._9 ZEt!q\ԥ,7Tk ڡ wAh-4i'b5#?(p*jLe?T׆:=ZbjX-B8Ǘv T`PEFNڠ{)X I碩$LdލM"ک^gvf$|ҥĝR @j@ @fhX+zZ5Ab"6gY6&V+=EaZėO K%URĔOHa.*eXE&%dvX&0:jajEhER2SP*MPhOPv뜮N PbThŚ켨m#mf^fn 2Rmkǖ *~*Z N=(s%Y` MGVzl`ՄAy֧Ѥ])M'hɆ*VX&*eȬOuTb,ZO$S+y^՚.ޔ0m2*nʠE֑b+S C[AaEmEaQ.n=jHpߪ_~a0,f6+"cׄRB`OZĥY澔YRSܡXƣ[¨֮z\[-`)DI/oV祙Pnʕ !vއ2L~1Ja^N(u{4^kJ^DYX#uk Kbъq$E om ' #fY&Ma#!r"kb.3V G.b.魅/kNH 1fADc2+BD}=h۬pZ!sL@eo}ɗؐ䆱H_2pr?=K"1c}Fb<"#?@&]bLuc~OOJU0..jkt2椂5Z+{ MQ .H._*Fͧbi8ǪH߲s3sJe>;B"ǧ 47ki6J-lNE"vVV_54f]YK*qSt.G UHɸKO^L75v[wKq>?EIgOpL ""f/B8L]}DֻD+;!'gOg|#{U6Ć,.Pb7xAHɋ@ dXavbHI>QC/+ML2 ˂h~E;)5 NBq5ziRKuJӄO>1l9UhEO͋|#%R04)3!/j77s&rQ׸L.<ש\F+d$ eBȠTKBXV3eҏ1 IߛRź},}'{Qޭ4C \` V`?)\a _9a!I\b)VYb1i\c9ycA\d#IVd'?Q\e+kY.]r f\</o06S26j޲gAr60|fB7̑v]fKOZҕ޳9FSԡ~+RG8 3eI:ΧNEMok.sjU/Z4Wk[sҊFvl@;{}Bϭֶ}-joz]lXش k3]ma:y4mv:І7mS9ݵm{gMp7|R_vfj?|l;0pk.e pHGo]~',_Еn'WՕhЂu=. {=Z9vK]47+'wNq{]ʈ+)_y_9y[> !!,@C_B\C]BZCV?V=V=Uw7To1Tm-Tl8TkETkGTkGTkGT\8TI%TH$UH$UG%TE,OC6IC?GCCHFFQGGTHGUHHUHHUHHTJJTdTkTkTkTlTlMo=r3y2~7APTTUtWr\p^yo_pn]llUllUkkUkkUkkUkkUgjVHkUHkUHkUHkTGkTHlTHlTImPPn2Sk!SZ SNRHJHHHHGHGJ:L/L(H&?//<(E%F$G#G#G#G#D#0!%#$#$####  "!'+,'7='AJ$GT$GT#GT#GT#GT#GT#GT#9T#$T#$T#$T#$T#$T#$T##T#T#T#T#T"TTT a<>FDGCGBGBGCGEGGGGGGGGGHBH8HbGTNhՅ> :e.״aw] m+g[].^q %4ܬh Y4t10 {/{wޙ`uIQe Jқt.Msw'pД#5 ZufQHT=~Z-kQCeVjP;tQajTS;U@}VpeSܕZL<. 9Z)\_ ̖A%,h]h$K,Q#x&6Wp`qYM݆i A9 cPkFǧ[e)jw8҆b}@Sn/VUdJ~2ĵxGv2^T,14r#cY%٬E+ ȚNZ47Eaj$ _)rDKh$ (3A 3$r $˱g@hzh4\H-#{ցԭ&ГE„J5$W3iI+ڗicJ`B?m6g`"r5as5D @<{!ŬkD,lx8uF( ZC\?GJa:&).KtH1\PҦ蓽=@:D 5h I)wt#/pq(}%*7:$%|ڔTѐ~4A.MMz˛#T7r2 bQq! ȼc'(PhE ZQ;Y$* +Aǖcd'q)]9$*m)UO ZxL.1_`+JQ c-o! 0.u SvqJce靱)VA;ŠOY2;A0u"a5 z|!ޅD,83\CL1V䡊RJ+"|lh&ӌmE{5 QG6zh"D$썀`AKJk|ͧy5$٪V00bه JEF!?АD[CC66׸LisR\ 6 $ $ڈpqIš"C}Yɓ"0f{KOvƋ5w jw^m2B=DQ ,ԸPH6%vu"#q+ѳ`a`sS6#f:wf7IhAm&qqfIX5tJB'}&LgQ()-{Gv|U'u/fT0fipQ[WwtvEX[cd'_" \EEv7p?kUVa0| P GG`fxhAU9`'um(y;O81`qs{I{E5 YG3 w@%4tn]L",ȗ3W_FDdwpRW15W=P"=U94!]kְ\$c U7  |p@W'| `ih``1"Hf#Fq=&A|CWHq,4$6heneQA PgvdG0:5xah9c )O~80Tq#]$u\c"L  39 \D}x7_&AZwj]tcJA,!]  /  N@fG`t_Z&ia+XG00Umztaz|i;Y )gn@D9qD)ZQ9_ZV&QEP뢉v(Hf4%7]&|ЛЛ` P='"a$E15TwO0Cd@/Bb1 =EVa&S4 aPY@Y(G.Qlp.shOVfxH"M"h YBpJ!Z`(Y 'P& QQ7{%![wl5f(bL$p^₿i<*ef ńSy3I JT!)Z%,J),+r$G"*A F)Q">2Ɏ5lasIjs)FOlKQqlЈu6?WPؠZpk os%h;U7V h(1(p%tV't6q.=ʣeHh!Tgjth6T4%$#zQ E븭(84`/R8f69;wW~TDFLe\C {1!10JJp k(pJ]RDɐ4$V*0NY6t@D15]u$-E.B:B|^ƢcW}5Kr2VQZ4Q8zq:mȖ3ylJD22- .R=Ӗm!ARz7_:ovik@d:T'E{Ӂkk@( nzec6aD$!WSclv#.9$ _)g$~⧠/ n#ccjWeS57$uwtߺ)Ӛ{*TG8a9GP/ / N#۵1bd"'&W16Fz3@ F 9k'k0DQ()p{dN, S@zhV!]?1)d;s0[` ` #3LVHʈl4@I<;FMk|(`Ɏh X /` JƼpy m18 ) PY_ntHV#,x0 =_ƈ _{$_DP{gJ'[ꙅ[yKcPekKBQe?Vi`;$&`“?;k/ q8黎%:jcJ8t!2Wxc!AX u܎i`حdsRhL01k&KYUY ρ{"7%_K-`),kfw-+p[1w9/#,@\,0X ,X!G(k+Q3õ1X;'onJ:ufm^Fs5@P @FkqXV{/ׁIQ ܠpc `cC]  uMG }ƞ ҒqP#"qP;yP n;˘ "(D:쨕E@ʈtA%B]"٫YBh ,(CRK1Vr#%W p$7?N.(? bbXJf])F&fve+M!&œ gR3# Iˎ7( uLƬћMF2+'A`d#B$V6x){Qv$dpP'ZLҢ|t۬!SMK״v/Qha:A-a)B(3F-F-@/r b;&,)+eAl I@%/ [,HۦPYj=`܆ȉLA畖+ ɰn-40;)TvܖI|Dz؏-5^]z0!Hi!tQk@ZgΨjAGc-{VeP/ \c )ۂû)` @*K N * )oR` 485hp(vA!he{M>[ITg Yge1=]~c, >>> kV@unPGYbPC사BƐ3N;)KnoKơ2/)(oa[V`&ihi8lu,a}mY{c-kˡ0] Ԛ'mhE*^jaԃ42dSII|rqhtHȐ$YhJ-]~(Wn΅rAK-9Qaŧ)@]Ew|!Th ɂ6-ٴcI=ev,xxE I:| rg^z6뱪+VBXUYɕ) @B &W:t珮:~ Kۯ> |@)?KI;G/ P;2/2o^^8.X(("JjrƙCr.0!'֐'-X*"pDpʩ~̍$ߨ IFi;qKz ȑ4)L~8L:!Z M!tP11; 335 >3P@isHLf#Dpʴ*GbϪ!#>%NYfSU'&x5kC $>aﵦ^K WX0 `/$xWJ4m8M' A^#"r ܌Uw$v={tǣA pҩ%]ԗD"7Bqq%r%+7닯|R;/Ls%NSR/^vEgWRA%9L4RF:;R]ǥ/ۮ9]NqʷMGjTYmTL@RZXca;M0np÷=m@^H^$< .b*,|ʂ%^uӓҩ|D-3cLD6R8YH\vPs3R?R#ML S!{&T@SP7_Hf}dIKo5medj1D[ZyĐ#*$ܲ%@$A尔̆XHt6 )"tK $Hj `~cy:@-P2&=0Ȉё5@PE[ D/հ=6zpH;[!8Ȃ ,\9X9tq.r>| Ӕ" Wܰ#2W` 'ӟДxZđ#|K&L- yC GBdqk&{J0^1EI;CL2)F 9vi9J s'qz0|1#8IL;H4ࠒJ4ܰ'${CX"8@,:rkɗpqar%.@ 鍭ӊk{Q,pH-t'yQ6٠t D1$;Ҹ zӃ=Bȡ6-h!,/줎Bq \@t 裏נL ; ͕Z,-? 14O$++Ӊp(rЁr8 k,55q ҾR!AJ u1# JD< ؈ (aL:֠|ħh ws)<$z%A<ó3@u0Ԭ4Řq, pB)kDs{8غU1p(ڠ0YkD LM;*)'!-Y)8 BpG\"" тq9(pb(MXs"P7] kb (&Zj}dPSD-ց 諙Hԑ8Z'bڠRX;2Rh'.䊮X3r&)xd8N1H_[NB +32|?tDSUKȿ1$\:;<¸ULL<;өiP9l |8U{Y}ʋ+ԔN`զ= ޻0`rEv2 dIFJ>cκ ъ mD nEY 0}^Ȋ6b?ԢյäXSq JY1dMD* \ſa?.ƛEPڕ@h\'aH' L OD[E9L _E-))J)CM].}{h|3.y( M~j1Y#!♲էSACBBOH+l ͍}*i dd9:@Ԍ/Y8ι84H@-7\<@]`e0]B@*Wқ-^\Tdh a+h݄pr4dAqN9H"Iqls^[YgQMU[-Ufw DTB{X n  f+ ۩, .U-ձ}DRUVc]еOy-#0ZB#jX(wzyմ3r ̒FFNF]9sDD T'&bpVi9pi"-Rh_rZ ]o"Obؿ pO b .ONTXܫنqyrذmo8[\Mq d J}/ς ұ߀ hau>[-kf*0],c*E aX#VҴ i485ּ Ab@6%d?Dd8`{( hCLU'CbFq\^dD0Hsύ h⫣*1,4DccL!Wg#k2p)Ȧ"&' 3*h.j$~(z`ob@w:P$ *\!Ĉ'Rhb3c;t5 )Sܸ$GaW2`& )` AGtlvAA TUeRu3H*>aI#iN*}:nɸ:PNK~ B(N\4܅:Įpx04&aP&ƥR*L"K7Rp#aR`K(HϤgYk5T̘ZKj0Ɠi|b-{Udh`R޴`A.PAJjB%B%qP}Q[]EA}VHw~'R4u-H#!w'baB QXcPIT<>Pg!J _e  i,4pX$IRs-2`I,%hzXYkLcOLҒebA8X 3M2$ ` z sgHYI~\&&.Y&]9W#T^R mRG}iV9W6@G9{H=W\fqO RаQ*jFUuMK_h 6&mqgTeuW-a4dJWG>Giv2F0/!>ǘSiWuƉU"+rq[*Ѡ? ؞@K 7s"" 5mU|ee[rkw8,2`4$L-xI~6jv'QMiwZcii H@'(t薈_vb@5B8e*g\ )a}F DJv\2ЛRpAy1kAciVl=uDTU;9ӑԤ&Yէ5 @}'Ol%akM0h zfGKp2!j|b; 2UIbTd8`aM9\pwO!ìnu+R d0A 7@ ȑJ#A2ΡmK+{*TfqfNZ6,)eD\`_J/XP 1) zuP`W5k)ӈt.7,I|唥@$}2 VPB Kj d5H)-;rs,3oER O DIS'L^S5h`@Μo3͓IfrzBW:Ǎg}lR<w1& DQIjgT7BE3J qB4jRMFB&25Q9R +92B&|ntg5R ,dhl3, |>Y_ЁgD#ŜAM3 T(;* ͲO7 'Po#5DM!`lv%T8篐dx+S4CQK%Ci<@j}-tךhVtP\(F;.~mpmQGˉ]E%j$pԻ0AtO$ITtzzcNUX~DR -W8G¡i)Z N7'$cBH{:eO5cӎOIE'|bD#JiKm*QK;=0J)hٮ,:Prj;i[9,Ajh:)^b} 3*E?ˋDԀMj6ڡ#&R1jj 4 cW-GLbx#ͅhn`Lr|;l[3mj2qC2"&Lr0xjq4& LEe쫶 u_ݪPdN&Sr{&3D P̴3B:iQ2U7JB:OkoL;1l|TI¶R p* U1"&Թ %x~pP)x'&'uO `4Tj*1l`+Bl\Į 0ВQ6m|0a{Rd < A\L"ܭ) ƩJv&4xEÂ0Mݶ/xP ù(&>Ny *_,'LdvU $ͣ ^ctqc%Ū,2p(Xa4?EYMpb*:b٬19=yʊ*c5zu5H0x(A:I/۽px ]E~L. HτYɻ5R͑ʽ1NpyxXOxuN{ !x9U0 ,Aq`܊9!A@JLShINJa&$Yty]_oxydԈ!+ <5lW_P4 ŌɇQ lp`ErW!LЙR Wm ЁsQmͿ8!7@JeNR\Tt$!Mԡgl[ZDUI .qXЈtɝolHoك| $iHIڎ-%T4ʝtG&6]HOI@ &yګ5Tŏ'ATh Q~ mEFX҉F qD ]Ne ɡ ;a"")դlQS]EΥQ$c( kC(rbјeYP\FHh=tReϨmcQ,Ĥx1"tFb\g^.M?]N]_ٓ9TTV_e'U"˱%=۱:^"7 Q ی!b#B`KܷKv ,G`ȑ OARǍ=kvhԈdaH{:#:n\b(ŒvFÓAc4υbΌ}\Xl )ؚP"t&)lOȁҫ킂㟶mֺጣV*Yō)K]U,]dEl6 =/ҫ cdҜҙ*jdٌMRm̡NR>9OK: 'eRV2t UF޶jh>1 uBRS.6 ck@ۨpL'ZlDŌYnEGdƤ{6aEve6%# 'X0=)_ː`eV- , A0τIZZz|OFFFX9/Ah,B[r +8Ic5US(n @@Pa8)ۂlnb#-/&Q F@ ULtd@F\Y^gzڦuO!^pVi1MEꦬYZqIQ :CJ%-Tu*>NGtFOB)PHLãQ&҃+-߫>) .9FqE?O`jViZ@%ቨSJ$E+@KHA~G0=jdh=Z&mA X<%BJ0U=MX)e4tP8<۲ITcq0m s-Lx Q̙ $qe/ : ?꼢LSi "[dxLf5brZ`:j-1n!9LX0̆Et;񴛤tÄ=)=9ʩ>U EG~ (VW֠^O=!nI"\ v~;"Z w֬ޫ߿gz }Z8݌K /p`s.7;1\Z~6r]j,A[0xP;T1L}S% 2Qb( PA:sG*sݦ[z 4.- J#Q!/3Y`>[P6xJm]6@JK" *l%!d9|Ķ%6N#@CVi,+]G cdꀕM.tRX(+IX2D(|%fP =Au~(&YG}W2&Q"`! ɬk`R+IlFpqL,hl>rp[W8u-nA5;@ rZ.Ϭ &kj Β!. 5HiSIFdf+<+y1\4>t+fRžD3Xl,]dfӝg7k}xt2SR#ĭ hBf!1q 3hu]V($bM/~1]\80>R(!% şWȱmĖo+.vGK.w^YPD f1z/O"A2P7M3_Wj @} :&;d'#:q`ݒ3%H% x(@Mqqd 1Q٣#Tfwt Y懐Tk-8!\H$Z^ =/^M.:ҍFi eNY2!Pj'k ǖ_J3ݪv Y~,H,Ǽy<^DJD[k6-)s]GˍҢA6X6aq+,P R1ӠPpG&휖TYi)Lsc,NdB/Z\̈?…*YU^_,S;qs RcSr+<,Z|!(Z.OX<]1c6_woB~^}D.Lėvy4^mk~{[X_—`x)S'q0,!QM-@:&$5rݚO4pY nwo9&p\.R`|1f2X! y!S3{2tJ}f=w(aJ$L O{=U[]iakYEν6d%&>O1Q0]F'R`>.ߘ΄]>$fL?ّbDŽ+5)X@G3RͮqP|S?)|v/ƖX8?4&nK>%ϸGr7XuE' w!DΫ8r xit@9j-39KdC˾}-~B&d2{∢'vDe.><>HNH&lIjBrB'( -PĒa :&/ś7_zl|0,n{2((Fj-OlZ#H1X ʊ'â-0ǓbĨ&Bx"9lP^e&hk}H έGNm'BR:Ox+|" &#S%R 9,v,$5jD0r rєJ"$IlRPMPFgTsT<tڐ\B&x*Co\!Bެ~ 6ʼ_,,'n0EJMnp$PB:P%dR6<. ɀc kBH'@>"h(>l 'X YT\Mb"/ y.^Vvvv{N(('"ĹV#l|"vax!ldrb ) }8Yz%`~H8&,b h`y NLƫ L$ LMb#EiH&jkϒ̆lPdBuh0O;63=ahlRrEPA 2/.# }4%tMyGSL#r2z5RxHCt:'Oqsb{83$0l2!f;&#M!N`m7N6JbG 0<,   2}` 93.ǀ$pTF$"%4#JBB._ePYcn-.