GIF89a@   !0+ B6E?EDDGFGGGHGHHIH]I[^ Zf"q(y.=OTTTTTTTTTTTTUUnUlUlUlUlUlUqW{~YpWlVkXk[m}]mr^lm\lmWllUklUkkUkkUkkUkkUkkUjjVjjViiWiYWiLWjKVkIUkHUkHTmHTpHTmHTkHTkHTkHUkHUYHUKHU@HU,LU1QU9\U>iUCuUE{UGUGxUGoUGkUHcTITTHITGHUGHUGHUGHUGHUGHUGHUHHUGHTGHTFFPCCJBBF?=B>9A;3>>.DB'LG$TG$TG$TG$TG$TG$TG$TG$TG$T9$T)$T$$T$$T$$T$$T$$T$$U'&W@7kvZikkkkiat]m]kckhkkkkkkkkkk`fXd`ilq{}¸̸зյ״״׳׳׳׳׳״תתתתתتڪܪݩݩܩکةةةتتߪ蹻˴״״״ط! NETSCAPE2.0!!,@H*TȦC6FdɇE1N0LJ-HRdE'G\FK+a|q /otQ#G lYRfǖ=k4c FD}1 jzEԯRwm/-;BSD5@th݆se#þN0༃E v7=J˘3k̹ϟp&?I&=5R;w1"v׸]޽Ĺ5%Ҹ{AeĈTiKbE-FѪXmk.|#r֭>v={Bk?Tڀ5|*[E5ф.[L*dJEe[kF!ZQa^e6OxuUVVx(H7ZERY<P Ř'JVjMFɤRdF1%fϗ_gf!!jh6&oQ(ti"'OԞb4^~W!UR'V uH8pYhFgj!U*krj| H;,0SL Yb/(Q:aJ!r.q+*R* hFTZ(dW'YUyVTsFZc\R%)_S:0 'Y,x@ K\\8",;+pZr3ig/`˧²'MTT xt^p i&7y$/kD`B8ٓ(-NdG^I12Mfpie(.ڱk\=zFbٕd  Ƌ! ϊ#b3!%kzXZ(V2 h 2j7V 0$E{jX&2厅W nR9+Nz3Kǒūr0ZbJkO&MLL1pl/8.-=ҼlwPvb𣑎dv4Eepl!!e;ߡ´$[tɘAլvR:ʬMk ǹr}FSTW5wU:5y|VF-E~y ]pL7=m~`8E%w@M|9q.0'hZ3Z48_u[v(a_l ^@$8LV6 iCܜ,"cyLƍkhdNYYR4e\qG|TbT$4H"tR^ hP #_&<2V ف($lK( j@l1"SlzfZNAM#jr̴5O@LH0ۺTW;U8t5MZɴ܌Y`tjy _YݎVw5ҦOOU͕1#Vŋ9P/vUfg< =JP/#qЃ0Xŏ2%ltIG1iɺ1ƿ*r/덡&Uw;7^Ç( njЩ hW]w^jWw<Ү`;>05Z]2#E]pHF9.^q:}u6|UnFkTvt1j<7c p l=!@4jE(NQC41Fc[O UXs|l3(USy#FEnT@tKmq+Hy&7~B?(n@~II/ ߱N>}oTRᄬbv+U>V2%7f 7#t[[XY"4qZk`%91 dA#be5f[,7J%Xr*'%bFOGdu!fGQ(g.^y-TAB^L]DwXhh]mYR/Q*Sw\owlGu4!)uhGZB0%?~wmg`x &NHL衋[jE_Yk}hI ;VbT]%Ĉ$n-8#(\AU1 `h9D5t b]){4BbGȊ^7nfnf=UB;GRH^LbC=1 ; A Gk~ pըDŽcq:Z[92gYH%IG*]?2 5%f[TJň#H%(:vh+E*A4gZRZ9z ssK,'bS#)"uCHuO.[VtF4G1uvfC>NHN)'2eRA#KR/d/aAcYWg (TvF^> zҖhVJvAZN-r S54Is'y6Ӊꃌ;j^!F Pn8(#OIN2M5TW%p֚c~0c,w"ʍixc 8v$ٔe$"ImRt+=uquZy[rpJI.Bt))qvrFc'X/ք- )|5hTv"IF#5]ʚ͢P:Gvs!Ȋ@XX?I]גA 1HeȆx BP1:>CKXqVe۔Ș/(>7`Drax9k#LZ/&{FGӦXi@H|;gAu@'LV~B ~l B\!E.degYw/ ,YsAJS.s9^KՙqY.G.3HrqMSeYR7eLʥ;XOJwNHx8*1T/ҎӅwjȆznb|QC>Bg4{64e;6a8_kXQ~"tyMI5GQk6Zk]Fc|Ih9F#'$'fe@GBhd~f}z)+^I yCNGNǨ '*2K"Z7bp&*e5G7`F480q?x-e8K\g^15j@\ !,eRF7  Æ Z;:@Y6rGwD HˍQI[lpcrDrALekh[&[Wp(*#~2>w(16 (yGVq46!~6~#MT'sA"FC8by[7(4B+zʍLx"CvFyCLxYFC5y*N"*aD\kr_T 4/$*:$L96~ɂ{ Q,; :w68{\3tK\\]M\?'t5Z: pTX'S[7-"bj F"F],!Cc:$Y? !|F!u&/Dq91*T5!3 lFs"SE_-iI$ e5RiWsCRfwC^;Ɯ>4UxV8l‡[{KAZmTK@6?:AEʭīxTmKRl"krnkj< &lX.67̵$H+?p*^`"WO&)~-=Ch:Z?1eEgAsG9ʶ 6-[Q0dwrq>6;L@tCr/'g8.q* #QNG̱CAˮ^KIUX"s!TH,GMUy{3Jv@N-@gCva'kk5i糱aⱆD5јX4D@_y==4(+mkS}HcF6y1YMn΢9rN\HtLΟC_uY;"4>^4RՕ' ݅xI3_O*P3U^qf[G5F >c"߫^a]6!U/Im! >arT1Y Gq &y\Gf"\9$SqBsqi&M<'L8PhqCpp P >Z|bB >Fh@ŇHP0ĉ]y1̃.[j3I'GePBDɑeK*M]JԧLG5D̑.EpZVعTYn,w}= _H|w-zp顥?8ףFZ`Uv5U>8nh:}< A]7WwA,8Cˎ>^qM/B7?RGTd=H}r-x8gͽK]\#0.`A6-:ڛ:HZ-= ")h<8v@(1R:&݆ N&U{Jbc {Ģ6{ɧF'᪤jD5B 7>6h0>%|"<Ȫ˪ħRIPۮYigx3f 2qPD ̔2U< Ct)'Js$65VH#jIk2hqEaOA ~ eD/^MV%-J͐w^ %͇]7wa)y/25d7}]8w**.MZy`Y!'i ÐúR2nweL]yXxbf Pwt`|wx!"zT^[>*a{*`1 jčb>6?AP{XEIЈ D ͳV:5,p-,uqC8M#}Yˠ l(N7˪}fڡ -| &,R4s08ywY9uq(ڮ Oض0PSޯQ.|z̏ʩR7xΟBYO40Z ?