β6v`@w0FyxR(I1%pLB f:h*2I)ALz#JE4 Mr&p2ZCQ8$W4/&,-'R-]UfŽ&&7|.,bN80^#>lBe C# <`,#185##;l #edP(T2ǸCFI'- 3ewjgt떔@XҟF&Rb= PpJKh.F.dI̴jjOǫd$_+Jz(٧ll´712RzP†PC-2;f_>t-3S8mJ'pMdRтo7}bm($1142ڦٺ:IwtGwMF\K'B+V[C])5-;,V^ ]~w~}#!lc+lS@_h+"RET^t+cE-2B3RBw r(>z=`,֢c u&21,nHƄHHitFw'lw]71dz].Ie4(i)-+ViKiu0bȍ"h̋t8U03'73T.Q%052:c3z r &"o=$M¢8efDфTǍWq7sUu/WJ$ixkOD7u!l1`9 )#޸UiJ< ƞ)Mx! =7n#%:T UDfHhLrt2^W2>;|}2n3*RiY&5kc90RJ(K8ftљy}1 />{jYyT,8@cNBH5j#ƒ6!LWiC%FIT0"tjk347-կF  Ua&H`n*1ll"Pj80qUqK5r{Q}!s$r&GuOO:qŦQ뵲,Yi̒G9L^| F'r0KKR ]">ObjO"9{nzk|5'5:I1yG'n,.$A7c=y'}n8HSgkhT6Be/"K*'&hiߤqś&-kĆEΡtH"B !duGbZlp['nF4]ve)2 PUa"_u/"ת!MqI;8%xYTWM;IoL'Ň+ +9ی̀WŚ\a?i3i/e@}1F^)^\Ŝ;iMI;մN|Wihvd"󢉿Yd}'}dwyA_ee|+2~d: E&,!B(@Nad`k`办U ,ux}(0 _C+dQ/ىxx)xiQy("R'.N8?<}qK Fv-L*}ݳʺW: B )(Zƌ)1d/~Xa]s d%,&.A8tO.-R@OQ䐊;R:CiVP$lƚ=KYӀ8bZ&;S֬XeGδ7M_2}sS82d"l1ʕ/CͳcƊFJ P]pTLwEbb`4捋F߾,84Wi6^2ٟC;93eɒ>ndǛ>&@:Lt-[6&϶?c )H xH o)vi̕5_|I"u`[=!T"rH&&ab*HoMSH &X"I!"#   #X#JDJb%AQDAsTN^j%NZ\ UC*ѷS[bބLofM)ݔMNShByY~BdP> :BPD U4ZRGgDz) KvygodmK-T(WW_Uf>k04T24ֵ+^wjAfsU6wr .:tW|g_j#Q؁+, 0|ۛs :p2>]/nn.x|HRs%c߁r0< }:0.n< _,r"FV*RYVP#eMcuU"N?@Nb]Aa^dIh:OU%Vme`VY7.&$bPiu.RsTg[~IHt7OKz$zMiNZi ݞ@ˇ$Ҫ&m9},$D;IdHK+WcDY=Xs[XZumC94mG]5 ^epL1@s5f7/j sl6`YlS '84gm U1F; Nʓg:| 0l d'4f&3LL-71NCgKVD>EmRZPŵHn}q "ЩL;:P=#H ZxLXfpŔ4,)J[D|Iu@'XE4xƒ;L Wq@IZ"fRحˌ@l(e'v/A$@9>d8y*#2^\ D6$x?J*UeHR˧"(WNnOT_Qbp ^ Et$1nINNX⩌b*(:فd"] ݀iT1I)|4Bo10=6̩$2 $h2A OA*uZ8D8$=^ғR V2-E,ҚD$Wj*+zVּ.Iۡ2uYaAcQJ;%VA`Qg,/ C>N 00*YECc`VRRǸzп%Sq7<%oyd#fhOtZ+Oqݮ|wYg3_ͦOrѾ_/({ϛUr+4q%+܈nv^kmD*WOrB5da!JSE9 $ OlI& b\ N4iYU#I1p11 +#MamrW&b[# ٕZ! W$^I*E pR$Ǖ6wItzjX@M@a^hW@n1J(UP~d-[BZFI;9"sNӐC M)77:Bz": Ipdk_JtN$o;WV&+/s8+%UŌpcSK1 xq"2nȰ T %C W2Y& Ma(@p;%x"$|d #<@ŕ 䌓%~oG%3yxb]mUΫjs~tyM#I 5-|HL4 a8=yKT~-q7 cjKv! 40IOWI a:3qcͼ( >FL2b*=0߰MeSI6 ߷jk91Q 5tSL2OT]m\3misS |˼VfHc3 Gk3"8|NzX3X ۟>Q˞`$[V%ϨQ^IIosW#,Gr$geH5@A EfacjHx;tʄtvuv:Ɓ*(9q=-gSv#A th-"Hf QwB% w}L$A*ILfM焲kyxcaN^E#7$W#N̗P?/hS'2.TSJoWQaofBsa2g&KwzܑP Upb}Q:43rc22~/wa!2r%rm5z$ 7zmt5#imt q4tXUiqgttbuc䶌f$4Xg7[Veviih%D%,;2;:B5iwz\6MRuwe#66>^,f>'zY5_lpa^uyWhyhAtht 3mSɔ|rCm`F1%3afaH%@z1.G@=SG}V~'R)8qA>\6mɊAMOYwsw # HVs#gevuK"Utـu Z0x*E:j\g=8DxD%: xL@&W \We4h&r# te6LƎ7;q(X.8':ZKTb=UGzXBHꈚ(gc+"t[$k|7ijj؄yЕ,vxz&yftёWwIeV8qz}A7dOqa!зIy14&9C7 N@t(TѝɈ:}Nؗh@ "(q\yAV_Y3Yj jYsX v8eHyiGb:Z*%P2v'qH@8LUtfCZꂑɣ9J Rhu.4fDw(pAuO% j b,nz,]ՙ}}vlՖ5*C|"h2  |CC2mQnމY@MSPp[&/(AS3Ȅ*<!6vAhq^@VQ2AF(q*xr97f JRB;DI@GjskPjn2vϸ͘ʤ[OʹQ!ue]٥_\~w*[]zo5s&^.kvlk5t*Q@p8K.NR;$ E{>+)@Fq7@)4Djv`,I1`O6ŽpXP uÚ\A[D2`fdz,r_F-t;G+L +ig8䘸բ+/=!A[88Xf4< ){igs: wKd63\kĭky,,u\%;lԜk@C DG11` P8O=1kQTLlpO5moՋ lx K\O}Hd{F_66p;uKZvˬe@N&5ȖC˽|Jth2~E1haIS\VBws8%Ap){L΍̳eQ,›uϒˡdl!k@9zS:wP2#B: RywB;mnbo 2iZa1| s!@%ё,mlAm*kۗJ&Ԡ졭QD({ۀad M{[gG_DG_ CY?4H><7o Xd⚲R!9"XX*ף&HKڹ?K;:J1'#%'y&9+I#̺i#Wؓm>TϟM5 #rzsf; x\i)q=s=[ztb1=p˳-+ .݉"? Zɩ(.ި,L]W%z}%&X aG1f߶آtgb 8`pϧb9[@6mGb1bq,4ƙīOTE={ `~lб2+i"bW$@A!P{!mAt|n5hT&qkԎPVh_-<8hMlMjM׽ Q=P"ŀ#cH뷞C/d9Rݏ`3%ߔQL..A:$N@$<$$NXE5nX1" vCdI'/$ }qSGfMy6gꛦϝ2esQ bBz \2oNYU5g̙:Zy,YUrV][^~6ݛvU.LhLEÕc.9JBYrEVEOiԧUF]k[ϖ];mعQKoUR<-vJU 9 SGzܮ[=d;$8|sqE=,uyß}[[~:N;RHI&~n:s?, $|pC:pф 梊*zJ1\3Rhr N¹iIH뜁8aCP΂d F:y(W/8eF^|IfuQ<o He.e,h"Kz6ע&Г`xm+1 ƘM0ΜjQ抭JfDxāqAo+}ox\J0:31u٤&kZ̆լX:,favvߨmn=w޵5|G;7oe7D{ݶXg>~N 1[oo?>嫰/勛x.~ÔOӳ="bvD0,D1R84e{A`A . Kt0mIKgZ!֮&Ix\s ͔2M# lŶly"@(]Tj \gd.&H'GETRUhRDW#]i'x噢&vhg )3[J Y!R[ٝpH<׷%ɥZ9W s  h=W` 0|W}2Ӯ0LWyL&Hr XI$5;NH`g%4ОH2ގVN ,D V*g(l?I5/I.HncݒmJ\tq3htB:EW;bPZ7u ߾'P3FTy4:aP/W{d/+ 0>S@LtCͮjJO1XHX > =vݷ&|a OViUgRj%7?~| ײtgd}sͱ3" VnGVc3a<^졳.V57Ŏ2&4YsoN_hՉ3y kwjrm{+\ۂz3q.;L{6t*}hXApB:@*i F ތNE?!5Pnr~aG7ƦLZ"QHӾGKUPWfS V xvlØ &G/^F+f y<,xte-FG(}+vfQ}1i1GZ.Yȝ03=+Ђpܸh=[azMȃ[Ϭ.gYlEn8\gKsƜDˢH7jZJ̪!:K?FI̮6]`Z}꼞wRjG"ŦPhZ8 xct 6v!'nvleV-oxj#~Yǽ0]ƷTZ6_pB';m,3g'HA;-9s|N׻|Pzَ+oiFsEovBos9p֚gzF ֔p֑;''x["T;~u-rװnigVBVTC(<:01*{5s󳮸[@e[ ɪڶ{,~B<6T0l9K-ӈ042B!E99S\9W;sbc5)#C @#6JF|IS0E;J$YT$ t$ ;<]Լ]EL.KA~7[Fn· + N:ACK³2;=TF0]y7=zG:xⰖ˳嫚>S>v`ț5貓q )<,4Z I:bCdٮVL/RO I@Iæp,{_SI?WԈZ@lc[L 1 ӧ@=;'^}#﫽JH%D+ BG YA(rZG{>s37\z#0 ѓϪ&+|)hG-491̖3D;s9tÀaȃ<1 Mi K3ιHܓ1xQtj8r H [1x#MúCo3E\?<(# ]^@H->;T )X|ϥ< >7tȮY'2D93HPd/(췏/̏K-.1N"@3o4bȎj4^8ʽsdJ|6<p7 A>Ok\$3%IEF]-MzA"FMuT7x#WdkLOR*Ըr7,dB[-9/L/L%L3^694 RMm<! ÃNҠ{ =NtWr EʩcEF.#:}O;جjG@S*S J|6_XS}qGEPMF8c4)-Y]YGeAۃiAJ}+%ʽG*_ 恳'+ { ͤf5Cg֗՗#LaR& UMM4K(V)-S'mRkVҍ2x)l zUSdDE)٪!>S…J 1LzJ6(J[JԌ+!kMFͥ(dK{Vj3ZB۵ ٽZe,9\ C]eaLVW V'!!!"ZVlȟuX[tR,Cne[}Rm@Nl* tBWgaU]`Sk$J6Byǝ?m2cL]a\]Mٍܴ>Y{F 2KԤ2W-ޛݔч l!9;s9bU:^sX'b<998Ϡ)\ËSl숔Zcqs.l0O۪Sd cSON}`Eܫ1)`I\MZʭP"ˁYt\P-5eZ3љ8\ڭ2]Z$xe[rUU%^'B])VMbM@)f^gn8L0&9%O9i0MBHeTWPeOeJ99GŪ/.?F \J&AVܼ f!G8 QeZzf@'Tb'QujqcBNNCWct? j6vON\\\FDX3hi/n\Z ВNhRV&նϭnLVZmm]vU!Ԡ]`cdLk^1lfnކ3;ʮ~֌.M˾UI3n|6Tǐ;%>*&4M^oVJSv¾o_t"^w|ɩpM&j;je]QǴZiA"NfZ-f{jH m|ͳ>?(.⚮3qqco-;nhvϺqF“icrqk\XZ&,mU 'msNmM30jx4 bBcsۖd.fӈsˌ~kdr fBj%CAo[IW6K/`n$fSv܅⫲oUW\_,hIxz #aX30/.-zrpYEJ(>GI{tkGhVtq*`H7*Hqg yuwWJ4B՝ߡ*UwӒP v1lYa6j3.x54aULơvm99V}m:Cy>>%>tqQނDgmv n'FI ƈr t`|-oM%|wb@+?u@קHVuSxf}V^jQ*rb7 A`pslx` gv7b=X}T7 G8LG7Yx#j期qz7EvvsG֙ZC8rO} Lrp|Ku!ؓi\)W܇p m?+㼙~&6/8/foˬ-*(I.t|}vGzL׸L*A*)t)a &1ᝈ/bLƎ?z rȒ$OzH(_XQNJ6;̉sΞ;)Ft)JbF>I&ԪQBmծ7ňplDAlřveϴ_ݮ,Ycw]l6 !S,2j@T%8dɖ)Krfʚ!r׌iZiz5֬UKI tްgc[pa֟e#819Αcjh{at>O&"g$jdaRσO_shm\ͩ< 7uP盀XTt|A%&bƥX&!UE8ajhZ4`B.šn >c8xNjq!ӌ/ri!DD6E3ւJ]F:9 ܒnCwe$^@,miӖ_NeF׭fD5nbWB 9皴%$sj#"RDgR`ݝ{:Q"oagiKif ĭS jXCIqj) dYeU(WtkmU*'+` T_mJUMYeXh%,d5cObYF٭j*Rq ۂ ZTfqқ]6П/RHwI=2ܞ ]’>X@F詊ƪb zuJ0;xͯ֌sXU3W2C*iwڍHE9V ݴ*%ۓrܽ-P&g[4&Egt퐾}}'{ǀwd(w gw!knʥ 2frlUS!Ra!͹k/kbgg--q1fIk#BT "սKh>7y3GtBNQ@|.s-]A5&wT?JxE_,9}\?WL7d\漂z_oJkQ^ry tv hi8'$Y1"dNZ Wh<*NQVًyQB[A)DB"Ŝd>K9@\TA %_R(# h3<ێzF9ǭKX@́hwܮGDf_0'r{ 3>5`%&kwLhDIʎĈYiQ~yu1Zj % \I y{/mb0ED0i@IA# ݗFM~m &G#7gc97&?ŃRWZ`:AQ> HMc M=`tW 73Î(8#ѐPyMֲTЖךx7UT!]dڥ[OMݢ ^Şԋ3̧>xAƫv@Wwx=vӫ"ȞHCAX rgS\Q.s>:?<^EpP*4pTIRxҪ(mG5ˠ4ZT89N^^XV6/JV]_!Dj%4scHX`p#N.3!URT#U\a I*ݰ~nEr̚Lު/3g]y:uA{F };'AwS](0Mv]T; m!kQEpBj.$Ls?AQ>FӮ.J,ި[:)mşا"}dBd&*\gN5LM7%תRƟ@:3a*;ѹe$4ˑ6nuDd"Zg>if7g`70kdB1EJ)FK ҝ$?oF…B W%/E\+*|qWk/ Yu殣%~S rWdR46ExҶȢVgJL^7sw|/'_"s}W[_L\Dmow?늰EiZ]_ᅏg&XLa&)kBj Ʒ1n#k nCjd^R=HD\r㙆Fp J-Wp.W6 g|*UV5Ue/3V,Bz΋aӞs܉]1`*Se+D+E[R[1lYzZҋ//q,+Yyoeu^yOJ oq^J/.l(וS`\ma\6em2NTNQܧݳ2 ҌW v3mue(CG4o7v<4k= F@5ST)ď-QNF_`M؎qQkD*aʭ8A419Ց=Y Qҙ) w%qUtY`ei^RzXɌMm`KmY(#VIҍ& kT d-b9HֱOLb@&^xGUb`xX`\X%ᜥ.!Q[|d(Jut@3N^aBmH~)ZmA0݅uTS^cecT`b!$mW rF2p[ϩ@n`$h䡀LDw` (ybAa"zN 1_Q+jȝyH,jd`F21TiXbW 8D]ey!Z,AX8 I#E:;caiB(1!\oVMnvF1hnfcv . UD\j'@2gM\Pg#mIY\x'g&1Ո DGLridmA$ &n%(yNIb ni۹dH8hcb5x@IiO ޳T֖Yhģ\(Ӎژ,GV$TZ ϙ1F&ʓ.e0',gGbrbbb)c͗z*N?e,כb.栖Ω{))3.m!nD,}2Θ 'o,m̈fb~f:n s^>+P-]\:SSGƠT!![A MI jm>Y`%~ZV H중φ>c,f}7uN+fanoE,(Gb0 lco H '6kkr\+vM!i}RcdJQLa&R [ V G,CWEx1kl)u$GiΚG,gT*=(U~nU bnooZ0,m[Ծho p =0K1~!"[(voN&'vo'ffE5\0N xfRܟj X7H3KlvFrr-n*؍Xl gSlP .UShYp2(魠$p=W's!X| OE%TGyHZqDap NqqK2(ַtZsvHS󿺮gO*K7+z |3a0ܾΑ2n"8#n{QPWWLO~2!UFjъeD rDu0 kuո(V)&+i$p1OD5tL:>4]/X*-NSp+:cf|V).R['_inhD8@vju^F7OH֢D^&tKkvt%1tbwtq8O|TF6 LwO< qwy ΞHaI;shgBy:RyPdџlY\V72wv_oW DDS#H+j, t%~ipow%zG⑙`m!# ( Tw߰~+WF\u3wv/P/;eOѡl$n])c{2Ҍ'G<8t48= zϰ.Jm;yW!D[~v7M$k{}˻U򗗒3q8uTeMZmtUSː5n1'Doť;s>`{^wa}~Gd AClh1$k\>¿ltL׬2 -L::ƣyj1K c3MHI`bS>m1LslyD; ݐDGi!&*=:z[vԆlJ*;Ѣﭯ::ZnR|SEύ/InTrՑ1S1s $Ʀy8ZY'a|Ǡ%v& &@h֕miqt4%k`,2.=\$*JxIArEM _d1R2-3ҏ}#58Nuܟ4?ʨ5XA*. [ (\ʯ£#$赴JVmZ<0ħ GYz 3B$(4<:ѳl,NM/wXn[yz[~>}%xJ)wE;0HmٛZ;(d ]hCщVhG?ґ)]iK_ә9iOԡI]jSթVYjWֱi]k[׹yk_]lcVlg?і]mkk.rv nAMo4vSވ6v޶o64}n7w^nO\߷9S!+G:7m<'OEo.wùr/\98Wss Gzm=B{~-׺}.r|L^t4^7^u<8u>A;6>>0CB*KG$TG$TG$TH$TP%T])Th-Tj3Tk=TkGTlGTlGTlGTsGTEUCYF`JsIGHJ}HfGZIIF/?d7S-I&H*H4JDIGHGHGHGFGCH-H%G$G#G#G#G#'#$#$#$#$##!# !   > TTT#T#T##T##T##U#$U#$U#$U$$U))a::EG@GiA}`x '5 1/T<~< \;PDUPDV $~ (f()flyF` B1#g)fyRٷ2*blf_Nn u:xȒK󺥛/j=M ^#p8sZZJNtuReŠQ&Vs}Z*S=Aoe2:ikYPEcb5$FV:C⢑ae&HAHje VrG}Ј)KgeC3AN3D"R]9nEOltӗI"Lpq'w*ȣA*K=I'NfL($+1wS5Ǚ&5ǧ;{?:{ SU(`LR@a(S-_.eSy.^tT^R@(vEyb~oަzs% &=aZgկ[̷6]p &RKQРF˫9A{^so| F0|¾%a L*4l|Kx52(v`)4$MKJt,vdMp:pٕIJU↢B <3":kAɄLUc IcQ*$!bw(gJKkߚ7KIr &ߎ;ADя P(ooO0=%l9f)3;ACeJ.4Z]>^l% XˬyB-9۾ RFŘF,c(%&FW֒%0}mJשy?em54ui:"^ "l%Zt"k#3Lm9C.Q P L6F Ygk}Dg\]aNfټ'rXAu,KzR„;_/,'ZykH[, iVw{NtZRȫfd|ּ_#bdU{%'&P'dyq|gGcxDHI1lvfJdo|r[A+@0.La JJ07S2GtƇQ\&55_8Ff/445fJsB'=2v;+C.g0^pY u=OQO̖h 3Ŧ( &NjkjW8m+u7Y^vwQw63 $x`~arcS P `[\@SrU@R$UWh0rvsy% xTgX-[r@SXUt3$ rY X&34<\ HV]${%C '+S|13P6+PQCTY3\757Jc&YR= 1.c@k dbP \PUSPX{8$Eٰ]d6zi5Rzz^!0kuHzq - k# Z"1}4K]vy#A1S)A#'Cw!}>< ? \\dTLef5esYcD$. hSoRG($UP A !yE8161]$J5"1q ʪ5gT|2@m1.@ l0%zJ[ <%AqGY{8xNrBRS.GB̳RJL:v+h^YA_DlK:"yq Q {IR) nUۓ=i>8t:4(X ȵ3 y }G`J}:E 9`K$l+ص"Q#tpGpK|ɾ1Mzxx*u'ʤl_P{l(oƩ@+#" 76qZDj' {xJ +3n妞s%n!!&; 0' &Pڤȹ}HTR90"|򌬞4«Wq" q ޶{>IzݶmJ+8AP @ FT+}2 &5f+R+XoZ"aߖ&&t%z͆ӮFz_i-  L:s WLb‚!'E p+ +E0ôc),vJʳC̤\p; I>/LD)1v'iTӵl^FBͻ}GHqjLRFcG0N+@ f Ezy7 zxzڃgW =VNÀ %!q)A =!{K\ܡl7z|-9_Q(xpB{Щ#uTvIr*Iy%9Xh`] 8M *ZcTb;$UM69̙,t|JuG<DZȑƍa|1|rna^jX_ǎJ~`Ԩ \X@MZ3?>g5@)o\t>R/-`mB Q2+,D T)U`2JZ/B., .(q#$sL3몠qИsL3ήqOAai0k9%M>Gg F%49KοS ځOخԁ ʮc`aT?N [m9p >IS#)cEXܳ֓¸PitTYp$bH4R2Lh\$̶2k]ww2*Z|eA3M1ZѪa*N-5ZQ.Z!l0nU:n++&@E̳P.(,u+ Qn%Եk^_sP&dCo91f&:+#i/ +M=JjY=Q=T٫.pTwH7=BMŠDJ|VxO\F_=R`\w)ϳZ> r WA\3cbY @M,SLĒ3墡 Xw¢JF=ТK<{P_q͗TK+W((5W:IxTqJ C*$}MsPIk֒d;PŜK עb-RUn$70`A 7A $aINg uHsX1#fp 1 eLc/Q0n=&bX kؙv.%R'ulJ3|a 01N }eRDyG|Bh`:8dCM1g~1{pmE 72YnG|NKH&&MjR!>Iº=1wd"d 9M H;^r>t؁7굧((i*rUL{3~FvIc) z#5I#jMu 4Q@j-/E’f)AŨ1 sW0Km*~rhD1$ QN20)P^gl U򧖩/'=(ZM+ 5!k47؃V]VH4+ "&_`tdEe?OTE$^2^dY-;,gdGŐ&e)#Eh-!\3Ca4bi愅2rEmaXAIec[lXXFLWa grlWdNQB+Izܪ6[QbȭԶI]~;atP'~< /2(VHܠA &{%3pSa7-Ң24k'`WߥUOLR=OX\T ebtёJ^iiO˓!@uE\kĄ/ ĸ| 5RY$B! K.C_ڕľ?JQLzu$%6Ag>a]Ļ{ƬٻB|o7[f,dNE>]<oN:!tIς錐 "x2+{Ҍm'F{<'3uM;mpFV`V|"f毫4SPri l5|*4C*A#؃|;bK3]Ge&2fSuE~!?J./a'<׉uT!5y^s G<_PmMkƉ2w )UrsixE|3l |Q񂙕h-Xw[ڷӛ B+ SD)&J*%Jf+3kSعH_| {ܓCW CPW̠O CI x}{SB+WMK%a6v5383ܕbIBی&(h"}msURP T^٪#[+C3&Lk|+I PǬL &`8 ˔ p?$c8˂`i;#;CVRc#h;6 6Q9rAћ :҈; 9m+YX@s!+hb@3hiQ5p: R&-S)0Ux pZ:&RCs;x;Dgrb`H*|;<41yl6,WA%u[[&m$j  y"z@0њ@ΐ); ػ0rŐrqA8!/:(2Qҏ':?G[ OplK"pq<skruL 򾮛;Gr! x ܪH k=!,ľ.;$wB1@Hx黗ZT )QɹP;"a_|-; O;!l+ByA^qC7 AɟjH+Ajc:8ŮK1̨)9[/ 8Qý  kXplpk۽) s=X1ePrih r{8XR@ Mlͥ  |Yp`$q#;EuDl/Jc.ˠ(>tz$$4Mb5~ %ka +Ô:=|CPAej8ztP <&KѢB GOp! x P~*~ L QhҀ!g 4^[ ՚-DS% 0h]MD˳@2 +e$[e ӈѬ_O͢>wy.`ѠՐ=@ 4}"-["v$M*jP ^40 &REiRҾMTT7T/ܶ@==+㼊 =5i{B u {Oш1eYJJմ5_W!Vŋ #烵vApu]u9ϛQ<8뗂4~4-؁5ɵ,6"6`w>a4%Qܡ֣̞Ձ-&a8Pu }q5hDkb aL`>e~H9kPj~~U~ Z Y  \Vҡ:[.1k4|ZhXb}z*[@Í×P29kK-aJ!ԌR W Rٽds+lXQ%;Zdϭ14>7{MW9PrI ,Ayǔ.*#{MiyԎڗ$3ُ,J( foj Po>~x٪~`W(oPkph0$xJ3,3K9[dKnQڬ\LnScTnL[JҸl1 6_@8ae :f[Q(i9\qO ꥧ6ͧl0%%_t Aң ͨ!e[=θ̪iveMdeƃYmfi嘅jnٗf]xix'>[-4^򜨭@X0DF_UOy iAgEX؇VQ0"]+9l7鉟X$zP/:MK S,2:vRGG`r}i"tR pWйEL" 'jJiuB2/ݿ?}a͕EW2~8ApT-Rr)Fʠո;G:%](qJ}xpSW&)T G6>[B TAm (70I)Jg^)ryVy?< {A$ӥe—@X{OKyxթieO_|c\2-YiA6XդڔOVK7 a*,޴t$~b苖T hD)nJ)QHk)3ox.GPtWjjQsmݺ)Sf\~)% ^>djE4G`N9#K:kae^8B,Jo\}T3VP)iA„h2"ŝwMpɣ2 ^CAeIttv~*nTd\Q}-cQì7#jzD (,BN U[OͰO «ؑԎwQwMZY\ iC]Fj4( ;AeĶ82#⣌Tl&pZc[-%!T=5jU4v*L#ddV"F!yB}&7BLܝmK7!RrL&E& 4dnSe Pd(g,)bR .+OQƛ0//QDZQh&)'JIH juہu%j$ msUTƫL653éU)Re&V 5u; ,;6s1_R0q\sTkShG|Fh8Gy4' YJHEՔE4bZ!}΅ נوͽS=ej߰n!  F8EQ,=ݜ}]0,@ވ HPXTᎰ  zbjŤ< UJ)CLHDCO_]GiFX;EEE"iVQEhXf|WLє `i\{^NES dUUކ^$F( aQA*J9s Ud)51MyTGH א 5el}( VA[hмPFr,Mi NzT˜,]A̚s ɠXHī]XPƬAdO(Fa[4nӸAh|ICϸ[ӆe@qғWHl|e`{ Z i]!PPJApZV!H}F<|1K{TdLcv@W] شT>2)SKZZ4TݚZAʠ`r2>řX lUk%UIZҟЗ18nzWkQ::ehaKOE~<]!`u9Ԓs@Y5qʆ4ڄlQ@tT@V!NRPfܚ`!#ăS5HUׂndwBkrtZL DOSBuMd 4`҈)Xȟ `( _|:_J[JXS lӻ6E> -rhhQF$IȚ'iUŸ&bʌ\~T'}irDcYݐ !LTp)[%ԺeVrAT\!V zZSс~´81PDBHD4_xK*7&тGLXTF%7̾,+ꞻ' @COCcͲm[@-Z)DnRx&AL'z'tl$Zw^XIPT4'nɮqvtHHɸGX CZx` NTG+,KRRa-0׼0oFnӠ,RBru\yTPOuI\Na헋cإėŔ}diJ,0)ю0t٧h*ApIl 6) ٘jq:_E~\b. YP€O^H .$Jja%O-QQJ:MI֧]mX^X.W Uc% r ]\V̑f)QBϻ=2~<2 dKljNG6Zf+:%_+:/5/ydP+BdIG'DğN{_u jv b`(Q*c8)ž4{A錂$fO#/?dI% y1PϻD^0X2oݹ̕] `(ilI pe<䩦2a%y.EZpCYK (ɄSi׊l0`I wB_E8a}BYɟ^]iiŏFulm)oXEUϚıR iyz0NZф네.8Hᄢd083+Orrx]Va-50A{@ |+96:Ǔ *dHw JH̴Ds|lQ3mom_./P>n5(q9Vܬe1ӘlYqLCc HE!2D%|zV>]ZGZ[v5VZA /Y(WYřfR 85 qi4Š"/zZ|qZSM3-5n6["D.k[py2WiPʜjr̔%!YCL{FLn Q t7\Guǰ~.^-MH6+Y4*SA9}9! R Tc{rzpSv+lYL6NG?e6nmo3?ͣ׫Fpp Q)_h_LyC6ɤNl(,m Yj4A)Jw7NF0J2x*FwgEsFﺩ.`,jS4mʘpsKtew!Њw @Y7VR{Al2Q^yfj.  |yڸrV7"NjڳRmhw䙿`:aE4Nc9.VN`I*΁󀗛rANtLҴ,$[.@ `;6}m/=#:vÑj8sds!tVm5=e>m[GPm`X|3qƬg%[g;oA%(D4 {E7w0ŪFψܓ#i[F) ?k0_ ԇ88nMVZ]LTSW 7eĩeV)4RCUM(S|*7Ť*>(]t/Lt!˼t]rd۟[ci}BEǟN@Кj$(0 w,D8!ł1Z\!ćV S̛+|5[i^NmXF!;  &řҞV@6f4ۭTY>m40_<嫥}`"`s>p7VN-K^aHIѴK.Ǭ ghgߍtZTEeД(筩GD (L@vrM`*tgPC_jhB˗J{L&#Mpe(0s=h/&n(P8)ո%ܩw`uLzaЍ h˦p?Q:LDX*8 *ke%־]6E[ u:;HN:RDʢR Zb\# C3QIXs Xj1ρRhE1'(TJeB= p`IC5]L#y\oȔrqmjj"-mS^`R5u0pNEA% mJB O03ehHӛ]ts`bh᤹ $ʸZF-VDQ>1cEBM\v-/ʜ>!O""G Rj0:Er]lW':I)v$,h$hrrAH*Izӳf5VsZA8|Dٮel?&2#rA^艏oJv '+*ntG%gLcو~JZa`ga+[ABDX3g`xVPe&Sʖa4@EűD] l%ql֡"F] WX%J/(`r*mujǻ0z2V7 D"B?+ OIbs414jb!_Z`pfT+b}@RQ2i de:^c>qmCPH}rNjōVfI QSd fI:XЖOD\I7+{QebK^qFy^!%/|=)Nl}4‡ Ӂ tEJ„ЫlRxC16oxސƦAEwPhR¥*$w32*MDGZbc<<d& T9m LCX ~7?bmqʘUՈLdm'9x L S*%i[ *I hЉJԲ # r7GcnY"amTxM +&)f2*g(Z })uT؊T!F+'[vض!bٱ%=Dq2r׾R xðgz7nU9ش\k+Z|=˦Ӝ9E}ШH~p5>RC!2 B&D ZGwٓ-*>M ab@eקWM85C^¼6! L6*3e0~&#YKTңu8G=F֩J4%t\!a*&2kU5MUL}eNqQ:g $D-*f@-FLZQS|b]\%3*2&_O%ЈlCI3vm_%%-yn󑬠S)m[?Nn\|"=w-uEFAu %@Zua(;@^:DE#{Ce|hG&!FH,NΐF%/FB =$\L-PΌV%pԾTI{Dj,fpmN{b{o jF,풨ClxO2hmmrŠ+p䨜/dbdbuioc/d*OAjԈ0&0>`f|bSFiL 6i"b^lZ1 -%~1\mٚnI(؞moB榍KEW B0hRP7o^Z#y&bݰ)^0a:Ol8MWL[Z:wj"o=Fb/ef f XL!",& % -j=dDZGdЈhcJH%Uh%eL襠n cHprʐpB=AV)_I/F ͮCOp, Jk*>դ RiRZ*DDOk vb/DTqE M$g$~p%eD3(n.dCƄ@%Qc -tàʥ| p8c3gXA&4iɒ&-,L)@OF|b"$y<'r+-7wO2+*.&2Lb^,Z(Ͳ3SiLT0 67@&Rf~&r])Cd.-hE'Hr+Rp?"fb&XQQ. . E6`k$ld"0#Q$:ihTJo#+`&39<5_åM '#PֈMyQwqp }hF^ˤ :V0"+ 6 I054^BUi #%&3Zq rU1hAc1YѳT&X3a殂.l^$v/Fd$=+lHsFLAQAkPe,4mr@tj}Qu>0,WDoFSd+pT Q#7ĬdsmGFOiTISHX3)J'Nѳ6K1.IF-8*FpDR&"d$\ mT>(,Ps37kav!qQ"tq4U55kg00gRp*KT΍omFSՃ%B$y݆qccI{Z&IrpWP1ctP0A< BMȠ{%'ǎ<"/JPB&=ٓhjrc"%N/uP^xuyxc2*fi@,CPCuRcގ;KXE]f;>vq0v@RDHގIGGVm5|DRvD!lQrHK' q.+Oz ja/c08EDuY9#1(ޜ jjbH*5+O]ooXkcTPrVQ#RH.p6}EQcM+V܎-4ݴޞ,|#Y3w1AIXq/v,<tcp$?{b樢ƃ5cmV7=W")6Iͣ=ddHPYytSyO|z.`w҆uQ;CLP<Œ"gLqicw~(D:"eCw`ǭS$14*TdQ(cpjf8Iv&31XuUBi]觨n*40fF,)0uv8&Vvlks4rpeS5V"X#8MYZj!䌉.J^9cz0.y9qɴZ,YKWј-hjU+41tE7ʕWZՂ2FP[!R4(zy% l$ Y:lXwyycM\:;{94gye B=%{7(~9Σ_NYHH~Bq2")v++c-KŸsöyK%]:\EV=ù&[M(2/`;qX0rqNxQSKK 9%.@:8+}UIkkuЫ~Rͨ55XvT̘ETa02oNt?E<g ]#ov7)bLԶ{SM#h⪇7tP%kLGy$k"f;Wwҧxұky)X=jx:lmE3Ù̘dlh"|4Aehɦ9K3dV %(y/Bܙ0@K1Fbl*; \ {dTQ]_-W}|A[%ڔo ,imc'S9ʚcs1$'Q Tkg/#>;(с\\Awp 0S%ZFh+ui/!5O "> ?;G"gF2o0e% i#8ANK׬a:e'JT6lQq8X <c fcƘ$3SD;a*k-(z( %Ft80T $x VYr5lAej0t uvi\(ʅܺ'ZwJ\΀ 8}RT+7DR6{3h;8>m:5զL~zDŽAʾ=a]]g͔ ;o̗V>ч8ZO`ۻgLJ=<Ƀx>Ra'P<}b"܁LeM`%%6n'Hn:H56[;`r/̔N}XZ%ha~f Ahf _nQGBvdeQso&/IUT:GTVB6І d0Rқ ŧG/K7)h)Oz)"5QQIt!UUjkV:/iE͵\VoI{W%M-nEa.)XF.,vVVe.kmq\rufH J i6'ǵvZ IgþT5Ίv'PYlxw!E90#AN9Y6Z $dO46tq"z" *-OM2. D~ct_@j{6~4N0~D-`YM&&e{oh&G8mnhV%a&f&k`tD,W%:TYzQjNGmTG;pg!iUꪡB+01E>WbI,: )B=CT-~=K-]{UWsnRt)[1K{H>dn򮶰k̔t"mJ!q.AO r o4%=PƦ`cCʂ\jH F5"ibdذt" dtfY((k̃n T8υG+IqTZA)n &k3MR55N‡jhGӢxE.NZd%#Ǯy,Tdb+9W 7Ik˹TSKmr+3w9Ŧpu9H<'? 