р@k /6-8·wuDAte(|-I<3`*M+%σY{a 'F4'iEy4P]iɉh@c2ϔJA'1OmH5 ybU*/H"ϩ$>Օ(5D<J#4bNn&Ppg1 potC8!"HMskDO T\( רΌ .2MLldI '/|P\^C#+2SG|EUYL2(z ͻ(مNk^SG$K&KJYqJ w>j ]8(QeAC wd(uB*U<Ю0*1CM,]<<=Jf 3ԽNq5Iޓ ;as#CE9@3I|,D}KC5adys>M1y8خ°FfsY l5J_P a\QBA2«T|1f%ltus)X) iLfObM@&15tSWl"j|KeҖO t 5W|(#mEG*ÓMG#kt}~QI8B{ՙ0(z'#:@ӡ8 рbh f ($1sΌ  707sB AȚЮiWpp7C,kyAyW=ݛhD_0{HX14w:4ȡOfcambk~b XVe`>1GuY@OXw2OUN{ pi7pm{ -AÐdqZҊ՗zzNlRc`WWX k5TӶ.^p֒ BoIi y0>^:T#0!+b;6MR5Ȣk2AV e7x>21YV/5٨6dcA߂TBQ5SEP9!]4Z?k[Sr¶!԰r_3è-kC9*#ٸ!W(zG7!*,ټ1__D^5D:)5jh; G[!J7E1̑D eDp{C ]@بF_͂d](.#M.-$Am ;D5U>XC!`FR[Nqxa ѝ_t&UH;:C{ HTʔu( P#,tz `60`ҥӒu 4vPÔ#l|ʸ( qȐMt qE(I€~xI x`[-*lS- B)ﻰ$Q )Ѕ ; u{?w)x)+ bB}H G̩L nt:Ҥs]Qh阣Ъkטӣ" !ʴ/'e+1јF ҭy]iEFK Q .X,в JXT S5M[#^_l[ dJ1yʪٱΚ"T(z5: ~^_gđt>ܹy 2,5yUȝO ?[N<[_"!nDʈ=rȲ ۗ"DI)X=ZEИ J3,k0 !騋)3x'5|R6qУ#2ٱp DBaY$)?WQ̱-R,:0r+U:*_i@Ljck?YӉىई(-> ʤMհȨ^ԄH[]Q8נi2gҦ]$hs'?(=0:3tP] tiM%9Qc_ OcKV"ɢ\Q dɧQ4@:Kꨖ(iX 6X2;(ڞzw#u&9QSIYFuM˦I,],Zx{`B%lx ǭIR˂2s)e̛cP"C(+#fV{Ԩ!hJDiwJ0WDpzrJRH,iFTs)w,+P:2} 8"b bfE2!)Jfiq8 ,{%\tz&h5/> "> dYU, ƽ.hE ,rO<ÉIW1:1}rXEeAy~3!? 0h/|h)~`HP/@ {E8iܟ Wkb<*Lvʋ,8. 5:ʖFAPX>l6}H8lO#lݴtpy^HP/P BC[*S=s' hS*M&~ğ*ǿ5"N3 9 xmu0phаIraBP(R?`;;(9o5e1)Q"Z`=m6٫C <݄V^$7VG ܰu*k?6x3f7n&e& .&RH񒷼LӘ^Qd(8. Ay#-ckl2f,M%R Sb8 yˑC> DkVC„sAU71iI1Y"W1RVJ8':QQn^z\JB(JN5&Tk184p)톬,PXTQJL&HC6d.ȱr g``'t$Jff 3YYj; OlG"7 ԝfg 1M֦󥘆G |c/M^d 6iD7N8I2e[MT\#iFA@(=?I"$Xtt $ͣ8ԟN@C8U.iZGŜp RO.ȟ<@E١8]fAiPQe*ANFlMm`ħ)x-qFDIݹ@e u֚RۡVHD_zAg%ۇ-|< \-=s +hoy5MDTF[>{D)Lg@',d<AzAUPuZvTѯ0+jz鄿 K6q'w֨R j}f\FSř{JIFhf5E؉E"^呎Vh Dϳ[G(ʒF&_<P eWtڌ& 1Ŕ&#KRڕnPXŦ ii7`NhK$VҴXQLHj ʬg&jvEk)Sڜ  * ""*@Up@MDPz 6u\"JgȊ-+**\֪ZbhSȝ!^{Ů=}]v삚 EVR:)GD%G%ij+1"@On(Ak} dD\# xСk[ҚE,p;!销L0Q.ɓ2IflSFkW4R ҝQhИ,IPKTZQ 2é枮o/ZC%`j0"oGPV\[8,2-s֨"xyK`5L$_\jUX6t}g!] <#`&oTd}DۅhZޕE$z5l1#k0Xm/ %XcRDՇأ^F5q5H^Z BaBpJ1f-iL1k_4#u5PV1f"AEԙhlFXy֬F͞#$Q/Λ%#w(%B8,Iќ*Mxrnm^\aRtk }َBFN!G{0- (n"[ ݊p^ŵ(P'̢36$qTHL~?Gb'F6}fo\Ae8+Dwqovjvrs_\H/EĕɕDw^XX׌3l,:DDT =rr)45(2iζ/hXGEleͼ됾 5bęf NݾJ7زth$qd$Iҳb1{:˅xX޲-mOG3v1c3^3.)TJt ؜D%ybyi/,8v?4DHR۩.YS[hMX|Ĵ8M/>75@Qc2 I| jok(v~rͲf9m# -<.w}o'd300Tm/UkL͙KBvIG _6ٌV!C^F+h1Gǀ3Vj6&fS}0`C㭫1Ekc =x5aodXJ+T,NO`EЄĖ4Pgo'(9P)wC8S#9GUu/s }s)WGYj2.lbS|7NB$Dյji|6}ZBfWX>1 3k8kgXZCnw]e [HRlꆥ}SPv1k&_5mv;ywйSS]TZiq7Z?1+eYv#gZcnwjry{Q7Q7ysf Jn njZwa73䞠F6>33lEv:|*PKwjqd*V`V D`~7} Ō1cߺ:.(M?k?('x.%Nbqhө77)X 'I[{Qԙis;oo67[" KzĆ smO Hǽ2x-]Yڷ_ٝxjjuuJo+y}i.GccڵUIqE 겉ƇaMD=>h5T{tAk4NֻޞeC7}OriD:ׇ1,bRb JRnWȹfg8rpڃ>ɵɣPJZ{Ŏ.p{dH;-ye㳪F@+c.*Z=%F MU) ~k\6xW )Y8ϻXL4Q+vm =+UMdho"Ѥi!Դ踸>)8Am}G7=`&RwkޮϾ^W0gul쟶{۝:.}b'H\̒2!:&ck $3=+ 1ql&5U9*0TPPe{* 7ySVG> ,/z(MC|Kߑ^&QL%9BY<4{|b SS"0^@= dn詂Nnxb4P;jrm&bAP*0F PhdgJxMlmS{|dgL.! X>d"*B$nح?@OS6#1$%-b+@: HG|e!d Jn H£|On*^$0po'zjb˨OV 5ίVዸF)@KYq0nH0,݄lU<$ھBBb.g³B^t$`F xipqMd t4j숨hltd;nAjkdjCrU*<ªBD+.G`ROShT +͐xoX L_##h /"Aj%RO.pbA#Y$\B.%ɰ2.ͬP/`@"QhR2'LBK0 BKQDNNFl3c`) bEPCeTÞK+eOHpBG֥ElM+N☑Zp.HL)|w͢Q"r,Kl.& (YLɫ$ )$,1 .(t0 +$T* ? /R<C-b!n6MsD&-W0^@~39吰\_ kNb%?K+l4n&:@K4hCr ьN3AdmMjbIV$Z?oď停(Ch.hq..H\'pb#+o4-_#k8nئqDW謹l.6&\B:/Sf1ͭs"% %ғS0u oL-$IT'bG\25=zQ Q1$_9f:x#%9T9L39[CPB+Lo%3@;5P )JsJ2yD+?GRv4)۳P2-gPȮd%"."l#[`¹@) y]DW5Duz/EԂ5Ya*zPC++0Dqfզ..or82X-QItB |΍e<>!ٲbz"\(P1ce"PN .Mx~g05`v~/No5YQV kAKS/,PLU\gVPA\ `J<}Xd72Q.1Sh5-,&~j'p~)dYl`dadU."㖜FNEnWEDaqnGpu.AT) ?lS>P҄Za{db[56q\ i!0@R倆JhTQtŴI5݈Hu`>#WGǚ@@ai6MD<84Tw)k2SeEP@$yWMw2 /f{ofIJ=6o7`rТRm_NCh*4PMHobBӞbMZ 0òbH@D^A8"7Re*ZuUA5WU.>8/4yȈ+M^YDh"!X$[crU|U&=6w3#a_3?zXgm_UQS]0^`G.w!JJ8v}x0z.v 0e/4_%PC8 {LdgH`2i1}w~ ,(R5M,}#6#h.6n4pb*1OVSeF df1noyowoKV"\pR6l2['w-}1 !W׶?Duљ|s_Q,4J1Tގ94xFBl0#wl!9wkq J6O9 4kQ{{4}ZhFRajG=3WTvRw!䉹О8͗}< ˰-PU"b|+ǤDz4O.Æt\ BjBwZal 5r3>Qsɾj ,Oa5z^Rsfl,^D2 K٨bU1w<'vvU(/  ʶ~BKe _[Ү17$9{79Vlwqlw761R.FV;DGGr#J؂9dM+:P#m+l춈ֻDovAf+ &Bd&wz3o4~~&S Pb] {]zuQ*B)\E , YViOCI#:7{uJ\8Z*f -bqwF@`S`DZUm%ۍD,SwGWqw24hE*kRBa:b0:MLAv"~#.©%vHFNN0QoIx)Nk_m³6O[a S8+pSgoy#B2'ٵ^5zKkųկH Gٿ'tT`r!q=$?|Si!T#-s$A[*B0AEy +Y  gu41U_-,\tZYzYY H,Hl(z#:/HC?{+N2*XzeehPV){s;Dʂj̇6(-gӛn(1WO|4Q{._I^:n,䕍8 -60V$咄1]wGbwPb&2%Y %a(a3yHd4?՞nO)],(!ZƁ=kdc0bT]F&=뀕+"ԒnO e=Hl׼X"盧ѵ!VJidz{7D 6|Ɛ'd-_W]-ЭQ7u>\t!4p⅍x1x%++2"ªB! %~0GQ͚Po?-i= 26 $cV+>vڵZ;k+ZG1FY K)pV ~b{kZIsŊ:1ӶܮqWJ Bx'Ω夊VQF1fD>F2 Z#Z8Sz4JS7_}$pal;F8Ђ~.r͚/y徚K=95hgGhlzli m6! wOćݥIܗ[Ӌk,}WLh+g۳~'<_PpW}g=\sgV^ElfZa -Xna~x zHla*fH "AeL2dGYWY X VV+/uVEV]1GqeV  -II=н$^OlX6v=֙ceS n , JXz׆(4Z"bqrzf`nqI%oٍpMw|E^ٖu^MDµy}7UvZV~Ȩb΃+Jm)yDѲu_tU˹wf-D.DNL'yc5,=_7Y)53 e.U `ѫk{vj2uPa8(OMj! Ux| UWef%Ɏ]3\N?z@X>@ K:J9.@CT/s /@`.n/51YվZ%0T[{]p#!!VB 0,\K>HDL1ё0r':Ob$*hô)e+F>b}cרlF P]h$u`Ē"M4HM1լ9ZǺi#|L}Fkw3{K4'y$In'@`]{LÙgXⅎyVp9ds\?ˊm[b`L"z 43R+tI@V-8J#c7,n"8n-/xkkiIp%k[~qskhE.ngB%Y 7@YYʙDSuT'9-cV9g qsKb/`HTkMHS-hɼjY/ 6ڵvu˿@؋%1Nf,#&4_OR[3\&مw"IxwkyIQ1>xu3R B^p~'gOe5wTl5)RMr7_2[d1FbݶiǗ+CnG}RH1t!0u.z~Bt{^rsu"ҡ"]IQdwm'#cn5(o"">d&3c$Ԁe3}ೈrSxӇW0@ /4Tt$XW.Us&zezzVz~L)Zf5X)s,aG'G%~"z(|V9iDGLƄSHn Q1S. 9 ('PXN7=3j6~ɔz'Xvp8 *$Roero4b؀& e;sSFfbnSn>(>_dQfu '8T,z peLDx6;wC,M2LgtTQc;`lJJa:B_>pKiF$3[)qVդ_"_})hV~* ul8_WqFpl noKi07_6|.xUSW%J-8wSRnY&S?SYFeaoG9v"$a9؆as&&UV8GduZ%Bctih}='ZhQPbj AE@k.0IsyŔ9` C*(iqTBGkcwvh6Gg+iay^(cmYp`w>jyz gRx# >\JS61EȀYwS{kT`+31c;"fTO;x4&!Y8ɖjR zYxzL(zc6Xwᷢxd{IvVO5AQ Ç9@4Z|E=YpELS,y$gjڊhպj}:Z&$iuYtIHhjզ*qȒdԑDyYJ+s9JZ=&i[.)q  &uբPO%$i6*z^(顷P6J{!Fr2IWhԪ]$_e k(J= K*(yZ +QKRS;Ze"[a3WlA *9'Q.%_kţ^Z(լJu;+)iۼcԼͫA0*+5XR| +{P3^9: kHh[[R;/(!>뫕ƿɳ;<+seKh(ide6džeGJT!,ƫ)y+̩{ÍșIV+f%òHȬUzF}ޥʵ׃GɊܮ%IW,| ' 9M%K6nm: Okcl8٪RYǁ|ϡ-ͥՍ)KѰ۱2d,̪iQ`d'l ݬK{w^֙?< 弶*ٲ\|TU+"LƟ|g,PY8kmEgUQ!NL,=t*(~j6+JF^n]Ψ c)ghE9n<e TڤmާGd{Nۺ~u2l%f]-㺋ѭMګBY>.-mꄌPδ&ƙ5Ӟ٭*ͼY4reGHP,iA`ɈVmM̃nᑪ~n.38 $m-X5uv/Gز\6 *c\/Lo8gyD 翹i8.]FnVҺVc>qLU+1 'кk>װH|^MkP ɵT~>b(;pQOh}ޔv~8XJkl뫎Tp { gs\ S%ƼI))ԉ/lax5,i-l  O(MH,il,;Xߘe ۟.. 0UN8"n\/UbQ\/3e lȆA.,HPa%&l!Ç-RHY2I#Z .M|9RdI7o ~*jϻ1bőbC[(d:B>`>g䟅DWKa۹qݛo8D NiWY<\8ƯYcrc?^|î)[.Xjǧ_=SZynЇ (t?|x,$䋬[1D2GLDQ, 5t/3tmtqF;r;_DYv|$(.%[2K.+rվq]e'F8:F+M6l̻ϡD#nP %PCEtJ+,FxL8k/E;]<[V3>N?HM73фȒ|(GA TrI@spGVmKTygzI}x5Z&z!VZˑǁVL]5dIZLhY-\r:dO/d~ÍUeKvPdl]zr]FK=gô6߶ /eO6wy7*gZ"^齳cboEV~wqMجbr(Ew.EE\ޅOe^ \ 졫:\P*Lzb$z_TƁPIBbR)EU5q^*5n)QJRŷ2ʏ{,(1HVΕYZ1"bh5esIR.8xzLb8mE˓\ Ą6t9ƼEZ` 4myse/i%ŭ ߆wYm ܼ.E#=!u k(԰S9[F4 hz7 ~Z{X"lXKC|&k˲JS<-p u43Cb#~z&S%.