5oӱV=8wa $69&tԊeBյ![;hUCM~ L  knAN;DRto[ċ]ԚHpQ7EhkU/kt5//F O9>^ #x-L`!j6@?BitjM r(: R5;Mx!g+D _HAXond#: dg>i )C/rkdd<#m4#UJd.w/v8{&d-wNOQh52`+g'p]brX{Y:6 t/a(5X#vSL[_(/Q\5\z_Tat,K")qHz5(HWz0{aNt'Ǔz4g AD##R4R8}n)"Q5H.V4B#&J` )K⊉AR~6nT 2nǗ4Fpf.KedcirI@ҸTe](@bVI)X'xP&u␀a2 >F<))(囡uFh5lGHLeY+d1\ibMk҆آMgHZ!X@܆:'zx{^Y“K?و'p1#D2À58nP=(d}܇o4Md0&(? TV"&c ' WE)hrRXU+N/7x\?>'ԍ9g?9Oh7^sugOaMaq-{aW\ ZgA KIx͠` aiUJXvYh:&yuɨw=d!Qb6yDuQReh;ǩ6 n,Y]zCi{Ŧ¶'ibaB ˇ3@eȠ?h3[AAuz '!*qOrh"%4O3A41bJ?ʀ9rj@Ve2WH%W38Qu_BZ(uUw:XكXpQ$+gAyY(y )1?IyZxZ (vzYB,Xh9;KLj*i#Nmky6YiE&OmݦIC4r|֪Z+Vmv–ٗN@23בhAV vS" 3UoD``(*R3}1(}ԗp ƲTgbK aUEv&SJ ˍïw6'Gnu;Wu7t[gpw-!6)q]j \3@ rP(؋_vzj0{2KYu֛\W4a +)*zOKybʴ*CR0ڵZ{PM?Q{r(U$Kws(u Z |8ky[B&"Ҹ *a)Պ1i B֣:eť1l2M4fs`"&^|lVtcJR?`Km%(3RO;X /79g2usƺ_&kTsZS=wumbRhS)Aa#-5Tvwھg'ITw;:Ka<ִI'͏{v[kD; bڔWU_]\!^Ys~g¾|!,BB;@1SX!։+,44Q3&wܖ/;T9|z \E=l1gq+A 0[Ė[Գu&<=s#:`ՌMie8ihbLQ+Ƹebmn=ţRXn3=}+UQ]ia.Y#L-`nѱr+QpԥXhK='῜j֝Fհ*_L 4amù*o6-7і8{AA 7S$J /E^& Be,Wk8͎M Y6zۿ9sn㛑)=2g7 =v\iۻ$:A!=џ57Ҁȡ5.=n{ OR[CA,i].R+o4"FlPL ^Z ?Oc;Giwlm3j5@+3ڡ.>UA#6a#! $>ioT-dIչ>dG 5tmQN9^=kk=9kgcs6tn^T1\2㹓Ӊ^!wR2dJrT@NM|_ߩ8oˣN;Z N^a2-5;St>R |(|:§ 3C C#o,j% SB .P1PD;q9xƒ6+G`eKat'1H^ )|RI*tΗRjj#lhJ:2%8] v:Q&t);aΖJPj -C+D RJJJ. .P.QK%_'MP:ZNh,V2X2 8bk-Vdsu@h͛HK،ݲ-mxҌgڵ4u]2 ɴ)γ2{ <t5{w^ n`S8a+p) !5pƎs QMrЗlT7bkGGYC`sHQhefHt,*iVF$ʧKҀV_b:$3a Wi)F'TI'QJS[o+.U6-SR+qHjj}Lu)w=3S7feO+L0W?3e5 B|ԋo0u|.P$͛W.tH 窗Wzzzo5N- _x} l#bp~%| _㑳#~eWTdHfkFi0{ 1bH$J4hM` ץ&mKA'IE.8@m$#dH&' -n~Sj mN1JPLM )ڊ(MaqbX8Ncz >T~ W -*8h9t>8銆{ldc5cu2nWϔ l^-E^c0bѝ*_[Lk˼J>=X#0Tk`T%]cR}\/uY?8~)CIB xe@ HbX'E&onjRMD42~%+iS'w"k tļHXDB3׆'$՚KLe)ѾQ+"cZbR2+]\vC c#] 2s.sR3d E0׺r2I C1OIVSU ePd ɞILjrz2%Huk{ʤvŒ`k k_t1IdIB'BYN4Q;= Om TCM ɉ Ffl6G*-`A%#]UIw "fiʪ!> ،h(?BbW,EQNUKō%Te/RTTiuT/ղ+V>QWTRfV3wiF4EM'Kt9튚Px(Uo׼5È[{݉{"_;)k 0qQs/g?]\gDvIx/~ k}U,~QIZVmQs\.ֱ| dIwY9y /&}h*W1G:_VNVYW*9fם(dZ-MZ@<G Z}N"c~CI(H_Bcš;4@Z3&@͑ И)K:7:b:" #ؗ 24*yZ6H1+xh;^3琎L:tӞ]71~=$,,j2;9Y@=+-;{,jZa1#򣿧3"E43ӾX"9-#9C4;BD9.?R(F+:Č"@"2;1Ҽ/)T/ +Űr sXѪAтیC$i: #o(%̀ PvEΩ; PdYVѫ&ƛYEp,Q8 ƹu4PdU)s45@]BĄcRrFS>[S#[-Wj [3mE:Q*2SdLۻ29I5e55@S$Ů#ESŬUSm6lsTm?|(i)+mT0]Z$QuKm9sgW}U]37W5Q\eZ} ,]\ZIy܊1̧-/M,h/hE[K-mm[m'@;LvL9HnD_ye:b@WJ}`O΂5;.Ƒ/j``M<C=8ؤڌٿX]6|aEXБm Tn m%Zr%Z#UڽL^'N{QpZ9?b*[keE8 )3=㰅6>WѸ *঒XCMRS/ Sܬ4mӪ?89(ŭ`d߭zB.T!gOz'DE`[ Xxl9Bjp]1* %mEb_B%Rަ^df^9:cfb=櫸_`M[iU[=>25jW$D0= `gf~>3V~M`,XXNGN`Tf ^2`޴UiQJXl)qmd|btI D>ܽI$5E}WG @NŎJ)yGaE i̶elаQ)ZlV|%NfuƒsQ2%MhCf8erG(\5sMY2vU? %K7x8lgC~|%V΂f^hrhhҶ/WSoONFNE<]i$Ƌ;Jʈ5A; %HYVe G '#V-=]mOqĒ^۲1 XjϾ\i8 GȽQkNĽCvSf7}S::0Tno-dNjN;G+l*6Bo*1w;95ZXc.^mI,Xr,k+T3Y5Lq!Eb.~Z+BnOnzzCEW6hU?6ox"-ɉ-DžH]ž#<ڕYi9oӖhwvhוŠ1sU@wMkSɉ9X¶ZƫYk$w:>B& Cܗ GNG+O[_Aq#oZFNNK bEuhMgM[/|ngWtze2NuWfӂ&zWX+v eoBSWDŽ 6ŰJ'GkWsrc6v>8pQ$#q*6lp͚G)&q/Mvwz쪷xy/}}[{&k(xSN)Їu 2pG}۞doOV aՏ'j{U2F~%VGyVNg•9/wġozK5/z uC@; pAa/Z̈qcF8,zD#ȏ#MArbʒ)I6he̊$gV1gE>'f (ϢFrH(Ӝ~D5A!,;LTc]+j vRc1Mu dm*w.ϥe^w/ݦ|# X/**Aƫ/[ΌyΜ?{6U9Am23_=:nݢV˚^c-<8*4^|ZƆ@%xtڿG$(1CϋO‚/|O"Sֿo?~BHHMهXQ֗VRxmEKmHaYuaw)o+(Te8cVIbcj;i6g #kGdF;e5^\Q4^ D,+Td_*f$:G=צEl k'v)sډ%-2L[7]|ꉖtAA Le~0%ShL VZI^]]a)]eUpug:J}d7rȡFpo~jĄW G35DsumhKᬔ6oۢFsTR*Ob %a]q8⻫dyi@B%N) #9TDH֥V3ҤGB "=")WHF]:ev 渐}Ive?,)2-2Wz:A[䲩nٿ*vV1 pUWyz/|!*/ӡ4f[4J,ӈ2`1t#Y5vUlYH{6 VJhB-E[[(7nƳSj \>= jw ]F2z$A+.Q4=x֋huԔx.jeyYWjuMY˺vz]{Z SƿV`g-_ W8#>x-pps/cѪ͋[-mkbUXnB5™8=>c %0 Fm0 jf6LwjJIh.\ʭʹQoڐ膰bMԹO@`ٹֿ`t`6YD =A$AFҨEҖ@ `PAweP_ jQCBDJ$D~]P |0F"!GƠrfAܘׁZQdNlYWWN#{f^iVO%d{ʢF1N@M!S "c!!桋bbQneS F`M,Xcr2sFg޻闯w xc1b"79+&&u%b^n,&dz/*bk!j&gzuQh\dV`l|Q9(D֍JSnXjM꥜s:g3H`V[cV pUV1{nœT'(٭g,VOC.'J`dVogeFf)A᝾RF MDHxhmIj*~kVam452kOlROVa\e+ЖMfJj$驮UF=:)hLӊMG@qTLUix&,ez5♎)ve~b6-&Va*ݜ04V1#WiР UpZ#)pmVM+Pm&͈&^,ecj0,^x TeFAj"Nj.}`M&]G $IƛR^Ԫ6+gcd$D"iIп&n",]2͋Vm,!Q+j9y ȶ= rBh"hf,-yi+n !jj~֘& 1YjzE3ήY՞ ZHuE\M-}%ڞ ~؞W_樠9J̸ &( Ɉ)/I[ΩolmMe?ʲ T/z (ew!%J^dhԵa`̞KJ+3I0ch3nip! iF1ػbTMy!fo/MaD莆#dA Wp9R>hP#򜫞T[hƭo0{r1o !0"ӵ [ժ3{^Np]1*׎)E* gxP,HP00ς9Fo %,cq-%Do Us㺋*Ю 3asLr/EZMdfMfyj2 DӤ#O 2;o JG"WP}a^"Bj@vDV: HФR/ ¦W;{$C1]A e|fNEcØ*G1CS 5-G64^_-QhqR.O^xO05>Dm "_0*3/Z-n*.JoBiTYm| Wlq\V 7Mkm0M7FWFd^iE=ڟ&nR'l a+ *0vDOT[J.ΝՁ0yHrQG S35LQ .1x)oG2sҊ &jUk7 24크4x,tKv>6n&d`?6o){ja/+vL;J6Dn#ՊҠ [v֒Ft mΊt&!"n'?Q)b7ս7}MzGWc=TV?ؔZ2R /_Ăb MDAy[MtO>zf.G3Tة LS1a 8sWq1Dp#R՜#G6u/mhO]w{Bx3'vӴ }e8~~q'8|j ƒw4`SÇh"BlHbE;06رHȐ`Ĕ&3cɘ.lfÒ;qyKC5곧Q8'КiN@k^$*4)֙ZvUHUJ΃Yʬ(ܬUʅ zߵ 5\aʼn/vߒ%W̛5w9'#S6}gՠYvulײywi 7E8đO8|p^O߶;}'Śy}C<8+½ 3oآ˶wTgnOS,?jk?K( L u "24.C PРC:<R/(Zq7tA684GnGzK۫P2R[(M DgkT?ZG4 P6GӿsӒ7wU\Eiy ,&OG SWF߈Ak4UwaNc93FcWG1 18de\ farهSff2%*Uj "Z4p&Mބw8'l' jF8_J{Jw6 / ֛}tSyF g=վ7V_uUK s`EH8,qNffCVԝ!q؉)M(|==.Njq{7;so ^_Y^r(:.5')OSXA T/rT5u}Ƈcqks/̀KњUJlТ1n]d>mQF(M&Z`d<0yzOf6*w,\T O#}z R)uGUyed`@)&1"ǡ^y7JFхT3 ]蚥H%yIb'G*v`GßL+ru}쥻M38jShHHF8%Ͳ<#(I=yv -DVRdc+2s ԗRe]<%0 E/de0IFsDx@<6 ]/@jM jSL@Px%QQ&sIH2nRZW%;Fʨ oH ELmka ú. ]LJv vTL,'GC-gI*|+ޖL3*.)jrJ R!Q;yi^F)z )SswJ "' $=y;X|L j\?H=!b9w=yeeZS \cbҿ}5Q|Lby ckRkdٲi~HP3@f#D%h^btnR|WCXƚÁO4([$-MCՆ4-9t'dQbswV) [xTؿ] ì,g̘&Y^G_t.k"+lN5A><b J"}oi,#\C!)aXV|ldFu6WY#7#<|u>y~{7|?}n|;>yϷ>{K^qsg?oԏd/XOp/O/l2o5Po|/ 3:,P0,PXW0[p1gP]COP 8p ox0 {go EoOU/ vp }pbĐ aOoGeNHP]0Io. 'OT  0pKsiuQQq!!,@##T##T##T##T##T##T!#T!T TTT T"T&T2T DT#GT#GT#GT$JT$HT$HT$HT$HT$HTGkTGkTGkTGkTGkTGkTHkTHkTHkTIjU_TUkHUkHUkHUkHUlHUlHUlHUsHUGUGUFUBU@U>U=U5U0Uy*Uq&Un%Uk$Uf$U]$UP$UI$UH$UH$UH$UH$UH$UH+UHBUHGTHGTHGTHGUHGUHGUHHTHHQDDI@@C=>@9:;$'##   !!$#$#$#$$$$$$$$$$$$&$.$?$F$G$G$G$G$G%G(E3:B-J&N&O,P=^KjMmOeOKIHHHHHHIT`h!q(u0pElTlTlTlTuTTUUUqVmVlV|lWqmYllUkkUkkUkkUaamHHGHGHEH:IEhGkHkHkJj[cj_kjlklkullssllilm~{❡éѩ֩ששששש֬ӲݴH*TX@@Ppd)i0CG8jX`IT9*)|UaD\.RȚ\tIE8#t8աU@Ki%JN^h5Ub5P%3iaP-[rHٺuLxƢj q'%j;U3up㬍JTN 2SŸ:\.UׯaWubmu +u8um4۷.УKNd)ATHr 0 '\-rl]}fնTPy16.V]`)]iI)eUmyD+ŷvq!W_VYFXcM؋"0 0ѨȒY^RjMYjj5%UMhaweY^pax`VvY`WEvojipag'vQ4A.r"r!U9B-h!X0TV/METLJe[^4ԦT)hg-Z vjX[ek#YZYNIhep|c7ua>(Z$F`)(Tfnv[5ք[]ժlѵ+E.ԫC 2㯿kݙnwUX2M6p2XcKXs)QuLCRVŴ9uN&h)! Z%sX?QXnٜi:gSe],L'M4gU(k5cڏs\sg^rz9rM==6khYvYğkF8|)puŭs{:ٽ3\Be-MVWVRҤSAc+"ʢ=V@֜H [EN]Q6t~+I5)vlbQP5}c}bW} Wy6eTr^KM$.ȯ?q&OdBwiKʆ́yR-/O>L!Tr0f(CBuPK- sH g6ל6*#ak(3  !bߕFT%-K[ҨG[7g} PZ%wZ?_Ӡ5.yP"1IQ0y݁HV5k#| ؤVآ UZPcUWѓܑJv\Nx;KWP1Juj&>#$Xm3Q#397A^=aI>rrY7e"IQg .$/9 #J BD';o0xbŽ磪 )ShBbJsP8rLzz 6ÒU"fiKRԘlR". 1oɘɳG5Mb*nM&vl5ꭜ{U ܩ_@'T_%yHmbpm&QE@DI$KJ{OY\(oA^N K[0v"v*3d)GPUaɳ+|\ h"CUz Ӝ sHKqtު~lFs ^!gu*=(PwY?9cWNCpEoC!xVӃXṕpŽ\MdAa'*pItUz ɩ"^mU-hc}F)Y<}fi2FǒژO6j2:P]0Kdֶg#IOqm J9IT ."HF(I;1EsCBų.!*kh0jChFS瀢<#` 'aKfnT1D!L/S8 !Dc~I/^v>Z8NA;B B)E':F*6MI0R>֣(!r&_UzM$TƢ|7^,5ykq'IyҶ9I{TT >>\l+U)ٰ DRF>g-hyz!a Eρ*6HhAMg֎鶯,q2s+ɭwR*{"'nW{Yi^9{DtzTqpe@f$_cv#.!IAg'NXQu ;]ggt-Fz86y{;hnwNXi3ag?EN{h34J\Tx\ Ϡ߰\/ /0 3- /`u5 3P!]clm?l4:'YvFzVR`srr4iT@u$SADfW T9%8-Pp%pk}2!$K$+3q6Vk%fDS0U3,_#O ߐ- /`3q/* PW"2(,!crBiwU@Gtm,A^3GoY6l(hV{ts5 -J2f[1ـu奈(v17^ ˰ C908Д$Oh<6q:Ŧ^?[/kwMd `kц8/y 85&^hfQ5Y!vNEe,e gy֕Y<hQ(* gi p8ϑ zk@P<DZY${QC3hF{8r|7V%* 9@ C"|Bpј!g.=ENQqogi -Ve-A`-2ٜ/p8so(oFg&!Kq~U+ 76'dIo0 P yࡔzP!JPTQTGQ#0Vau/S^uNW{N(.-7 J I) 5$NAW#WR5 ştzz9(YhAXz75ƥ e"UOϣ8_**dZ i@jIHAq -UCcf8).!qhRS"j4vo* QzI8S ZUxc9Ey g3(G2*%Y"!>!]! H3{ q 04ts5h8LFD琹D3/H* Z k zd@ +I9C!5QDQ**jdGWSX>?)y7"bu9 <۳>JjQzl =Xhu#zX?CYDw}8Ī}uC`#;v- I9APuٜ2nh*Pxv#45?]ye^a^z)yz˘(vPI* i`J i0AFcUBB4Ⱥ.:h BD"9soc8 氳 vhZGGj@HGWh4N4a=p0JA72x.UCXCAPj(;"KAPߠP&y0`Հ>~gO8۬8PFqdvB mAKzI o@ + cxKQ#Q!+@C|2ZGR#е)R;`> F̻?