~'d j⧾X2Kob7E~s3qfgGHAnJFS~U}|]{HYy +:+JL.c"@mgL+xҍ ON `hw^J^*l fMQ Mi6y2{kiັtn2IS^z婏N!q,8wk[T~znGq< E~m=i],/Tՙr}|g}jP&l-!-b)ßҰL򟀌%d] iڮ8-zxKrTDs>QpG\)p)GQ؎*Wg;jϙEJN#תĈކ2/P*蔈d:;s5s;^ =c̘Ikf@usI58ԧNL$-gjm`] 8txsJL։i`Ѣ}|V mY+0 I\W?>֮&ncg޻r'3$1ylʍzfIPW{'9k|\\P.$X{O0n:uUg1t}fڦ:k94!?s<5ACXV (斎VbWLg[OuhDB㉋  ҷ༃9= px@"˟c>?,bxtb3#;/9n;3: Kճ?xG;ʺA٘"GJK@L?<4ʬI8 6GG&k jL*)|tL6*rpƶ F̥7 ]鷩!*ʜ "TU>c/3 |31gFXӡtf<സqT;̸TIPH9G8K"Kۣ2l2 ξ?CC/BN<-ɺG Fs$PvMj?0BSZhaīJPS35t1Lߪ9Ĵ`45uJ JqTǮL ˯QEN+!)ҕ K{KD'lh3?٧LL>iwM%Rx }E{N)^,@M?2FnR)MR?L8-@T3Q TX+PB]0˨Q+LIAj+#rbc;:"<ω+y,=Ϧ:4 YX=>HtzlKf䌅%JBm4 )4<KJ8e5[V`Vp%E=W+x)Ӡ mVm㶺2PRQչ(L4F9J: G}LX;EU S%D͕qΌXbC-nEJ :mX>c%Y?Zʕ͡}%_Dsn׏|Y} ˴G ŋKbQ`:ਝ3bU`k]|mXKɄd|:];*OaU9%[}1? WEiIp?aU_H g ebzLTȜb|ERB>.Mn2>3c \gqɥ `c-h9N hV%?pK)gB1;%DYC*hZh>XF xߔe{X^ 1 mPQ&4B` ,鈎iejZUc#e mP9)ނfhF5`̃VF>.L f)ɳjffmgFf̿-N/qiDvNdZeE6>Nni]j 6he?5d:G젬bc.Xe8oh2ˎma<⧆dH>bFb Vi>Nχo?c]({!$ҋ^yaL V gH̦zF%sJSSqRja&HY=m-9_oqqBvv8l p|OjdPHNwCO|Oe%yW9bn]nmFs_l]x.+[cLFxb7Ir}B-#K)S*\Ʊ>TwhN,SjWSR3-\lw(TS9tv+xvks:wM)cEQr+V] vəXG/(+D֗MZƤlfzRlmVZoNo*3o}waf)LoiRgA.6x,Y7ۏKd\ebث%][ D4'mkMӓnHEh!`,& "ZD2Ϝ,x!dPˠs!phK8M=(F%#BE/P+HeƑhu'r=U%fױjV/!vq#8 r;ұQydir~GVHGFӤ;(QijԙTJ)RҔ&M *Tҫ>+]jVկ~U[ +NTbg+UʹBk%*Fjײ,]*UU~)\̹r+^攥TR0+a:nVt`jZ6*ggJִ.R}Yid*ۛ^-h+ԩu-Z;=m[+6f-Wٺڼ.w+yiv5uK٩^7}G ޔem'ݰ o  vq]*ŕl,wV0w]c4}\ XL[Y 7=q# ];aڴq;КרHn/X{cuO2)*V9Z2/9b3l333 !!,@  $%67 GAFBEDDGEGGHGHHHHHIKVPaOhKiJiKXK$LH4FE{5 94& h ʁl (`rUZSE(<҅*aL֡lKb4UjXWeeZ[xTU$Xmz_|EKI2^LԓXbV 9t%5YzoUqbhf*ِovq6ݝ6agh_(bT^~7&!EU:&xrg^vU^Vr98訿16|Hzc ͤC5`=L!֢r蓄-zaESdrk'#q`4"1lFQ5V4Ij5F\mEEFkE:GW 0E"Z6`*Y @zQ0U&9,'ziQx6M43ws$A3u5w8ϒcrectVojӪ-k\|w+h N e3!gY%^$9кhGJcm{jR\]0۩`ryUcNʫj`;O{Jvl`F&g Pe*}g9Uߢrwnib/\Au[ߎh5wQ&y_4IVbޥ#'$g|1vI憬=Rc)*[T$iVqӈ=,;" h(0#vU((]HDR90y%-`.gDuziZmLҰ'AIf k̛N * O(hag)OqVKL0Şeo{qj9E  C V.cu(Y`,^VUETPJ*-ljRM6v,,6[U6m0l{2VUvzKB'dZ*E_hVF%H)&QH{Mڹ fZÊPYhD" NʖdW$EQ"9VQHRfq#6Q r~BD\=J /w{ !<ԎTh 0ЄPȉ/]^鲂"gtĊVZX U"K!w|*ssy016̖fZ#5/*Ґ*k/U&fؙS$y;G )ȭNֲMv[ ΐqiXiH\ Mۼ) %^ ݆|wFt@$!Gr0ZG\.@-'H w(F#&&[aCW{x5oh#P~ ~BdEV:FMc'JIt痄<}HXq3% ] xt}  |3u[Ѱ[!{AxrP&_zSoA2"6PQ*h+1~R28-fDhFwrh\5ε6ق%5vXG Ȑo]YF5%R/rywvO7GJugc8eǔ/^$ *_1sp xsztP9sp'UWsUA4:ƐD>peJP EJwQ5EOTT!@OpR4a r{7}ƌpF|iۧ6X4$lC}sgBk $kP L'~ pؕ}$i/#aQ.(ifcFH !Z#^mƊwDKUp@$3葬aa"]byIh2n%>1SFWuF*wRCǚVSrB?TjX5i(#zRni'RpaHyd 2 EÏ~Xt3e/Ub BtoG_'JږbLbU3Gc'z#R<qRnF|Oc#ozR$r5= YwY~5Lb&qC,qzЇ}@ XGjwk:]/"1ZSNm:'f#K9.R9ʺz:T'GәŊ'lu!q!"SJR]t xaDwMXQ 0z/dw0 kc y '.#gbBӈ[UhUr08 )ȊwDr᱋-m3(t/}b3W[$m՗A&ڈiG򌈪RR0SטM׌ڷB19 -yi.dw)`(Cȝ"]twF!!XsmTɪS)C64ɞ̚|9H_F%LHrMԥC ʮj'"bf^H oe\`H'rۘ^CF(w"4Y)-]Mb-ִQ fWbD2s?E©2 R7W Gw赗QxX ˖up޹luk[q{Svނ@(gxa&!^y/^J-.9RVQR SA#o~dUGՕuԺ/*,QTGXHXk]7zP8?mQ('LG~Qֈfnq&»Ai\1NVA(#hE#D-{3l(#a~MޫŢk7PqC7cd\M$uY7,dB:?&ug\¢2KwOʁc b\#I s 0CpA`ޢcksuk[nPVYKxYHB!;kM+@Xl,qYR ,x{uǘq`=.!aW\1[J6fȲ)J+K|k'ۆ>X 3@B7ah'Լ-abQAU &I qˏo $u7{y2|ˡIؿKvqBA& OL.OĚ9ӆ ?.U^5!BsVa9A>B,E Q{%Sl.^OVxfеw#HX\i\ՕG=lP tPLݖW +.SfbwR,YE.=fMH>T6`19d1dN8d?[qH5츰פqǨtLSL>Ȩ~?E !qbIsw)CBkAuY11mG]d46 [mA>)AԃwduSi4g4o$0ܹ~7TrfzgR*Wc,CH\"2^Bg˕"VL$`n"5~ReY9-:xN/A$6&Q"oJ@e`|2m*/clj=d' ~vDWEǷ4BڈY ̿bq.\%fe VWŤWE˅|AAC/=r$-X -(u2;屝3%8`O]FxrHZVㄗsQ*@iH}L}MMJ:sІgIl+Zi-7'ݗ#KxLBzy<;(Y'xjL:kUl4Sn0hRϓJi퓼=|V(R*+˺ͤp avr5~5AthYq.i<"B (`=Z=Ճ#WYFY5:S[Z[SjȫnJ)3=j7,c aA,4aTah8;dqߙuqp.F|a`fȬ& GWa)|#?%)2Çw`nj]^]J?8:r5 |ؠ BP;F ~xAHf9 -9:2G3 iRY^ ڽ+GypRh39{*Yc՞P5g̒]TfA62H2O Yln2m̞ 8ZN;y4־DY3U%`4J( (O/$n3`Gp>td2Ӡ+ M1cc\;C?:xGsv_te9ۣ*h3w={ioϵ4<*== *p.+lPB\,4 Z6#>rÒ9i=RⱷPPHcq뮴 KbDBHRC gTa;c>裏BHt.r8,Díd J d;2.Ӷ.\UKkL pAǤ-TBPt o- 3<`>$0'/ҡf/lFgT_Rv#j`>>oFdCCYT E¡^G>Z;!UlS-U== zoZ)EU Ax.,g;IrHx Dd7ȲY IY㹃VK83[*n[Br!÷”X:rI%a0a||ʨN Nϐ: ) /aɭumMΦrnB bӫ;f;|uDї6dP %k >zsQ魷QUUm*L'K3wCȷOMx-\eE[!ZOPFӕkuh@P> XG0cŨ5uv dQ] `c2UB!Rq?nxB`Gtƴ^G1Ծ%!9%D:G)ז8M pj 0Mf]M$A~d x6E +:{<6"^&1 hd;!X%E4ҀRt2c&j$јFP`NJ=)Ϛh*]|v5mF~ qx Tn&x':^6$5$:7ј.,9KfH 閽ML](Z#mWhR"F):etq>ė !|R0UQh1U 0 %-&TD<&8|0)KQab l߹&$:%КcTtB[F(FJH?uQ-)@UWDSq, Fd(GdTXPBS8= H3Q©ȎD6) h32[d`RUZc@WmTpl5Ny͇--F':.?RP66`śiIޮ4 czb6psE\BW<[ݟ*Ȥ$RWPAJ5"#w+tX2 gEbt,`tJS©lӃai /${1# Dl@w1 V2R. }',0c5Zf2YbLfBNJU)>fMI^ >u'ZyzDU+zc'] ܘU~Q v8gTCԐ5~Į>ed`6ȯ},t!iHQa`(Xu!t4:!GKjPH:րP[gf9Cr%Q@]/9e+quM@br)}y NxDeGnQeX5z^.ۺq, ;(]Cz"W^Ihl"-5lu+)փ#1!M.oB޷=MgFr-bFS_%U1g8=Xt UHPCP+ca aq?:s6xQ,sSOb I@?[Plbv⫯mёY;c.(&ڪ6bQ"=IHfuJxw*(AJ@jv xzwu[f):3~D~Ͱ&J#RPߜ $P)iyFV(|# t*Q,0Xfb &u;(; &wcސ flmG'>cdm;5^C2cdʿ(K瑞"j 4H8 9)nٷ@Q# sjz9ZyCXMY-P2 \ш$Dщk@DJcOʧ"HqD#<+)0ŦEyDBhhpeŔ:PDd2L[$^\1'j;KKĜ/cҲ?29D?DPg۔Fp܉]A2!P:@hA%F^#qidF_Ih)p ɨ\dbҚLxHDh!Ԑ?Z&ܒ܉d xIhk`BIsIxDvG̚&)8\X4EF[Csy@1ˣAGy@͉Q;f b B JyvN Z&;D#ȿ  ڍ{0ICc  QB;̒J# ;b<3 # '̗IԫI Dԏ+I5*)i9EGJ)  u<@(VEbjY-ܢDIِTmy ЊhΑ8j"6֨GI H+ T eK j)LlԘ htsŜD ֠sH}@h-A@Zi)D6Ķ \Ý`kO#wҠ{ɛt@I)R3k|t;98Md":@34ţr6Z-]2 :GQ#\5Ȟ\(ɨ@Q,P,H YTW8*+"hٯLj)EԵ%YJrfD-$&acZDi1br7jyC?{Ї

hIS}͸.@;cV o2%;두 k+ åܺC^"H'qn{oZA6Hn@hBv B m8)smGP &}p0:W pE)s36m2 /?}͊r5tZ]0 Կd6@}Desr)CivdQ 2Cd(g_?x A8b >z J 1;3\ 1͐|p(a?ƹ1slJ[Tb?G>͡l{.CNE;1ۗfI ;==U; )**'?pRh;dlq)'8y)Qf&{lMM֮#fnXOKA)-arm-4xbt4.U9fFޯG!e*wT-9?jG|_~\rsÜ_+桥iZڤP  #VQCf-p`r*ad5 6 `+EGf&ad vΞ}hЙ;~dŅh"RzTYCw5h*gmPB0CmJy翑r9RJfZz * p0*ῒn8["ډ w/FϢ?]=ܓX#^lԩ `eרxoksTA40Q <\K"E ʄN,՘`w\OĬQRUʃͿMQ'a _fцXm1r?i[}VudbQZd7 v,n6XCgtcَ=ŕOt}O Q:RCUx_mGLhɖG`RT=VuYyt-)W3THQa(YsgEMA "AՔK!*VV>{Pw[^juZϙفiT!b8cJҘ*DA#RusXnl\q2c$SZa `xVuIRsjroW{^ojYtt?e?aPrRE藃ۍw,B.*:TE*h+˷8 i>!|$33BlQlA2=TSG %J(Р(}>7xcYuZ =9D8Nd5ql(0Wi}=ꥨiYDњ{GXUXez_٣sFB4l͜Fc>pVwmd{ӈOsZ\v 'I\n11:a!/*[Ư@hmZ;w(Bm؛|&' &#(79&*f5KҐ<`g#qD$E(А (lO^ML ,QI3qN9B1#JeT D@M"dB-P:PIH`O^߲tR" [d2gE1nr9A"DDP`=`l `bY,+]{sgcLJ2#d  nӞSB=ɊfG7hYO%j`)xo~ܥ#D;mOs !"%$Vfc G31ʚZf48?#p',Tְvka+y)P&s sP1kYbo%C\ȟt!Nי"ųNJ Q ̊lYzⲒ!ećdRߎH. *+o.x Q t;S:)?S ӻg@0©#Rv1aBV2Mza%Uh T"IJ2Cscp8,HZٚsG􌧡 ,)A0@CY>;EvT;!٘6̠t<(l%%(*&-p!*Ath3 g(¨ăAa8TTtS<%XgIH[|N%bEitR?*! 9+5\$J+ZF+$Ʃ $9l&!RsiSV4e=Hz8)*/͒l9Myv_fK!]$s/Dгd2KFKg^,e0)lvWaLB ueJ!zb.7b.H-AlRJ.RE=z\Ф|Q" -9)# !'Vf-[;"9O.