$0  +GHmŴX_i30pCI 8cþ8ke~;Ģ 9D`Ip # f a>7 4<ĬH6JpA 5AH@]Wt^q^'BQi'WkС\!OMʃ1H[X(2\'X ( TJ($ ҝus ;}= ؃] inغ1I(XXÞ:YAJǁ g]CjƈR Cxbl4ك/*"!lnWv8Q8t(Z痥La<AP,B8%(*QTbT (TE2PD% WJ*TTG6XPCZ섫şEZTU^]ߓ&ToVTU4^ )īE%҄˘`cGjR XRƌu*%ʘR.ZhK**\RVEN]ɘݾ f̚Mֲpr䩍)In%'IݻJ)۝NB})V_={MġG#{򷩅/C!Di)cЧ&n& kH jD|Sa|P1{'eO&Q2I 0Q SB.'IĒHzCK(-'./΄N)5;>%+ jЉƜhP!( < ѤH39rMP35LMZ{ -SrM7AR4EG5Դ(">rL@t3;](gx8A|tl47|g*bױ&T#B!϶žx"VI'69BM'7fFA>c79Ve J* Ы{ҟD 0̠>jT㙮dƤ!2+f[^reD~ʟ(&*R2i#@EVS(<ƣc$3+EꑨM:d%XŪVKHU' '_-T.ErI;͕:H!j$#Paؓj3"#PHPC0 !WaxQlߛ JM*p -(WQ6]B%U*";I!TUF#@"n(HwQ[f"-R، Ϸ̌#]Y_*<]!{%u,hʚZKSW@)MSjh"}Q)IUdLTLc+X:tdj0@NLj qa/2\Ξ'U1,Xh?CY2gs(r}y 5Y6M]qzi~;qEg*|fAa. #Y0sIF!#(W pXŲጄ.tDTsq)ơ7 f`xBlzQ# #d( ]WPz1lN\FMQlin}F.m"I|6"T"t$ZpeAc#]$ HM˒$ ѯ1>|!"ܥK!,20ݐ]0 œxz s$?"#hawWg2~XVzۖgQIgTQ8Kh$25O?`n?C>@0eY.CԱB'(('0&2@;>[(cj'Z"ɢ1@УR$ɟu2"x9,(`Y`=%GIJ2ٺ@sc󞝹49.YJU04;@a+ixKۈ{5\S(O.ih: lD؛5K`+>A:;Q<,92X9zJȃ<#]4*i1d 2sr6I:ڶ1脠ѹ] kK'CN!J *7 v >:8:eȸ q[ C\Z;A$b@AKc( l9;?C%HlkAHLr AEË9JJȃ&$' ]hR'Xj~Xږ3 +p 5ٗ7C)d7)!b F3=K3K˽LU<+*ི6EY*<=H EkDH$+!*KҼ;3Q:`*zV$#+r;c"̽y+XVK*4#+; 5@\'qi J\~c 99PPdt3x UPG먕:hq6[k&sBz3y&xEan7[!OC>tPH]Z߲!ԋT+҈Cڷ` -j{?z[>Ci079YQ]ʐ9JHIH&q؅2*%cή9";YY ) I4Sl!` )=YPS\;R'c Pv 7 J2D˔Q\!+T2:Hta;JA"(5Wy0P7GBY@E#5=<L:$S)J21N5#8ʝ7ɬ~ND(άRJ,-VI-47j𠦻-%cxCBnC>,<ILOJҮi0C?pJP"wHԤiȿ=zd Ќoe$,=8&B؀}:@y9`Ȁ!ȀR$i\|5؝5(hۉ'hۉ5/#p ïԄ;|GMj# { h˅Ġg:XOP1B () \(rϋDI' >;TL A *R8p' MBa*>#ڲc` S;5]XTUa4=`[:>~Yũ ͥwEwk(zEBc(ØX-?ˠx>3%-D-ӻH*TAs_MH? BM㐊F%Xc;ʥH ZELZp[Q}s9GMp]xjb s!S ;x a 5y ʈ ]^2i䬮cP(1JX"jsP {X F*/I ;J\hu3BԵ#6[ XݱCK-F/Պ`$1Z5S1{;?"ܨI-i(CI)[F!ێQ NL 4`^Jڶ%5BA #RtJb [}L#/т1&5RpgvgА'9 N0jd^^P9 E"ϥ8SCNd&SW>ƍܐlU j*E ٻkPw&y1I!#8> aؑCO%7p5EQBjFb $ztgr`P)w9Mn6w1D͝JB5sO=wPU-~,GXEޏ?bV *IUر5) ).i{ CC8PUjܛ]yt|<2κ g}jBOF); >D WTMa_DXmPٲ\U1F$  SPmz! HfyrmKJ1VR&/!aybX=q=6P$C(jR &+ÙtS&t*"y?5 Fu)86zQMVpג*T!C; zV9F-3NtVb(dfL0FaMrs2NAi#j8 C\ET.NV"!'ED ː3M[5c& JA-89!LBYŕ<ǣ_NJ!TURH+ԫݎt}g%i+Fj̎ +hA˒z%y6 1nBi"yr :[s3?O Y$,CQ>i:QDzC\J@󮽅#P H:QkZXD00$,3ˆTT.4R.+<EWxSceR49aWEJͼt})!-)A1rRh1ю_ $'׺yU}5|a@ƙ9BI:J2 Oxjg2u5:cם )5*ɏL0ʒ^jS}`n 0:y)[3v$yMt'W#Rw I Ħ|?;] FScH|%Y?m*̑~ iB/lH },9VUzsen<=<$)u?lT:ՄSWTDñܛ0{,UYlRf UfP=[%E 1:Lg:6FFcέe(ETA,t4 (` 1^BopU7SRDgc2ʬ) 1\!]yuͶ ]*QntL ȭ=рeu)mF[:.vDĤإBre#ylVX8OK*N'k(ҪxQZgqc(3)McMsPN)ޛv2 ՞O tf:~K(ϊ ICԹ럄#8|'X~PA)+ >uWstM;Ce@2AӲY>TE}\ORba)52!wiÙp(Ii"})tev;+|T&/qX7}Dax5 P_gO|q.+Յk(i G#ր)R 7(yRZ2=ЭZO.[ӍN#g \\!BJ)I)Iۗ*[DEM2)Mk4NS̐vҤ| Ѫ8`uVˮDS%J"Irɧ$G ˪ߎPW;ȉJ@ ˀH`J$0JKطE r):d&P}XCx}r`%O50B-±5J}pN@ߤl͏~Wm^ǙԖMp\JYtUlLWX$"yJJoKDYH'b]g[0AV]O̦Ş^ fTƜb9mƴXY1#~4EfEMaP0 DկJ( 'iZ a_YS\E4Q9*d4DB~Q.5Nj&(Ml~bDhXC bT,Nbȧ b$T"܉)TG쇺N< \,y9 @81 CӇ c@OX\Pܙ!x]EX}G}0L\8X‰wdE@JK] ,M$ad~bUtDc0U,"dMA֠ PhOPSD]]Xq(X ytdM Kl`Jdcm4$#=٠ GL#pce02ٌ! aV#-\4t$ A Q:Nȅ\Pϸ(Ng^LJҘ2[%ხn,=H8 FEƎԒ7ltPXRG $rJ^ ܭިE"Z2ʈ=`jg `Zi\`uqD/:^,F|s~1Ԏ&py: `}|T-!_fFee_aie7gCys띇Vphc&1qjߞbJ5lrq21S+u>ggqb ͪ eKv^*L p^gTaPmE%%ҫ&{F2UIEQ(ᙛ~rXv:EL4uS֕BZ٩qadcO8ʿ (wow p0vFD/Kv8yϡ)//! S(]=USFtI-R )fy p^2hWn9q0Gdm_3`Xz(ݭZNشr*NEjjr47/.%ڱ(ibdV1.JˁEcti@'] dL'Rd8nI>cUo|iM9Z%թFɔҘiO;GD=3ޜޫn!Gw`T.3sNiwlgU`&7y` ylR1 zgpNIaw{ݛy ׫ECl I#m}C4,ТD:s6\Wuaj֜G Ox_9(Gc  CFD&S/; ] UuXyxA*6Yy QtѥZѐVۙ(// cЕiB|rO?M;?#YxIX1TEd:As3'@*U:L:c(4։!. dĨ1A9#Ȓ#MDSE`JQ`,&]zZ!ĕ fs>'{q>|U>,_VF_S/'|~:n,vΪzK+0" PD G ;d !hjz̪>m6jqFH< 0ɺnơHlD'mB'3;=8ɼI;(?$@x |WssR檚#}9b`*O EdiPR&(EnasQŘ){lMCkd{g$njގ&o䆩j(|+-fzBz67-B*M gJuT!|90R@ a} Ggѫhcېd(7U>)ͣu5J*TܩM1몿: XÊ4K Y,K5\VD/;l3=li3F-lFc"Wsku? MkhJ'́о!:Щt y0W2c4aԱ\zP{8H:F/}EIHhƙhbZ*x"! gIąd[H^bވ-+4( \Ep;GpS7-J}FY =%9pàL,(f|98s"%+I]*#t}OONKc.!S`F2WEYRvc֢jfؙj\oĠL<&+]`HkhΪF%hs]SKDG!?S̶@G4]MBQ/YḰOcĥ/ưaf-.PF`r`v%6&a߹^I*! B]L iTKF M_7O;FYd) 6(J#& }&bDRU%dA>FZㆎ-w#+e x('Nijl@gv{/A {\m?[py7N 8yi,̚9j(0* Bq8"]UGCZLL᭍R<0IQ^d^,Hr6fZ N-s;&]'90]y&MQ?#hklR\ ,Wքmp0sieKVֈ*.#* R^6)HrR05ǨL2)CdNHсMHbu(۱Β28a*UoS[>OK;26k{WV㺢*#OG9M 4w[_"6ìHusג%ӂ$c!MhH+9d$+d QTN,nZ u.?Bo LD|߲v3zۭǘC@eY @*$i-ą1BB^RE , ):R(F&Dn # |?IX,/p5LtBHk*Mp>ZRrrp8LCȄnp$쬬FmhNچ2( "3@ k!" /rd#<tA(D*F\dA$,}̃E|C@0m nH.vc^¾(& 4 H"΍(!5"9be<# 0pj'ф:dE n*.Ά 0+o,yH\$.*rF l1(> D2rnк0FFzb `p1#mjϖtE"XXt(#+"pa BB)%W>L67q8G0Ć!PufL0֢&L fjn,(h2( A:N6)+J!L$">gdn%lT(>tF&062l *6n8T|MB7XppІ U ]E}$n &L`v$J&GijaFILTB8N\*d'*"RJ4Ldom"pIw 'ЍYI>cX2Xc>83&͂<3`luIU5,b} S 789SgqTjT1:o15$b&½re``M7sBR4<Σ ZNJG!R!-HXU>{$Ԏ=2/#s1w㭪amVmmXY}ƣpabƧ-B1 ?z%d97m~lN*W*]TF E[* ֟enDb G-60˱/B"$cʬN`9@z,i2e+"-h/S:S%ZTO'Am "RiehN)@" -$kF'VsP%/%#naSS;mn3smAUTQq34T%sǀ|><rqWcB_kq0e]O#tElΌUu [ɶtPlL o?tΌ^_L\Ɉ^` #x]"$zP+ R{ &oqFFVc}4col*l&0~! >$+4cۼC5j`-(6ftrhcDDZyOI^ƍU4:  nc%iԵʨ<}jh#Bcj$?XdA{ B (!&${va+SaQ0GGŒc+_>]54\0}Ȳ& ;֨&7'/}v[M!'3dhk 6Y(D$٦[6lWUZ ۩v%<D㊫nϸ0aR%oj3mVVn/u%ԈoY#T'¼r|""v35L6쉯g ףГ'<:D7 Ccg$h.M t[pA# e'vucU^ kw骫-w'4Us+YA[#f2dMzz[ "W|o|m9}|qjVXi'sT6'L9\Jg֙7uQq|TAN (H!^[e>bRhOCUϣ6) nkiȕ 9φ{xz8oA0qG4^sCpqsV+B%X*Whlr`/Y=;$tVhŧK^& { ;L[)XmfP%:@8-{z"a8&\t?ׅ&]OW[ PH+z*e\a{IgƱRPy-jF򖉼s9\M&Sɱ74)cf7մa)ġ,4? XA#XǞrD#f%7ċ~["~Uw2 /r.3cP%n!3{/oK9漓U&2b] T1:Ίr*EVǰmHx2ocP^` ¥ KtJ^abbxA kNŕnᝯ`6F&b6rɇdGD{wU'X)MȜ䐙))(>))7MףmRz]v*i=o;U~\mjYڦ`=͢&(cMܷ?Y: ΂E2[[) B]9ӏ>jnE¥izos2XLJF,RA7Cl1)+P[ ߏ'|[&h$09XîȆK<}o1'K(7q\amuWlЖȲkym Omds`ϓD+V$>))N-pȱ36Xz$y>Jc霖W^e&m%3hΊ&ºNy&OLl6\jUCMsX[CsQX{;J#GA TGӪ.TlnKXaY%%df_!`HmPVYBf]eQW2DkZKцhXq׭5E0™> u JT ĝSׁgxw^e9zw 2G2|&|Hq='0W `:̳<6KPQgJnYhh#A|WjbWnUR*249+j}c]S-W@dNA~oI~^fEdI^C]&nUS9ӐEDfFًYTRh4jk!*&B_TiDHH+.1.FTħꓬEdƊ$*OK|xd˭rW mdVkۭQ6J4&`]l5@"`9O6̃Dp9r2C)HwҜZJa? +twyt '5cDރ>ؼ ].>Wr ΄3 MH@kc> L; dƧkXэh$& lR ؆ujccԴnRN]V8e&%%],~39p]ZxiQ&G)Nz{4WխWTOK6e)åbѐE^LV%sl櫎J>R+ Eo $ifhZ\K~0r%kysC_B)@4UkX/k+dyst#}Їz D'BA "ZЀֳ+Ju`! -+-Z3cVM`ƀ)͎tE5>y]b{*t)6qG6dAXT#@MeKBuMJqΘ Wŕq!fYZ#E.[vvPʪ `VHS[=f*yHI\U%Eӟ {沶M=fȂ-3ֵu(ُ[ Fe XP5~XB NU.:Qh7RÍu&ʔ<)9{TbyYj^ԘF&9RERQg>fP8 Ń)#R%q8Ljֻ*Im)ƮvFHm%Zɦ?%4P8ݡDLKdbXñl-r!x2 )Yj c}RЂm- LrӲFd&$@rS#3ʌ^jz)ਖ਼·~֘J,흟߹@Ɣ{]_cjKTp#`! =dR (}b4dO*75&C5/L]ӒX+{}\Pͺ961;{ś{NTƵe9li*Æ&I0`R1f4LQY+}ΖqZZ|ZZ ,8R8IJ WȬ*(2 vD*?"Y$].s--UA`r$>>PҷZƉs4%KJ>s{wgw2*Ct{o?><p~Ϋ@]>1 26)R>'8)MPudDS ~ԞM2k>v1NYccTC 4hWj!*YoFǒHfZ<$FTG"4rl 8FztseeJ?A1AYBM8gfijvFgRYkWu[ttIG'X"9a kv&Piri$rw)E26)~|x "+S4ZVVjvzk2a53sgxl,b\]7uT!A0 o/`Cx{oէ1 fRC2D"c JL{m8C%p2SS/Qc{SGXd=~GLEdRd 6rN26(ge*'$ te5^d_ƌ*2WM2G<77#GHDvehBā&@EJw8W7hōƎ1qYt%U'[!@jB4H8t>HwwWwLI QAƔZiPgDj""dyFj8Isc"$'aNs Nią m:93|C AՉy2P1{!@ov'3Gz1{(UEDW55"6? D'geU  #WmtEG')gW#}U qvY6%t _X晈sH8STgBT+v wFY(jwmD;AK%l%IyUx;Qaj穗ʑޥTqF0d5s9[^59,BᕓF G@ԧB2 f DiI@ +zH31Z<)U=#FVjB2v$N5t5٤t?`sfx1ui&HO( a;&7H7X&P~"cgځ0[Kfji?EvaCpt3 39=cLg#y+Wr]sZsPrf,O裟_|1[T2(Š@y Twʷg)f}Z-X2a$ l_7BRd:DxٗJj p5DY:@sqe [Gtd HHQx֘՘'Ahq!t g 2KkB`rC%~FS)eRAFCh2QW8^z;&7& nJZejy]:kyDv]"spGsNkQ=jW <_ |z ܫ2_*E!{ͼݪO*(!Y`ӡo3Ao ÉLQΓ}^^G?' A2N~'\.#]7KpqFG\Þ]ѯƠGWZVoȔb&vL$a'#U6CGp\Z4(}K<ݽ;-Mwu[GE}t8ԆBLAc*L\jceyt3a,V[|uUZ!14d*!&3 I,NFpy]<\#d#] <ݹAϢqF>2b=gmh S5$V>G X= s)~|F8>$bT19Ӎ(u:i![~h'8Uzs(?jJ'Ǘ#B3xShYI)'M(@}s+W#0ȣ1Ch(N`Oh f茦~ѤO 5l?DYk,-QaEU*ZiCl%nU&`ntUN}ko>∻Q|wr9r}+jZd[`(`rŽۑ7W:܅]I4MR7Λ:H7)F N{cX7Dx~݇pbQn)hFRC3+G  RBI*$]K|(/P3,JZʒ\XemL_`7RM5QO洙nw2=%f~˛ >Pzs")OM*-:)W _cعaSaⴏ?e9}5+:Ae~}8h4ةF{Тj )\Lm% Dtȋv] 1hR,M +E} fr>Rzry,`:~0I̊?u6QW2Mq Mp*M)LAH"$IזFX P%E0H}K[G04pO%CP4@!V>1njT&QN)W+đ -rXTs3X2sk 9Y!9]̳hckTsTBx1[ԍ9@Ӵ)Pv$V8%djR=@<*Y:0{J_V[o}9&W̿B [X %6d.=,̘ Du!