₰y OZv2G?KAjƦ#,UA ^IĮ붖 U`@9lQe*+IaXMФiEmѰ9NCXeXm=S hѐ7~e`|337\`\8Ӡ$` kY4eI{HVgJ(]7kb h "UE˵ʗ8kFAVsxU[/{+Mh0EVU +EFdHI\Rɼ1~LpM7qYu*K F.fFϲb$#lg:dy6#%Us{ΝGJ^9+q)/|8}Rb"/ɋz D)J &(FzXGZ`a#]DP .OdWẀ\- uxm˚%a-j=ՑFII\ ف,Ce[4!Wt^:YїG I]X2C׍?R 8Mg5ʀD.M(0 אcЫLU}a= u"^" -.aDMJ tyGzBT PYN\ R@8{ė5!w_HeQmqEYvY"T{:yDŽl|c"xF"̈́/ eUTU#pL!D( "yJO8Gy8 F,BQ㌊|w~d`8-c&\t>ve<]^@C$>tĺagٸ &NEOڏd@wg!aT9سoY "PTSxyL$vHGQAE%y<\ahKa&3'a $Y!^tF(e(a<bM#"趠10$@֌W_3no[B\yE xpETODARD]Yl#U)/W`՝W )F@?chVup\E\un@DUNtNMddihm{OUc-҄M޾٧j'MyJPfiw^zz=I\v5(|lӈ阾>oeG1*efe䞪ć{Gώr˲* _yxH((c8,#=4i֧l)dͧMRjG 9l8C4ZrsTH OkЦll~)l p 2ɔ,TbŖDzlFq6-ĸ%By)i M@NNN,d~)¯/o.c mWj>B !QkȝJ}]~Upt>m!iإ1^b#s@2c 6lZ.gZZ*HA+MGfde8xQXim WnTb$ VЊ,IDP IYwG$reR.)taDaڈR07b8=,Lz~ L3LĨqd;ʉ[S0#_MP$ѝXn {`ѐ4c/Ķ//Ϧmfς rlڬͪs$Hp2?~jiUI쭚AvvZi:4g-G-V-sږPinڪJQR!įkƕUKI8s+ঊ El0q92 L".fn8J˰TȓP4pƴv[0ƟX04Y> F<_g\5ę&4qIaʐD7Q([Y,4orSr*35i:>fuH[ 1IE$(zЦ)2׏ޝ#ˣ, j-4qxzFv$@ۑ+e(&vqEG-rw5RW5q*f4gk趖o{eaFzI q`}^-ntn4^WIOQ] h9lLK1AhzՌ$Dwps{Db BpRR&2z/yͪr,˃Xv H-MY;iej{rT=g׊ _6?uxƐX7Ó&}`ʅhBOLc0(vPn/?+n tn{ C3M@]v6'x4TɪV6@q8=,tU'({EWח&NpLtj%_wnis7yMiyGy+Sqils_UPT\ ;7کAZ/37%|zԥކo'xɁugU5%%]9fmzD "k.<frӸQpgHQ3֣UNDYC]OԶ54ձQ/B8imFiΒ`rGItb/kJ\uVƺ"3͞w,{CWh@&ʐf\/dxcyu6CH}g[H(\%bגl&QX {|G0Ac9v[d'2T`v2{@*ILx8j+ώIVӰ^&T3qX ? >6q}7&DmH-wvʉ{{飣r2 ~zySoQDbvX5䗐irl5:_ 3x_PF14mԧf+=s>-=3"Ci\J%Չ CobǍ'׺ZG7-.ʖC4y34Dpqi(^(i{G/j{˗#ן| m\ V2 eAZP5vS dK&%N e,>k )bbʹ8+p+;r} Ү;!2B螄$hIj+ wP8` -7Ӻ $N,jd+?͚r(CI歔:hC  G7 %\Lp\S1N3R48, TpY{[MG#-H]35X,a-vV˼,+?zfQ!}k斂1Y;P@ o:=v+O}60 e"ml$}(1'`]e[LSC ^|/Y_!L!}<9GaBfRh.h΁&7H+ IR9dls-V"61lyfRz稨*+K!y z,qrrB";5 6Np<6`.MK}BTUu_gTg-ُw@lD&M)t!M꽓nl0ƽ}+:w)E =:NJ{黗ϻW}fh3}p\ % M\\ 'I62I5BgF]aIҨ-1M`2x* nv5 IQ6ѐtI5Z߰y(Rէ='#J㠭x\$eTe^bՆx*z@PP ?Рw#46w(-LkUR4ز#I0Du Z2 <,qWIc)CK θǁF+Bъ`1g~U@c Ùɨ)4cEe^q>ZJi2_9 7?\tkP#Ψ c!".Br,LTĀEp f}BHqIJ\8 Cxp4ȭ디tϕó%j]E!dwO^BU{52fĔƯ4SZ)_򾔖pIr9kЃ E=1uL\p!6 u:5[aK#H-PL5!7AKH( Av^ =V(Yn1)H4N&RnCz:oTRk{`USq5NY7-5L24Tjw:DG =nq7K"ͻtP!2C`ԖeDS/ *VBQ:BJE#JB5L"4N=*Ba-ÀAs8'"wH:\fk0/36㖳%` oT1&>3ӳ Ƙk0 m df3Xbnr34ULe. Ht!Ƅrxn¼:h⃈|I!Aef/CwJ1Cq%OŽ9)BpDO,¦ކA`,Sr2 Hs*~ʹt5 6whs6)Ct(f'Z8bC: G"pd:<=d|Y>%:dt(8);;65J@R <3@6VK $S25I$$fQ/3HI*AE0.,p$2Kq.˂&*guFĐ~9P# 8l-XWZ@q[ S-RH~܌Tm<žR)DH+HY3 zmV0i+Fs4q!5[!p5=u6OaOr` . !+o8T!}fX"C|M\&\-ֆÜP+3Щ1lڄM5J2г hVdvS6aADbF&c[GR5j[&JG\c& + L,o40q(F%=nE VKY׊@ca&.~z)GEHdT0B$d2o"DЇH, U\uLbS%-iÈiDDva<R$( PPpO`JG\fYUmURo "&SG19i(1vIo3Tp7pY @pU;`y5&dY*F~ʻVߠt<*\wK?"L/X ml-D%wp%d-66}Yx-+kv[L}$ia̸SK95!Uh~4?M)3Y'r舳 / 7)MD$fMր#D<z ( ## :Ec֫Z2JV*֢"sN6DL)'Xrj.HsƝ&5k3c_󊕰h[>G[HZ";"5pxO]gDfX=wJPx_Bc#{hL2h 44HSMsaSfh:{jbcOR:ttr% mcg~YA03S80B+N"oKypٽph5/B/Ə(gC/)QZ\GfAQp0&܀R&A޳`6"$t-ICdgNbH!+Me%TIXyJ"1œ/*>m"4WS)6J.c"WԪYi9/aZ5ᷭ uHy+Vd5jX`]Ӓ9=aM|էQ"$'iR #(IutӴ_\l1~i%.a:3C[ }L+=X^d(;韜skU%KAH];'Dl["#!P׌J{ل{}q1唲kt?Ffh}tSj(9Jy).*I­J9|Yz"YØh=zE"3{=z5ӕ,T`4KR72ńUS1}Qz۵>x8^%Ž;dUn6BZ*uo(!,["C" :C|0uPOŐ0>lQѻOD"^.$kFyE8}K_UAacVK}$wo0l2")sH!-y.;^-yܖp E"pɃJE` (;6zȏ$G,IJ"BG*(DG1(F1B˕3q*liԄTVjgMYz"X( Ujڜ5l;ԦoF}MqѬyJ-8≊#~Z7P̜_ʜuAŅe[MJm޸9vٲ4MrDi/xfmoB,۳Z7j󚹠 6 ^҅.k,O}o+گߏ_r UPu&$Zw WPp4!fKJT_zE\SP!