&X=*! UgTibFR9ZSjDThaI:k$$KVlhOg, eA ЇJD+s9w& zV9d6[J[8IQJJ TF0ULfҒrr|Ge(Yxt&6a'c )aCjgDf lT7!WA ;MvL /S17 i{chݴj5|.Gc=}EflU3ke,CՑ9XӚcۛZh&P[г ǁ9| _QUʺ;6[ (h[d $b)Qlp+_:8J{ߊƷfʚoi G#}u\~Z/L?s,uڳm]v^k|"fz۱cB:>Ifm0BP`G9dHyXY_&K\M1W͛V""l̝46)3rIM|X\a3aQH?0V,b_@^ WtL֐w#pvNہ򺻍"2-&o'ǞKo^r<Ъ(E8DMF J U5;PQi` )݂]5?Nm=XфBti$6EԤ_βTKb {\S7)|{ EBG* d"92XJAbqL|#+ː),Ǣ7î|۲<ɯܣ=K2g=)>{*/{!%b p"-a3@q9Z.:A~k08cb7!7jDz.EIHy:󪺩:B@?W:Z{/R:8R17@a){$]QҶ##l1iFʉeB+A? A!6.\ %ks7t=vl*=Ɗ.IY2S2䃴;34TPpx㛣YD-(%9A9; HùH)hpK˴D?Q; +5Q:U@*p&2PIuKz!Z g3;648eL: W SRrVAѩ8!&SlqA lyC)KU:G0)z) ׈5,*ax 茵 " L904C>\@M I;? 9&ATSB IcGތ?j"YɥĵX"DOO<:ɖZOCTE̔ps` 󪰙 H[;aΓ*@ j81J1㼇#s< 2b#6dqA#+SQ}v{Um+Q,]Z7:8*开!!&1GM2L' H8#ʸғ6s[-ݮ/řhI,|#[US= 6̚5 FTlX? ^ATXxfط[uO\V4YLJ+c7'Uv "-rN|ze%@b`4ί`XPzE~# 5W\֠X8 $h{έ m;]{՝aᅛԸk*#d-B=ES4rPabUڥ]W)Bb12f8A#^Eje`͘Zc㱕Ұ*}3PGҸߑL3s N[Q)S4545`(C ~=MFN4#L G“k` ԁya]v;DVp;0t<]gneC ^flbդ˳1Lۜ]s4*gY^@ -_q W^r:kdE=t4WfymG`lܚPW>VSh\8bڡe=Kt8siݥGaiF)k\ TBK#6⪄ƛĈнkjY.-V梕4pg1zVg߯ec6N7;H[Uk9d< C=eQIJ&SvP~ ܿ=RJlM>o^hT~T v(q0V&|K$f⩶k߶le7CCQ0^Qž2増q: Mk>ngE>?fÀVyT"^o6Η4lڈ#xGaeQL$d6IYY ^p7g# N ꌯ. JjsC5dFF~ pўOGEf Nd8W(GqNư@g5T\( #U-iYDl@m#pd =&MUq.1D|#gQ'7nxD^#.=6Qo.޷vrߌr6vr=ھ.c#&WWhvV| w}N7l`'Tಪ6tMM`TjV7xc x!2Ng@m?qSz'vwu&_ =䢫=HwuB6?,My,6sx›G~~II*sоlpy|p9Xp?tSwww /JDՆ \v}rb-OuY7u ;/w=_v^{ObWo^):=,oP!w:";V>w#n7Lh$EwsŃrpO:m?vWwk%;t(Gu7ݾY+<}=Ͻ~=U Ae<hx)Gd4Gv]ltWpyI~(oew:7cҳ2"~1Uu%z4ϗtd"Lp!Æ U}AYU?TR@$ɑ&K<2%˕+ $GT%ʜ>I欩sPFzL Ѥ ,KƎ0ukVZr ;+VfǂW}+h\ Kv,x׮޾չwS {XCcTZ `%w.N:MSp4Rꁎ f]@5׭).PIG=pkƋ.5rLCBΐpIMJ\~oΜ;yw?ߣoP!)=~ !B.q4 œ1- K\' ROn~rI3dh%hbae#\abM_7#bK#aA2B LhMmzW}֝X͖ٶl_bnYb9NPlԚWWݖֆqX'gf5& FYhE) PRZ!KٝMlUiWh]Xc~Rf]Q*ㄳ~#BrVY7F)V,ذ"0HcIY%MU+Iv_I[歟k.il+ިGctW*RIupk"P]EQhkh\;Z@I1uj2`H'ʵL2JjZjRikV4Ѕ{? gC3ױM#GR#UWV_q$ bTM旹}Akd-7SjŜk!ݻ|йhÄߏCP̖*.%!=i{%l3U`Lآ蟎~8a; šO촿3$LUY h!;Q#]Β=u%B|:d"̅@ t^-I{I] BlnB *!Hn(.k]Q{>u #)}]ӨA1R 'e)M07A)AEYӖ V)(;aЈcHq j#qOx/T:<+Z}L"E#>iqF3+^iWGgFfSʉ231F4jDYI*\#W=24>Lf11Hwhvoz$)Ȳyr$]͍T_fyܳuz a#|0"8.S?:ر4M6{YZ2ц6tl7\tju,u2[Y;'<Ű{L7a[ \6mH DãՐł ?6}p5c,yKtr,U|FYL $G1EUnZckNgݹ5vcI\F7䵯& :=HpO~(v˿^0i\b?>Zc2˰TT՟pC=&ݼ7FVپel-u>Ck*7c@.э6 +zm { !XQ JlA$KqAaŤfң0*KJڽ%?e:!MWgEnDeZIj:voS =*.'ZZugIXKKFb@R@Bm"f䒝``W) 悤?qaz"4"+b:Bz1`ݹifB]+)i n` Qf! 0ϨB⭉|Ts^<.c1U)鑶9L&]~Δ'LzzF:$xFPDB[(uG'I9O`񧚪.`diB^G~af=QU!eՒAZvԄlUo*JbZ%B^VreW!Rtqh 2r*<גNŭDZAzL݈ HŠ`.L6LDB~iFf y~,:ȳ)!,$A+p-omiu閤M4ՅVfmF*EjknfN!ŊsEU.lv0ܝ^&IlK$MmASHwgjxnҲNY^|2n\gFƖ~bC*atE!rɩA^r iP.lDZ(K P/RV+~$f8mSN2%}^.% -rEq-FXW2 ]`Z]]N.Š,lS(Viḧ1͋@Ƥ ă"궾pRhEQn`hXaȸR=**ɗ& p9Kyfvv`L\ݎHv] ÈʑwϪynE2-!O+̣ҊC]::PiGp%1jHX]Z0Q.ƒ@ 2R(K%hEQxС=f8k "eCTHJWcuv.aWUe4'`v]䯂)>8&noV6MxFHc1f0[r 7-!rZӆ^)- a c ׊s 떐PF'6)1HFݷHp06xE@ B b$ M|:SOny1YԴI3-iNDsk1lGHnkt[.n~D"oJ`x]$8֢3hv³]R_)Y?BE<+ʕodrlmiYa.;͈-sĆ.OA5o|Q)T򔻶@jbꫫoʂ"\pY7vB!ípYE,Mo![!^Lc^ 0.-E3C5U[ _uNC!poh??_UpqٛusEϠ<9(Ŀl9:J2(eruIWeR.2}Cx߅gw4r2WW/Iü9RzKpc#P7:iXP*ԟ*ЉAR[|~r=r׺t}$PO`R#^g8Zs7N4ҧwbiQ<ȑ5_~O(@*ElӺLt6[y:Bc|Bxŋ1ƶtEs*uOzHʷ}|f1:ӼڴfDޥ3m?:|;`xX,_e6 2e7߽/2b5;ԏJuho_['8 RPb 6Dp@'VxbFcH Y#%U,Pe9!A *qTI̖G->|ӦPvlXb bڬk2ul\sVk^`Zupڽ vT0B72vLQecɏ)O\Y#ܧ"cqa G3$=)jz5i|蛶jiѧm}v6qƋ7g3;,9sgvER0lҰw p7o4faٯ7zg0X+^, <d j 1B _C0C p5 EU?s#>FjqF˔(e7G@3NL4R9hm,#Dr*'+$s4I&j2C31|'6 *&h?F=R6Yx-٪$*\t,TW*IL5KJ;l1TTUk6t"ׅ\ PzLlc27l5csDCE벷eVjk 5s;dϜJ*J"8[K{!}6rnY 8\*NTSi2O%ӥDs&Nj=mzNJD>Sͬ&[QADlfT'$QtMouMWTu؀asV|du&Ie!3sjWv\ݎՎb_w*FfR +xa!~_ tJ:P. S?MxJ_pܼRDABV@]Ns2Bs&@/i;T'Qpv iM~=tq*~jZv}g?R53vD>$fAS-H *7OS=X"$ͅOaԧU~4Lu4گ~"պhL)*3sВ8Cn΀<é[L\Ԣ6$SW\1O TFh5J-+ MK, -l/yЅ*8z-(%DT=kbސh7iTˣ"HT}+Hx\E>36&8K$T=eeK&OxS\w G-K 褺j\;h2a N`!*I=xTWM">@m d+#RrbRG7*WT3{ņT2kR\fH*龝1:2/UL 6ZwvUH:uMKEps2Md6n!> \=]+W:,*72ۮ ^j-)+[feր fc1Rݐ}}@\ mE)"bM8،>-Q;ԦJdpq%ZѦSωppԣK cgXs.*cc2 [z% !j'#XF|$*S4Zb3ܡcZ۳O=GJTbnfPgv1#n_KaU52A|irJri~T&LۄD^i"Ӿ׼ܥ:u82v ڲ ~Ifv~ZBft{n;\\Zy8e *={j\Nz [ ^p Wp?)^q_9q!I^r)WYr1i^s9ysAЉ^tIWҙt?Qԩ^ukY/]z v\Ѿo8S:ݯjߺwr78~v7w_vO^߻9S+G< ;uɿ>OEok/{㹞z/^ṿy<}>/o.jop/ŏԯ./֎ /`<04$p<p9PsʯXpP mp0P 0p?pPN0.)PPh PQ3Wp)P#Q'+/3Q7;-1 !!,@DTDT;T0Tx,Tm)Tl/Tl8TlETkGTkGTkGTkGTcHTJITIHTGGTGGTGGTGGTEEM;;>(((  "###$#$$/$<#D$A)76'D$F$G$G$G$H%H,IAJFHGHGHHHHHHHHHJHQHiKpNoQcTZY NZBP1?)+70%35+= "KRTTT!T#T"T#T##T##T##T##T##T$#T$#T$#T$#T6#TE#TG$TG$TG$TG$TG$TF&T=.T$GT$GT$GT$GT$GT$HT$HT$HT$HT$HT*NTGkTGkTGkTGkTGkTGkTHlTHlTKoPaOjQkTkTlTlLp:w3{8EQTSTTƋT}TtUnVmVlXymZnm[llUllUllUlkUkkUkkUjjViiWihY]TUKVJXHYHSHJHGHGHEH&us {m]>@سkΝ;#6sH3 Ћx1W'CBWkWVi|Mgق]W|%aX.Rl~i^Cd~Y^x{VEXhLֈbü؋ęj+#g|-́/͂ ^MkQT⡸Bg%}[)Gm.(fIٝXK.Y~VRxj> zM1OO]u]HՔdg] ꣗[,քZmśn#uoAkQFJry%昰lM[ŽML DgRv\1:R뷹V9Dr:p ܸ,Zh)r~[1#KoJJ 6 .A<4-eKWb}"D0%CQdkC1]4IB85U_'rE}aZJ"Um dK dm&dj\3PEۏada"출\ wazT5ql_)xrli6\Я3萃͞|]M4IZh^'f.*8";!UY}u9enCم^.lI.JdM XKնQt?KRRMJ4Uo*ذ6mjČ>1̊(bV-e.ͥ%|D8>!nbrR\ǡJHābh`l,\ܩ9 Xrvbi1I!(DY4?0$PD l'IzRLBG WYsqcYWђE"2z}AQ^5Ȍ!bp*4Jmpɀl"F>iԗJ .a\Zw+4]=f Nl5!@GS 9#ŀa;3P*d;1+Hx@X^E51^l@"Cz@{ f A, v3reG3tB )Ub' ,;rJ,qHO4B3[#"x(J F*ΖBq ر!̊fDV1BAgȽ@xPIKi,SĚTjPB7S,ftL`2HQ>RjC0LZ'(bHo"Mb+W 6HCMC!FFNOzJ.=.uJa8R{¤~EjWժ$H&d"|,I_%,oj$ s##ӈs[D,z-,'}ލňFVE֮Jݡʆ.~ =9*.! )JftfD94܌Kv5}EMj)v,g;YxnDƙrl0x:j+4(R^Q+GqV4 I'VW"hXyTcinks\UO}*38B-F42Tl׈b%1%h5b!]z,̌<Ϝ8ggaM S R^ɰ%ڻ 'F#(61?ڵeijݶY2qhޜZa ü帄)tk?7Ң6Lk7$(Η] _/uN[_kvz䭥;dk&1$(\Jn񼏣C!n2lW[ |Bʐ1|y(j*~T ER;TY&Z.\B@ a?6o+=t>w|74y!fJbtthEH`h0${u2|g&*bu4ؔY^t!5h+cKTOvBwrD@wY`y!K<y\u ȥkL `,qDP  3傏P GPG.8S@ 01]ܕf6hHwVRR+@>i0= u[N #H_$mX{DS^6`SG{ZvagvC]ZbQ`؋C8}ۢCp}46ksyS;7fb6,>Q1p "[d,w0ypPrG0gP nȀ3֌V3 EU DqdPa fXӉ6|@DjF0 `҈×7(^a'/nwOMa"сf p: 0AY Xle#RvU}Hd>3,k1 8S(ЎGsG&+$uX[([6)[Bzz*hA+9[824Yg(ՁK4`)pLPaGcHKq3$VV B|UrG ٜ@1\6Dyjx]y 9 ,tC7/ 5+gVY!2f`Di((s(b(1_cmCc]&":(Wp#f~s7țSTp!$jA$J EgsM^)S[^v)y')-f%~t3p ІNڤPmI:/bJX47Hj)V"t: W~rO3S[.X Y訇Yu&^g|e+l+BjJpP-Zz(; 54}jb4)s uD_6Q "f#ke6|d.VC 0 X36zAqGC7SzCN5!Lep0b^9]yDIy3EFPt ͺvR2̶~.P̻/z38_({c/A!g‡КK;F 8ɛ(̴s8 {p ,EH-|> +{ V$> kMQ61 #ַ;\3V_J-ah0K$ L&Jk 3_26UJ> u%XDJ}"KB NT(H]nL{K86 2 :? B`6T#EECw6G=20$ҒѕfiFaq_#%q"KU_s(NϺrǻk>ﴸgjo[8ffmqԡOXHk67 $ ƨ8P$2 Yn!t-D: @*H>JH4/ݔ=u+BvXK26\6j5`K9TХ8 .SWaE). Vx G,fT~NUz5LH,;x+(^w+bh16O+3# ,03&.䁒䒙{`z+A'ACZb'&RF *U %#® B҇􉆺8 3REl8e1({m20'+20)h!\&H4ҨIs|O>c p*sO< bZQ#%>*F#LZ ōK_.`Za'~y)-*H0?d/ŲSx&by̖|!ևʼnI z g[4LJO_St([ QG܌KOck;Ņp{@ԿڳxK:/3֗aZܑ_ۇ!Ɯ5xD 9[*K2Z|8VW?ĺI6 BZ @ I ?BqqKW!-=;, HwO;NR&&Q'(`h0D0~8KӲ8>]H1 .p|㋹~cF/,Dtb<4!$n!H0! ӂ ɠF57cXt3hM9iE' F,Zr _~_$tvՍ;ܚ6) /%(?7.Lh'K8-‰$q#Qp8np$W9* 'ʹΞ,d_ԸW.u4)Y =1xbKd1ab(3qvӊK&fPUH12- K\mua2GL>L"%c@bȴ).RxO k</昱4o.gZK+g1lZ$02Tfju;0CW+#E4S0/Us"L*,T'y7eV7&)&;_# Q!4ȥ<<Ɣi?i1akrE4"2"I 5D K MUY-e kldo/4ȑI ( '\h`M\iD+ Aڦb[ KqR/5QA\00rnjcg,;؜e` !ؘ˺d~ƨ&MaqY1b<ֺ!쥻H"`f[)YLe(Seq({.!'wP8CHP\TpSώw]Wxp~7W)sI'tV~ʨRuX,\k ʥKs% 8ǪY+݈2##@TapBljFBT#ЛZ:R]/w|: \@҇wZnM B6WG8.bꂏ1r;+󊦵@,W[ qM],A }wϜ7dpâNןy.tٛ/## ,$ TR fE$/ z$TaiC?1xIh͊+QHI +Ȝy̱ h%<X* ے#q-Bf}b -88Ep=Ch(aKLi3v5j F 2td+*=bYѮT4k6<[ڴԐ-:+ c9HlĔ_)@R}$ړl[ʝ)F}B,;*Nٴ ,"LRjmx+`b,=6z 늦=*H)b8Y^, 1pEE2&Rm,zOHT:$p2SGⰘ؞hw>bm.U`MXF ci+ tgH; (u@ z"hURDaMY)c(ч|m)5!3xi'ɧ+9c)*IꕼnQ26ܹFzo;j´ia/6)Z)s)I5!M1rJ"19Y]Ű4o$5^R.ՠ #9a\})ܤ'ܧXTȍӡu+F]:ՉU Iz @e 'Pe'@ss+̹YV́WX kMWj31.fX=xZzH,ra7d>iIŚi @I\>%\,cNlMn+KOSJe"Bc])^+惛qGiMҬq^ʈ]1ݠ`Nf΍4 Tĝlpc(rb̟ `@OD l,дƀr$rUrXdD8:d 1B`o9C)=f Bɀh# ]ћ{,/j r# >C L', !oP +`L!U Q4Y昭Bᖙ<:"c5/N܃*P]`SM!ܙѓUO@/dMQXj. U ^y UrO3(`I:d`8h f*di^h87 ۪KBONʛܳ,KgsEZ#/(laf-bhZ}{$Õ ܉q\;PToao;}Mo} M#ߌCN:b 㳘 9 `\6 8h{C5x@JJ1inUaose$R\zbPl*yY6ۯ6d6U_Oq [#h}M/ sN|p# &MPKY <5s1ء!?=N4,Za\\N߾ޠκ;C)_eqy@=0DBC4xUx] Q\=0f,2 3Dd!,5`!B5"<C{1CHSwIECO4PtW[ AZ^Ӂw !|CkTVNhY)q]Ru-}BdVH~)H&@U%H~hUJUgYTiFeIjG. ZRѪ!jItJ4^zf$tUAdfzQ^VV)et'y`NyYm Ӡ-%Beڪ06H17ljnV[ZPI|#bJGc*/eG(}5ӝHH\C1(%y㎽V30C2"utzA/[bblѩ.*+$4s(xW>! 1( &Gho/e՟ m)}!rGp2I׳A{}PhUܩY懤4UbDC/,)>m^uHoGkXw-w~bV_b5.̣K#{c*Qhm_ufḭvV++!k;G*>FE%$Bz^**x~Y,I~4La jш(%rĢX?EIT TPHӑmoP8IBK\-cVr"-PGb1+[1W[&-KJ*苇J$ٙ;D, 3RdV{dxUKX\c%*K3ו .΃Ҝ .={!x ^9B1#;r(=hX 6XHVDm Aok$TlP^ ENiZrI-]|Ixeq h5&pJb$lb wH*+"X{6@r #١1`c 4"F9Z#fIn"2SrvM*kN)e/7 !ӠUr ."Hr35$"S,4eexbk0Ѩ@#(-=U"q]J(Mbʎ>ً\t0diSZ%fAE6lF+ud&u艦I> 0~.ζ 3WVFC h/ >?wr'v#u2 mp+y!fLLyU~j𨂥5QS sL;%~$T#4ma׳I cYCBlN1JيF4.+\Ghp;ێe`;٤HiS3RGh C,$ ltXwczR%uġۂhcFPD(*7DƋY,74DKޓ=۸=%Z \b%5lA‡RBcvÐ4KI/%c.ʖ$]}MSuYXZJ+w8CD00⬱3MC֛-I:5]Јp_C #EF9|\CmHØZ `M  J PbPU"֍eڌИəO5T$Zᑙ l,DrW$ @]ѕ0qV\bH؍ 3"vjQ &-F4Y %M[H\n I1Gy U@q>KݽW N}ț)'_OdUQLc0? 4jiNk֥ ƨy+y{gLOu8JaA4;Vȡ~e<, ͮU-Uᘖ0d崌`. jiZJQgb! %FiHh]%PFPjeR-Y!5d(0Z%: [iZI,#f̆I<kNhbWTl&oMG8ڃ^I w^k`$M,xnyFPY$'۫e"fD T#y$N"+# (mĽ $Ds$4 YHMzSJlO^D_NH |R,W, QZF<עH]c@ʩY0jDJb7 >$jaҰ֍2-ǔdBDarQ"MTK~PtFr~5UHc􉂦nVJʆ!nm6Ļ<^HYE$PJXKpb_e1>dErt.Jaj'`'&22`XD͠'2)NB8xL@=&,L͎ 0rHx0T$1ZÓy[} /lkslv г~CІ ' ɳ% Z 9G/R^Nfl_!j*ALXI+^)* UPӝeYSM^eVO ee\5!,)Vm^x.[8iDvUGlՑ-<3hyagGeko3C.AW^ YM6aR&xG~*>lj%] `Au6CNy+!NI$oA \;["6E,ܩ}dʙAy:: [!OFN^9W+I\6LܛrS0ܱApZZL֍_RKvxbz Dq(?_wfjZ|GLQJP-ҝuQ,O͟ę} jզ6[;e8{z9ydeLJ#5ƌiG"jnYzE {Xs:MFw4EJ;K衤 sQOws-" t:{ֹu]!e6@|=|+mdcp3N\TOo1Aϲ>wUʓ:dRwd^~zr%B#+{{S 4`72fJ`rƄKIՒSx2 j̔cx菻hQ.l[bK8kX{ՎF0%hl3Va8uvR0"'VE,A"V@dê5A @4ϫ4o.X) bxĉV y S|-,̢9t.h$pg8"ܘp'PDC~,) Rr6L̃8 LsUVR G1.:Wثw b6!ۛbf6kzWPoNi'TΛ$|^7gA*,ܺjc-.-z]z'zaG r-#IjzMׯhOf0 ~4`TC>`EI9ytePTN^YGwՋ3 P?L"k*rVCoZ}+hj2lT3=@G%+C`] M0sJs5@l]v'. Dx!3Bfk䢋⡧%-gA+ECnBHØ4ep^ӐmG:| 4p1 \'!)Pt#Ɍw[DJOVAwB8Q+q+נ0y PaͼI==~`MS217"[Kj5lu%trPe-)MMF ͳ~ԩ$QrK vķ\Koa&S1W`MrU ,cJP[h˘a&fטrRj >roޝxȺooe] j1L4 vl#!cLQaW AH]r#^}~ZjX(6w+;!K2/=*4>A :RNYtg$% ڴC?F;zJYBSu%pqvVw#9ۓ䇓9XXm!).d3f@ z0˺.g^B|Cn;VTz[-/4 ېN ! &$rr#Z gKb*Fca'" EuF*$^ϵD"@jvn˃E TE)ƛ$#-f89 z7A Ϻ^-^j&=B-,~ì̩A:i:{̱ Hq*.&Bž,۶#J;8΂2>2&DL.!%XFj

Go/MP@sqrxvKmjjcd* RE2|B .z~ȀoZDRh#`RfE(GdJkZ|cfP"ddB2!į;:T6 J8`B;lC5{pbN{,t1'LTN/s+rrDh ?c@#,.!fpkCV3ߢ9AnJ&,.T̨iM,-|O pM;23{h)PGNc8u-+aN1-b8CUa!Af;&o)\s 0Qu24+1T0)VDqyS^mˣg OEM8|J y",1+w%`Vo6qECU0"18S3T&!,9aG:9`Pâ0"d;̈+C#GTOPSF,HPY!!vF*#4?;rn*אXl1$K}EV l 3rcCUtcCf džEtfE V)Y4E(faL !bI]DmF2G%hN#"m|:bGu:3Gs$R.`Rfov/;KκY>i tO1a+s$nN%HGEt JzjjX|e~I"16E%ɽ0C\kcRs8&T]0&|Q+SUKg>̕pç:#,YEފN0SYSP"5"@{L>7;B#a7躕Ƕ#U!C#=-}O:cvE_ 1ˬDKH``!F5JaAFgb b|R+Fw:Nm:cm19ME4#-BeE RN`B^u(a5Ksjg xROvd1Ahkق͠BϖzOSڪ'ARwR6vᣇ/~:a,6o8|sͨBaקwav4qeMM5⊕I6; F&)N3|!UZu"Y!O,F[[Sf9X9wufBX,"z7J#BG$._y)!Dj`75f$D2$0]{9 "Nb2N>VFABJ7T }Fô"vBc.r@BN2gҚtNqGPYhc1P4m~4egs@(BI JXyVEi+jzc[vfmWI]#"LgCȋ-U=>5z8QL` 5b:f9#x>'fUxjHb*&ho?5xuՍ+>XXCF%v735n" l#3ƧD*'d,xW>ty&kpoQ^HDY%Hccgb1N(ð,Gypc:K"n+dOHrQ!h O2;ۚwqLcςMق!yN[q+*i?6"L8%`x;QuzO 'lR0##hi{h%+6'JSV /t2Bw9GYNL%|C+3=,)G`?Ns:uSwZ:Z{[:gg45eF^UƉ`̠ih"٬5`VD0)k%bﰛ ή^Yd0"ZG*SGMZF䴗T({ba>8ʹgm MƱ09?11_)<2Qd;6h_ j_v.η6G$k#ۼ$6[ݼl9UD?>Qh1Z3b&&edNjow[ /9:0FWcTް[)]R't[tXuIШG>O~"i@$N|bzaQGq*\=49z> M{c-I6C|)1f*q˵f!-o"@,Aɂg*0UutUH ;s,O> >7CۀPjKh_5M$EKK}v`MO VxxH]ZW |,"& Y=UuSuc{> rr]`}Y<#;Ows=\tga+@5$up[{8ƢXgY!٬7\BI<) ,p2Ňb`ʝ`ܡr+6:KuܽKc\u{ڏMʷ3cF+rr ~TGᳲN&$ef9?˯%U!Tt#@h SSe b"++Mϳ í K}t=P 0\8l_emj2nO~\za*l`ÆE1h| |lH߆ F>,WcK*aڤg]Ν8ugA_e8g+Bj5+֭Zr-xɠذd~z)Yf p#aly4ob /!b13AqVXɔޥ9͙/s 3џO]RYժs ׯevvJ+y:[_|pY^]erlJaCg6T]2=q>>Ϸ~&x>`h`.8 9`=G/oG UZ1TȗyWb.XYEwYAy6ca]ѭx׊ cE8JcKKDK5L5x9-]\%4da]uWxUܓ,gVBigC{,Ŵz5EՓP>A:TD3ygXfj_B%Q̽R~ _9hF 챋QiNd ;YϒvܵQ4`{7[Kko͒@fvi8ǾSYPuaRMw(=*[{nӇw{xqI`*|U Zr<_ %Kxr,_G/.F&i\[5=EG+l1ggV&[B&& bc n u|-QIsN AhbY _B)g̠ A!%W \I) R<[Y^f1Ep_pT$fL HdLa)S^*hm2w jU)⎠pMbؑ3<Jy S6.Q0)H~.t$@uJ!2VnUX%XJUSrGb*=/yA j1kystZ!3hf j >{q~ Q %g gbR\<8C5nbh Pm(|q?pA*$fbe/#'`(E$ b;R툥xAKֵ'崊9,8ⶺݭ!~6Qqfp$S!זKёU'<^5-JF rU[-ԠƄ&@$#׻t 3 IpFŻvv]Lr*tjZ| fXȃcsA`\i]3_$H[5Y0o4>h?l/jM3ϙ"N!V{>%P?1HD|> <to.d{-~4 (}tFYkM'ֈ2RZz8"#R'hIW<,J$>F;ґ`*ԠD`qk8,;9B*lGx%Gu% K5q$P@WI$ULTB`#ntCT [ڡ2$%+20ҧUggJZ0!Ly)[pjܗ;7Ԃ03~GEeIԋ?HڦwCu SKT#UL%$nlҽg SzҬ.u ރ2Zִ6TPX*fWyúf.h͞!֐~"l7eb$d]C`rET|0U{IΒ˦NuC #QhS+&IREiy=:94h[}?xGx?WtG>GrƧB%*װAc%+Cƪ ˧}+-^Ut8;3/ u/j Hx%NMRAяv+H +83uw qY΋ټ=X c%cCln i;;[Y2Ş}As h/K HzA hN} Sk~H%7 \b]yE3|Oxs'"_BVߢ<|c.!)(3"(/"R y<9lJV<f&z3ghFZK6E "C{Qgj{|MȁuU$bVN1H ?A94jDNk.v5b0%-kU1.|g7ke A3  @x[޲7'4lf .SlW7&;&Ė@ז+R&>ia@B#zCzVnTć.UGw$$Hd%"'#7&r'go^W|wo aԷp Fd>^A9s#~*&~gT!"Dd({#~@bPe%|f6Xe[BiX5`FD6`#6nKxezaA$SQo!h pr ڴ'fp|J,F-!|xbP`|R:biw(r)PՉ:ks7;3VZvI<tg}g`-#˘g~qg=DCZs4@f}&{ēKho;Q11Qqpb ihjRśћ.i3=x?j=>%HvEG6i9%1m&[l0ÅˁX29 vz9Sgn16E4i0bד& ]i$X[tTCATL1nkȋt7(:T^ FI9p}U|!W:F&lrk/5S¸XDg=wXt=cٓgA B$QD3>و/%h=E|E 1v rb!]jz-&y)RuqA%2$jMexIAD)!lg[qLƆ3[ɞ_qQԶʩ\.+&{{٩cDԀ^cq1T;f+WN5$F' mJuih\$q ~OYd׈zrd;|`d:6W@9~T2ew{g:;2-m̈́ -a~31Ӆ2?+͡EuUhArG3 ې+źQga\;oKg ")gl iOpY6*+wTgkQ4+j#b?1{~e**XrFrRI|17z7H-Sc& ͣ~fe^fѫ!%$"UԤ2z}shO]=dԃh(;\cjӊޜ8=1TAawv(Ն!cefMmb8 Z"&҆HG( a%q\D yyU4i't,\b2*e) # LL=Ρ}I>fiڥخˮo%A9\#>J,J]=洃{=^  _ƙiKxLި⼭/fvJ.MI>~3ǃ4vyA؜53atղ^7'kUmnbѣ_~&4s>Cqcb9w؃+6~PM}'u㚒[g;|(䢳+-wb ]Yjsb/bsDZ팈kκmp˱YZز<=؃u1 YnN[1ޒG2Cޚ>WJ q32iȍaMlLX/D"6a֨g qy P .4aC~y;ziNG7Y4ff]z"E/+N|E/_>G y~gǠ:eo|꨾̞dW`:֩PF}5[fRrbΜ]EScJf7_#1'&f,S˖#\9Y˙_!gA?# `郜9㢵֮9~M] snϷK;,}zA"Whyr.<"3z~I}#2Y>Jա9Uҫg =*pr߽?xo#:T*@>.| C7P Pÿ҇RdWӉ/ɓ<_R/>[}2**KfH&lDŽ2J*J,2K.K*l1ŜLT3M6 㕔ꨬBhlϙ$W =(~NFS4**uJxR'' *,PbkTQ:k+zL--Oo.Z/: '_ʥzWlXXd3f=sYhSK!|kV41UʹV5p 7阛sSW`]B788?ċ_c*&N '$pb!f9_+ @H'6_QV [pqOY M/\o|&vq蚋^Qco6zG辔:L0:BS몹k22<iS@O4 v$%78B\,2|,: :7hdF[؉f)}ZKoRWÀv 2-6XŔ[%M>+NĨ8E~ӈCٝW]K 3ϑ$/%"DIeqTLF|;*&N)+pz!_я("eD\ ,=M:,0puhPӠ#V'iIOH8$'EkY#X" !cbD5ˉYJ(m~ƿAHI:ը+&.vr BEJ ȱd"苌x2ыI8@nEb|e;w{4Z2)Gcpr?::artXC iKZ{΀|G4/-lSĊr햺dr=Pb֍%kcoJdW O:2p$#*K7W:IGG5T9urP yտeeOce:P"0A%[#KyƉ+\g=[! / ү|0 (⦤"XoDB\Iz9' の,`x{' M atv+^NzLJzwlJdOb&ʤI`ԕjķy/wi)4Ͷs^aJv\S5ÊbTj\U !G,c)f|JqTyl|&T>cmSŭSc K$%ERB{/)MuY  %:sBJs4|ьEߒLcZ^Q|Zm:ӝgV*^qʲOI -3o>)V1:6W0d$n3s[c pQQh1˱t7\*4!;;,TR!8ףHB 4`!#`&Sɽ .{>BÇ 3.,'d ˚|>x梷w2>_>cG4SIzAELDL 3ZB04*S/ȩag#$Ǡ=`"A1*`Q;5PT*( < $6V5+A@P[ƶzxFy+(::stdl{' >)2s%+NY_.5$K#CÁGz3ڻwtGKd9x,Y F_1A?˚IL /Ht?C@ 35>cS# Jڵ !S, a$D$<];/Z7`S!bYHK 6t;Ơ.\<LusAvcDBKk4*3(ʳA’bՊrj-ZC @ѳ5"xd9̰k{z!8˕xL+ǀt>*bJ&QL\I.(.G?L4xAͦHzDƼ|KDGT@ȳ.".LllNN?D@HYNLLD)6@6*S1Io+FlTQ[h"jF^m N=1+O+=@C5kRYG$"6|{ M|Ǖd UK&)<:7~ "@ܤ#?Qщ’:Da5Jc? 18N]\:M,Cʒh)?355R8E01)CS\J<< /b1<]ӶF1A]㘷 N]BKt?#ԻLKIbP4S-$cB3DSИb, Q$I Z$-ʤCC9CBڥk$N$j%ERoMA*(}dPLs_cGv|)uN2b{lۛ!+PKƎrOǓgREt1ATTD5/%HF]R3PFZu@ݱ5>\uf l0TC=%E\eT7IA҅'dCS=c8YJ3;3%]S]-TUÚ|2RV}և$i֌TDFDDV]x)(Ww- U`UweIWEWDG*.*h[GE<ƶ+F-FQ<φOSSO7`zY;H[U_&Py“%] M&K'~! R=I!DyJ,^uZb+bMfFɪ=_c'IzRV_P:;HIS!~ʀP¶E`tOĥӿ\4ثAd˶+$GiDХXѭԽwI I (!ѵ7h$ 0U6M5շ)Lj>,bщEJz<(pK#%VC>cFf&>dƇ⢣m4֑Vl3v:PR'JJʪYc1}gLxɤ@x5bY%>gӂ-d6aFfg2MS&漊eLf c'ئ  w@e*#2UعV;*⨽~Z,RGfip6/o~5IC @8cv6{|hdXgn)@ MNd N\<4CssLJ._%TUSv9Gɔ5),XACbBcNd^NPhnZ.ٮѨ%odP0N_H议ٛ2JCƸHc}vE6N|Oٮ` FTr<fo܍zn軶ԏiee&>nf>+)飃.piږm/ցN} pS6J~k<+9/yIdQR\sSKvtnqqؾnq-gTKò>rGEZ%lvA>mjr0N/np27G_U6o`!j oOp A1$0hEtif ͻM#_trV7K]bFgrFtgRHtgE%/^qbg$2GRW|uqJ@AnsvvK9pf;4Mj@5 ਖplaaK߈ͭaMP`7Gͳ2D/.A釆|.!a 24%qG; 7k^uW{]7 u6[ yYdt+KWY  zGe:'5zLB@TiqOuF\%c۞'ޤijNx׶o?M xXghG{4TK䭧p%}͌e3yҖBw%ov~Vy؍p}(JodogG1OffoyY/ | pBT(1"ņ D"nj&th`Ȓ$#r%K6%orĩ΍} SLA*s MS)S=u*Ԫ)>5+W[vJ3+/=3lSC78tҥBL޺q}{W@P"N 9#㿋 5dRΊ?-z3_!fXc#_U lNKll(Epb∍ /y*aࠫݻ"޹ϲ4J)XijTe@(%e~AN 6e;*6+f%g\VigyZg9g"+Tb%D@ ^7_)VBWHj &_[oI rfqʨM]@ v(=TtY16u8X02@"p6*"(:zX~ƯvF۳#MfI،_[WFяkOV,&+afʌ#GH.TFm:Og_= (4:߹(YLZEIsz2goy3D抈Y^fl*7e;vUn;\t NInNi.