*xULxNAA%BqH}4F=:ҏ?X:cG%L(W#`P e]O]yOyUhQtY|A[]nBf]xמ~:h^Nb%zT2ehT,̖crt "E\M9^ŚelEږ4d?!c;j4d^\iOEuHER%-F,|v+ Նy=.TA/lh z%OW4a4AMN = o&M(@I\F <ф߁{bHOU>mn"\X7Xut^N҅AͧvXwcg^k.T#0e䯰2'h (iRlYSu9ޯ^6g9GicT0eHC={]DM]&מBo}{v.TeCf@{n<1 k&RA&|2 X89aTA#$p$ $lVä`|c:O}DCHm&^ \ilgYMD- 4`ڴ)vU;.XA Zm[mj/@[@h)\c 0IG^ "f2 P|ݠ* =. |IMT cj4-Mx`~bxƚMv*3<+YbPfb+ .Rڤk:IG X0&>ebRQi-Egla+|䎭Q5L' M&( j5VBx5-FCXWԌTF*1O\&Y-T,9U&i >[ųmj(RbJC*1QԫՆiLЂI;g7jQnyJIiF1YY\f_9||\h[F5)V%= Zo|.ZqcF#ڿ|n"+Aѕzuk[BR>Kew0wDp~+I%R+iii1վE}_)Ӑ ~`h&iz8!zS fm- lKTvf]B0wFY'ePfFφQ# Dnj+;aͰJ&X94aO13\LU3WAPVO}ȉJي!PJ-.8P)k3VV-YUhmkHA FLV+IGDre$d JܻXdש{&sG9Dr V֦t`@l`ʲÕ471vLoHjklzv6N#'hxg*' ,P#q0q^4A.6+e%ڄYWx~Muh%ms5A7tc,c*p,cyvxRIl)JEiܧԮg,DR KHAxݯҎ(ȷyx5wEn*zH:1̾x0foΪ[ӓx*F)M~ހꑺ88g`5Dc&<~mӂFH JXoϿ&kr ]lIhLl&u?o&2ɻ( AA4x>Bb",0Nع+0%ad7v0xudIoIСrxt_&]W]oo4B pq7b^sǴ5FEMM"|+'_^âEc_x2-xF4zJ2!FEWbGgNW}o;+}%tjd:#uq˦l 9c$<&~Siw}(hxw { 0do^FcxfGX'Uif]8YxdAfUzLs6fgqfE2q   Ӕ8raX|#]W5F^r%}^2}2TWUEK%}od}[(Gnv#[[,q lw~kmh8wSRSq6&8sDxYTQroI#U4&ToUUcL 'NLkFɸ_$n t!s!^hDHq.̨"'!H5Kc&#`2QQI~NbI'FpΤzd7xd?2:fo=Ҧӆ{cV!2vP|*@l$ۖ I/EȉfȁylU@}J5o_y&ha{fPjAaيwOE[5i5w1PMlAM9g$&B'g$#fɜxV GSIH 9lBەӱTa!Hb<p<(hȞavE_d\RIfZ Zyԅo&4ԸT !I#p7b3XJenYT6 c*px83wٞ9z5JMs`orV.= Wx1* k@}ٝf^NWQ/]jUϳIw)Z=6Henfi\D@Gl'==Y.tzM*KؘHf(yREGyFd֔ oƨX^)HPfI+Q3,Ɨ8h4h&?E9D%Jc!C5٠).HZOm(ڜhJGrԐYVj9`t4Iz7Id)InJuʬs`)FFڠKIU,J_5H7!յM1!*]$ih'b ɂHIiʙ wyڱy7OZx ;zZFE' ` jyǥJJQ_x)k, ? BKfªDI {J:I:njjA6Ș (][L٠ZgxՊXʶn97*6g5K[ Qy*l2˳j.:pK[~e_9oMf!08ʄ#ɯšJfKk4eQ EK:f{]~ Qۜ !V-PPeE" o>z;2Q &B{IT]IYyzKڣF^Lti)veۧg+]$U~e*OH Ui2~]aaQZڹ+$̸+~055?Hrڔ"zgZY"@3¿J)+K [kZ*)k[iE GjtbzܽgE<{b=̬$bd{fܤDiK8Ȅ.d5ˋ@!Fy [5^D&R\WFʒʿ;ysyy%LU9Jlj{[zV՟W$ؗ笖ܬ?f2\HG9[)lF e[rg噳ˮ5a+M ᔯԟNcdL_ycܮ`\]_`lp5J53vH-aQ1E |?[lڹ^T߅I,N<_?9=4lŽ4hYۮ*z~g&/umz@$.FS ]3rQ;?D#&ba_3fs|F"/L{/्@^ ?0ˀA=>]u3۾1vWͩoE:C.= ; ^hD9ʹhӘ  ͖;æ=\|o?4tT  J9ì+vʝ8L*%z"*$8`A&d PFb"BĎ-vɅ(M\Q&K9-ΊNA[z$ɢU1Ԭ;|,wm5yV- MoVq7NQW^`ʳzqY|цrjmB#èXG0`fr3{D3f2i*F8mie6^ &Eʷ8Y.s裐Q._Kӧ.l^楗41U!1v{jUVˀ0lG$[Dޡ(06Q;  "1H-נ!F%#s#^zE eh}~sP!B7i}762q@_+n%$LJm&fOfl!܊XFDV+WJX핲4SHq  yɓߵP]ԗ=Id̜#ā vVF3axw#iJ_|ZǼ3fLuwna(=qvi!,hЦ,Im|&:,x3>(ܹN!<6mtJ(A BNJՐr G!~nG0jX x> X<\B)DH%*Lc|d9 WFPO=gUԢ:ŇZ˛Z38@AzRNMm\ Щ2&M 5#' I[f/"l*VX!Z:@ԒZ%P4{ZO2k# Gx(pd¤f.X ֒9֨ڔjsΐنuL\肱:!5)n7Ee:Ӻu΢k 4ڠL'hRqSDN?--)R+/ąҏ"0gK~֔Tiq'+Bge3;\ˎP]qXAf7[-|1O6ajRf9&#X$ro4+gz0FD⹚4EJ/ V*ղAfo3$ d-k>2ml79pmS`!1fB|~4~_I,iJg z9x5S$Qj*ӹj]J|]m 6cIНWCu}954pAZL\"aT5sr79 O;JFUS&Q[Yp6#C`FzGR*o [i{!k3xuѐ XZz@9=ءC!9ڡ$1*8sQB8EB,;4b=-OqZ` 563c8wb*l):? ӑfdjq@Q?K/DDBdKLK pR)M˫X)Dsllt] |PNyX-J$iI- a4PZMbRHsF}|#JȜM9P#KS2 NKB ՠB&; ;G{ݝ쒹9uCT;*LL4@Pݹq|ZPӦqPuY)ڝEڍa]^;.e]F^fNZT by} =N$ȜEb$QCg3 ])]Ff{Ϭ 5g}&B|4KRbcy;P_>S0!]S%[[gCvd:]Tv!|,d H ,E!fnib.G.SnjUdYHff_ޤx3;_LQ $Хj6kgh {NmD:^+iYvuKr>ng,^yKm XVRUBg\7$gcTdKjTŝ؇v=&Vc7d>[%jDFܼ.N`N=F%]փyiNGz*n$HVUV垦HFl>Ug(&md\dKv,.