&O4d1mf{ \+w!0]MJlɋuXDvmm_4z6mͭ֗T,M{`74"Ure*5LK2!,0K7_6 8R8cpE'V4! qbDFK °Z楇g-eS I-[ZLMA)]Q%O6 9}wY=t WAڞ`"aEQz5A]]XL!VR% MQа3 !5R!KG1ntj*5! Ix q h],S\T` "%h8NA!vM(H Q[ՠة UW5"(!_J^6W!McF]B9Gi$D1GjdL [bTھ[!˝P ޏ!?q m $#'^gt,(dсsQv%MWmz M!t"zc,RDi2r :F/`S=! `. QJAI c Q5z`͆Z:aqVHLoEGL(^l"ZH|+AD*c͐Qȳ5R&%@Zb  .B2VB}ay [Շ4]$PX-/0 \.¼f/ʟDT\]58UlJMKiN⋝qi] cJcro2'^^ R 9%DFa;fl*rsOt'&U&ֵY|"e5UHͤV!MN~_;9 ^i5ց*!ZacTF&OBNj:":xΉH^xi. b!k~ң" ޡ>ϮlmR*b==:U1j Bb¿gn8mjܺzDad .ݶ˥m%hiXeW@EnId+ Ze@`o1hފf=(|(9%[ʫ̭h k&6/ IFNxm}-f5L_æƾj-^ <&"R//ViDl0wiՊL¯H[SNXz˖hHVPm zfcEBj%l](FcVQ9ymFA$Uxj'έ|^d^!d9z gtnN7.6PqFFo)ګx+JR'ڕbϩkXk#qD>f0hxxt x'E [od\K]d3ʰFr[oơʌ4#,|Y*d@I(TK&,NJıœf//m±s, : 3!(6 ' s68 g"~:/ n=C1..`B(qDq3.cPS#0&(^#1GGZ=qb2b "*"${m _̕3%G ;4iuT٩AK:v봦-$蒳mV-Yj.gEG*FeP,Mu<3DDNvz.rИ P&miwάw&(C.!؁nBS̀$ 7Y细DCFC8Vk2T,ӔK1S^imat7yź3;c.cvgsHag2n-]nj))>FBv+t+t.VI[xp?tꮗ.*[DFՁmw0:J zȎ&{3zd֝W7`}+9JcPvz usʊ:W^x1fz7@ukMP^ vas";<ޣe 6ցs`7ޒyf9^OF,q6jHcBs@]s3ttGm=-B8ke44(Ǯrޚm1@yUW7Kb/̫,7۾̀j_o&QN@:1񌜜7eLWj{ͮ/{?_A8xx so}6Kk׸_ w{i'yT1.(F Yáƙh!9^XG4YAJ+Ei2RJ+yhP?JgQ5t3NO7RP[}޴9ժbZ,ڲc,Ɏ&#.[]yo`&|X?#vlfEM)\e͙3; į@c)!P¦KIjC:C0pDAЏK D>EcTCml9n4eԋ9h!; ɃKs4ҒP.s` &x"*1嚉l'7{3ŐbL8TB/>:-7Ӄ-F%4Ҝb ꎺTME QM+R WBlHyGnuRsuqV_u{η|d+冓?$ Yi?u1#ӵo]^K+uV51vs?+tQDIK5Bq=x,|3;NG]U؈<XP!u7Y}QKx֍yŒdC&9ؕS&YRI9Ƀj'̒$.Rːk̍ ).5"K6c#)<8lPvg2= _4l?l[nמ$)v8cX%|^=K_ppZk LdOLֽ xfY$8O5r"T:֒ <U/u{[=Nz)s v=>ހռ߼3 puߍHUi1 G|6a Ѐ+ Ȳ^90C*U7X9n6%YHKB\ NJBHa*I R/tq.@daZ0>Qu\vK-CR(DFNraS2§dL& ^>/CUG31%ӟbW-n_!7ƭy}L +HUI:̉wQ(YAy z`ճhKwy 1rB dBAO(c(>4a }9_ꃾrPV܀c#i1bPv%Tt H8g?sO#DrzPGg@x*۔**k82JVǬ<qUKBXd?fQtM.dKÓ,Rbn39띍9B,:IL5䭧45*.Ddċ{wj'Ø\RN1yDGU&CCgvr+?NSS{C[IߨOZ eu.:&4vF`-):ax8pc,|Ia*Q/qY)Sm2-W EԷıL8WRrU]UX9rȺj\?Јec1:Dx[^Uz^|[_~_ \` V`?)\a _9a!I\b)VYb1i\ͱxq=x^!y?NE"}Z>d//9:!793y#Vwwf+۫6s]nvk:Mh{ڰ&vTG)TG$TH$TH$TH$UI$UP$U\$Ue%Ul&Ur+U~5U@UGTGToGTlGTkGTjGSZAJ6/1" !   !"#########$#$#$#(#4#B#G#G$G$G$G$G$H$H%H-HCHFHGHGHGHGHGGGGGDG:H0I(M+V1j=pInWdodkq&u,s5oHlSlTlTlTyTUUUUUUvUoUlVlVlXvm[mm]mmYllUkkUkkUkkUkkUHkUHkUHnUHkUHkUHkUIkVHXEJBHGHHHOHVHVNJiGkGmHkHk\kkkklllllmmr}mllklsrw|yz助ܢֲ֪֪ͪתتتتת֫ѲξᵵH*Tx!D4B< $:Ï!X˃ D0"1d (LB (Zt)Ù7 UQLME\ތgŊEtS[CCȄ;jZD%[ET-Lxœ * lUU-E/Fz(͋h5fkRZ]͚ň+Rtó!n3cַh_IУKNz|kJӃ "Y0i(.5RA'ځEY[ V\!H&WeXJ񹧗FЈFQ}4f H+Vh2.8.(}9#JhBhp$PIZV$;*ؔQPi!K?}4yїiG{*Y8kz'aYgu=x`-XrzFK;6[uM&KV5TnGqqS{CQIg[lPє[Ka"آja5V[[QGVBfN]c3ΘӒ-06ؖ(91-e$Eٰ^lSgƂ*c9S{ɭ\ _^`is s0uiYeN'Ԙ1,ƚ)VOVuٞN+\"Fv{o$*17F BX"jeQtt{ZrW{!"oMX-6e.biLV j!8Sٌ%%9r~rYfTg7{FqH7yc%pj$!%? ?gOǒnڼŝUoK%.\3WPgEm H)U_ *P,UW ? в5q5CnA^^Iv5֍Ef@e˨K9n/DzǦ,U`V)nhsg%gIp( p/ DtD:ЃN՚rdi9^KM~en)Oh; JptU3. F'KPդž *1 >`")d[514 }42MCx䞕 =J$?RJ'§KoMwⷉ#As%B z)4pP/R/C,gFpS 8*cyTWGTFzUX)%; |X\S!+7ce>Z-}:ABodlFw!0E#.ż ]\<9Ntt~kD4i&V1 GR@^otK'.mzv ከ%B rF(@JmD 9}"F>b 'Ǝm5HZ-YJmE+)/MnYG2t+#3$'@b`ADJDTjS.bUhê-c{J:ЫQV* =!N mRы(*|Y@sD+&%nq`X 2&1J9+vI%qVx2"#K#Jx3 l`+ԍ k'Ci8sS+c9ةCA51'lLR  pcLIYF3߻:,Ui&=)-q$ )KI)iOM5)*9Qj˜`-fmw1*mjK6٬:5]qaF`NKn;݂N|'!EE tH7a _  Ym%FʽROJ"q 'Fq!hYn墪mȾ>W.3՝P#1bW0*ZϺV@ NݛʪHQ"]~[*,`kgEVI ЇDrPhN؄C T ӥҴLdzZ~i+A/aӢ]x6n{]i-KVUV>Z\~湾u{%4%^_HY 4?XWKragj@˔;C3<#+Uq9'0KFBX\+`JNj#4' F%as r$G@5 1uD44!f?F9Ffjc4zi:W!'ܱ|[0q6|hGwqb*0h@}vgM@mriLU~` w嗅GiTx T@$BTgKbqk]?]t 1 8PP4J| ~X550hć_V7Bt QVglM4iأYlׄf<5H96xg|G(ghDDB/Ya1Wa/#VC555 H 8+CN.C@ZRH7iBQ'j2flq"a> 1Ղ3 1 -50 h(菐{H {u(mgT8$VSiHXQ DhҶcAU9vRxіb(!. tGՓ"/.?9VЇ}h 5` 4P @XR.xwO gD[qX,ƈ,fZҨCQGh(tBW !qa' =p `@J/ J"MW9I'OZQu%a?l@QLO xY倭Պ FtC:_t,sZQgK4rgQĐ}:L{krJr 8h̘ t*xja4,)0[w^'<.8<z, 8ư-W(l%ՒHVE#9",+lGZ W)D1:pD J~a!1Q "/wa\@&'*|r*<2ɗ| @ Y˽[۵ɰTLqXeҦIw\{Wp{AN`_Dƅ٧yیHy>8`hs3,𷠌"q` ۿZp& ik#6:ˆ{! ,Ш_*_DnѦag*?1몴]°k7GAQA!dd | pF@U,P ֊ &:%HZ`hCV'68=s{ٿҚ\+!!&6*Wos 32b  )'o'X(IMx%l v#Q*D!vi'_1;D8a$"I* "8 E@q)R?P8< RLd TjnLLciyJMaz} e8b!)2͌OɌz} VN>G %3_GGJ]cJ˜,˰A u=@Xwu\b9'''gMa:@ۗeNkq6]Bi]o6:N_!YZ^LYY hƆ:$3x^z.ϮY-JY-DaZZ!*&Z1 !pdIqԸH{b|XqRArp`RpR >YayA6/3ϝ?/ₜLi҄)$,p4C9HH!ZTF/ σ:bj!֛1ȹ@D`…A?~DhȂ S˅=&¦OCl&Dl0g՜ [ GH"cbD9g=@QP^u}YdȗGI}zhz,]%p /p4Dx0k/D OK?(TaƪBCq0BQ%Tl1&lh4 7zI)Q|bDq9$Cb#b#lQ&db!&IBk5dB84Є@ 6*b6 16$Mc.с"] Dh3,UJo[AmD;o:SQA(*H&!c A\W_y5 MaR5 h`ˠJ5Hc=(\hIYZmŏ`d%]ףwqȥP|{jx84$Յejҥtj+;b#rc;`bF9 B.B=FN< 6Pr,ϗ=+ͧƱ zNGo?D)܋i1꫔U׾$l/mdNV\Ͼ Ak9űQ<Ԫ>m Fϝ0D*ޭODRKTSGM4Kt}+=**J%cIUFXEg~gyz$ C. L=Q'L={koG/QjUA.Z-gs1h契KY{|]`D~HBq ҚpЅ0619!V S*f}e%T텢TY8_Ő(CScïY$X"AnH{aP]UH dS"5D'%6PO0VhC( {#apt 5Ca~.ԈFx0܆kk X-pʁHBu5t͓E* B Y Ę1T1@M=sh cqMCJlQ l!&4CZ4Ι41ĄaHjgQ*fNF8#{J ppZ7) DQ g@Dߥx79%V4/A?cVt0#(FNLC,4' JV 7+-Fo:$UuQȪU@aMШB4'D!Q`*e?k451č0RxBEeB%a(JIԚ\á/e98 O>(ATzvfjo2Œ /ruôÇH yL6pelEq hطy-9V)G1]p߈7p3b$hB.RP#O4: $\%h % Tkĵ&ZTօ*Ƚ7\x% F=$-a>GFX7BUIT$kLG@%jpjJ[@rM^pRy9$. j-A'PT?Kg6Si$*VMv {ZhMlBHfj\;ekJNe[; u*B| Ĭq%5*gD 4 31ؒ,ax,cQ",IVb́st*HDNՔ𰴻ae ސEJ8}PuKn1%o#uBIޔ fvVib 66 "CI -]\H)n7( 6ՙFq!pm?Yސ~f_1:|V,, 9  ꪍy|'yV,řv{^)hgF\ԝtb؃I u>f֡0->hw!B!P ƥ'B^?\舊BREu!Z.qB̊];Wu5E8 )&,oDEo8b^zJ.'T5})zzWeTagqMj,]%&p,geMz;D'Szr٭QЅ26JYt^]FC$#o{Nkz!M(H>O[qE"}X>y4k5处En YΎ1aC'S9c㔚A6c5+9#1M49'E:"[ ٱٚi!?h0(:iy211(G;7#(+aa *.ESA11੓3)04DK.97HѼ+*<"dȾt"1 1)#QZzBRK "-,mAZ+0?W: 9: "8-K1/)la @AC ?c ܋TJ:t7 ɱEHjalc>$䃟[1D>( P%axl 7?  ,HsFcFt,Զf9@8?@0[Ѳ [K~@ =0:>3x/X#@:++X A,L/8õǹkasD4cDNëӶX$Ds9Dz2eY-܋ 3 =fɊ\Ы+:yBl j9L@r3jܠP$f"O`#18AW(-phIhqK.tF#sH]z69ô:Jyr$[|"/a,ymPn-.lOлA&+ʣzN>B ␰oɏ;Q8$:ǘGS.YY h Y@dQ++AH-ňŰ"uQV>M\40 H IMRs*8[Hzd`ia/5TpaOY& yniɠA%!hۺMcLoy3&S[oKPC,* 3H4u 5ʢ-ARm<5E `]p#@U"qrTpU}(>Pa9[a*%ZۨA 2:e{F)&0BwFRK>E|'e@%nCLBO+HÉp PRڂ 0._Z> EےрYQ(e'%`%h0NZNX 4ըx" ( ^-/- S۝wܨjSqD >peN9#58]S( ]5E4R;a` IB**TaI\ޥA7 Dݺ52ddW !Bӑ΃9 {ݴ[3`KۡTU y9FGc fIffAZJ-8nl.myxR v>lB%Hc p8ޖ fr[b?K7(2_)z E!E9Wuz nB5Y} 0lGb A(׍f`$[SyrJ':nA F)[|)[G X lqgepp[`֙Q- p"Ң%ﯦ6[lgxjPNSPUbzZ=!oӅK) gȇ eSfWwˏ>[3v PNzv$H2e a: OH7~H.T*/TN (cS]cD /YUfk^sffZ"(}qVZqnZwyL ^f_r ?j].]F8ҡ6#7gyWh c-z6>7aA"-N簶>~0N&1ƼqI 酰ծwǬOJ>os< JfMѪqYFa4-Vމ}ܩao47=Pǹ)cekjx*x:cn½7%Dϻ%m{u@gLc70~x[N PY$VWfX;*=[GYPS۞fxb~rPn4P_ 7vcag]KT!.&ĉt],I䅒( ̓DfҬi&Μ:w"D920 1bJXt‰P T?1Ѫ6pU\(jdWZb^h*bB &ġy,oW,\4%L0bг1ᘄÛ9nθђ0a:h\.UUh]SHiFT+BaieL16"Zªy{ "D4,j džkgS=l+[! zܩ-$bW!)B:~{ 7p^ab]h, sB uaaqXVrUOOL5]Mx<-؀ ׶N5'U B%[*:EP:PNRi)VKY\Ől!% X_R>[%iXl_.] JPNӰͷf?D($ㇾ?J%A]Y@RA,* }*l:&l WCQH*" D';:ȴU" x4dڕÐFyYT;|ץD$+pem?"<K 65쏇 ÊK=b >XzH(gN_{c-]/c`! ƋzCPE+Z3!RNJ.- sFgBN[GvFB%)OBwP2[-zS`~*iԠ"_W b$amazD-\s(A/hf="d9'X R"m:,Kt 79";j=T"\*Cv#4D3+S+e;$LVÍ#8c7Dc_t5D1 K}BEZɓ:ƚ;HoSӭEs gMp`h@=l)2HZ#mF,PI~aň**/I2@QLϏ6 VIKB*v@b\D qt%ݔ] *.#2ļADGTDJPJ[B!=tyE2~ʗh K3ps Zni`2(Z7;}m6~ N繺XX֬٢\UgobT܏j[]&ƭXV6]sf2 ",O\I c7v:@B'VLfX׼hNƜ7˩U7"1Dy8H>.K)M$n &;an7vZX hA+)(hA'oS JOy}sMA\NEGՖbJ<swDJQVc,)5#r-P$pJLGѺጋ@5(y|T@3mA-f@BXŽ@`SAt  QRS.ezBqe!/hǨl: uJg=L+ eS3FŁ-[٨}6hϱ_N3-i&mZf͟-58U#/H! 5lDۇs[nf6m1qn)3Wo2J h٤ƩJWr bŝ?x K_"2n j "WhzMAJ+}N9jc]zbQn0ZǿHvLFї]XdvD Ky_q%`aGq$芈Gq⁕-.QSd&eFilVZeQsMNG(M]-ӽqI4WC:9i|Zų? 5ELN VYq f@7!-JŝTKXhH7]H,OhEȁCwFKTħ[Te˧8Y CtP JUqq#P= cPy!~PWn̓< $Ba?.2Jލu\Dp[},,NTeF[3`?oͣelP싾 H#F !!q\}ɨ9$E=_4Ϟe4CEDY2^"`y\r`sIG}MDig99X ee!/gNI:T n e:Di)-X̵IeJLH_K0ZT @N?ѯBSn~ KLq%1+mu^$-x:[)g2Z"쭌xDZ}КVZۘƮϟ~뢲Jug("#)7lX ?2+W1 وӨ^cPkq!„ڑ)^z&~OWOI31N~E,"`i I8#LF/M,3lK{\!T ͞OL30Ii BLN, FdDV X lehYiIO8˭aǶHKWº UWHtA IHA1q1\$E$dWsyId 1 rlH VV4" +OA'ˌڳ$aߝ ,)#VeUU.c[y sK/} a^4Ǡkl-vͤAX%1qаhLmQO8 $G'9}G"MocMOj˯̢iH%3oZZ̎0LE" XCg'%FX]{!TZ 1S "Ge;KB$JK68.;rnOӳV(fQ[~+לQJƦ 3,Y'暚jlG ;rP=ttvkJCU3 k,x[\[bS +3 gɸbB,f\o-^fot &r`p]~QHDTW3iS&lBŔ5S\,:F XF(EbrWԓo#J- W*DirW^ A)TT@JҖvS, 4PfTgRk{cΌ1ɭ<