ˮjan"oY4n^ho0V&ieMјkNpƐkNwWOngp$Ө Vg^hehRoEl[c6qЖ@Fhq"fԮn#bp'G$;yYKk^96nڎ[VġW`~2߽j{j1osnUo9k^UWT%&anq9oA/tBնfn v_-₴Dr% ' +(?t(f`BM 'pG{Nl uF o|0Xhv]9RXdw%Ȏ0^fV"on4wS_/_EOi֮NrJm[NNZeqjXw|Gsmn>jv8dA^vx[,UFsU2ۍsՈyCgJn6E'YuL%cqVg:Dr_Wlbkv~p羶ezX /pZzqOckY[cj]qb9ܼxPFxcdnRezdLjwOm/xno-ļ(Z.GH_ Yv@Ix$/NZRΤ`5s-/OFznFFYsSCV9{Cy ̰J,JJF*-y}gnoDf97R$5]`Qls }IGwuXwSoWrkRH/LHB*>t!EC #nj*Ш1bŒ6D1TY,_4(s&͑5!ּ0E_3'NCI"9ɦK}64)5ӞHbuծ+6 %d͂E[,ٟ,7-hܵf╫^oPNls.?G&^Q#pAR9sfǘ!loAσK|4ӭFZe\:pۺ7צ=nrB;q^'r(GHTuU#$q#KTȑK O:ДA(`"^* N)QR8^EcaHXjeG]AEsywbOh{d9>cl;([VlGfdF W*:Y׈3^ib]9%Gbs^n"tZ]EUe+՚TTLhMM&[YIB7CM9|ٞ ZLY՜x&隍:UY*^! K%:r&XOfe0EbW?Hh5ZkP4ewbnvk.S[˖tQTTzV8av"KWݦTa-`/ʸ[1CxS>$%je}XRn37&or ,mRV72y$*tEUH8eNVys.jk`h_֬uebY\H0%g*vgSK˵UiE,azgʓ#g/C7jv蟣2bݽe\ktc~jMcOtf;P՝k#6`._%}2ÜZxbB  4?{F,piAOZAD4d&\HeNemhf-M:pl׳9-ZzŰ0N g(9JP+dKoE&؈YD_':&|lT}2>ͱjoك8H޲h*g.NFGE=wLf gQxFxL'B2*WFH$,,mSmė6]a%(޲'y2H3 Gi1iFQ R˜To@F(h߄ !() h*^e)X2Lކ䥂`3&7o3'9is3\';w3'=i{3'?4(A jЃ"4 ](CЇB4(E+jыb4(G;я4")IKjғ4*])Kᙎn|i:Yәtڼ)6sS> MyӢӨ6PToT-P*T41T{SܴjWǪSiժZoSurWZV՜e+TzN~Sl\ {TuJ5ZqعB6Q},[)X{lf;{ԧ2UխTV+jTئUB]ۥjnڨ"h[ ;oޮUq]R}mdzVRڕb1[]φֺOZ6=m`5n7hp=%TϷl]p]!\R8UM s؍e< ec`ܢx*V[Yi~S5@*ru8&&iQu{Z6Yr[Ub95R//9b6)OZ19j^379r3lo!!,@    !$((..2A; \DhHiLiRjShSfR_OWNPNHOHHHHHHHHHHHHGHGHGHGHGJDP @Q;I 5>,054.39+-B&(M$%S$$T$$T$$T$$T$$T'$T3$TF$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG%TG,TG4TG=TGFTGGTGHTGHTGHTGHTFFPDDKCCHACG@CH?EKDGTDHTGHTGHTHHTIITHHTGHUGVUGfUGkUGiUKcUaRUiJUkGUmGUnGUmGUkDUkFUlGUlGUlGUlHUlHUuQUdUkUkUkUkUkUlUlUoUTTTTTTTTTTTTTTTTTL@8{2x/u0p7i6`>VFPMRFU@gqMklTklTklTklTklTklTklTllUllUllUlyUl~UlUl}WlxXls\bf\bcikkkkkiodilmp|쵴ϴ״׵تتتتتتتת֭Ѵ²׷״״'H*TÇ{FċfpDX~>J ɒ"aQĉ/Q~|ѢqNĉD?~8j1E+M"Rʌ,ٱІ MҊhRmRa*CXozTbH+NU޿ RQ0_#6xcŐ Ej˘3k̹g,Vp&i!I;PQ׮EgIp߽{ 5\ދ UͭV5y *'!b5w팂qgDjϞ{)z֟_ȟh`h~lj|g 1!'d5!EXmh'RJ1ۊ,xeNEQ|UVT3a^GP?:Wrn0V/hVIO2)[^%wTwY韂qD_*e`&fhTx᜗1N;x jRtZj^ZC#]oH"٢m+Mm!pF(~=LQOZtx&kWp$}[00G_Z@Qe%ݲ6{)무VKZ-]x.̉M;hCa|rd3 3rh㟓(ӿ1%%tccD:NF׾WIDH,e=Ypm\< tx5m/f,4<8+13hAEP}kX hINR}lKRIM O mUmPzz⊛3.9m"^N;ct 0M' U 9"Vd@ѐcI'Hb(5K0LfHcÏ5»~{a=s@ubP*lGfd}~뻩*[|o fh'1yw^~rHLC$!"_;\y&A=䣌*qڑo*4/OEgXzf{,Ag8[T퇈 }:D˃9\`PG77a]u0rjA䈰(JxHTF$/9OʉOi|&怗k8"8agE)Bnz p'8Ƶy;`Dq);*)*GLBpgpivG%guvd8ujc=!V]*(BMIq'z& &nIVx1xy{yH(`aVhyd6kòiZHsn  EiIL4+SR0ueبg@iZ :ckeOrD1z8(sjcevN\r-wtHyt\y#i,us ҂E<ߨ3VF2d|:SVG+U֣2'1 ki75+~jy#TQm$Ky>p^; `=MGRsJIJظmhzJy;1v9e4h庠3x#ɺLSX21Xr2QeXEBwQǞ*o) b.<+bN6+rAf5HNy`+O"ꙹ{y(?Q53Bs\BRr^r5J,.RQR:|kI\DnL챪* <B˄ۄ3K/9ٽOe%ǣ"=4T[l}(, jk:4*4d‹a.賧?ske/{ʳd1'4)i ۦ@ȇCeQ*Li~ @gY#ҩ٤h8Ie+ax!<glX[*3X, q}zafIo \Q<6D>Z|k\݌ [t9ZDEzz,srkh$;=̥{5B/>/dK $D*+N#T0"C[$Pj KkɊhuyʷW,zvaMT6lJ18| Z4 ,̘?A-B>AL5\O$5E(!5*OSfN4;Q3T#"k~D0ZtLKWZaojGPY}Mtk"8!!ǓZFe+bs;'@R ݢ8I [IA/;δRP1/pnԿ; Ըb>41RŞ9NlG8X2+%!yc31b%Q)3IǏx\ v|2`|4Ɣi/N|w~퍣 B,%3[`zQ]T~AȤS_La%B âT+(*%[8@g& vLۜtN̤$RQQjsP܇H؟G츁!:.Fu/U;Ȥ"29-Щ6]Cj\*H/R$ k۝R|]U/-1'/}ؖobFJaB;a\j><9VXdfq"LY0C >#{;@4&.C400BT" 50&'`IJn.R)^! bh. p%de 5"ǸSȥI{!)/eX 3lLF `)&lѦB% 0V',PÚ\$L(P:H, òCeI 3;Ы @:tvjfht,: 1*v>7ނUٺV[53l@1 ڒմe3 q15zcKI>L5o)Vz# 8Z彜-tRkkq-I):[<r BXdR@O8qpTbe.@u uHj}׌s,~;OIW+t|vdž19&!\Ӓ%5v2L zqΏo:4'?tH.&N:?<%=3g9zN;[ Pu{B`붌Kmk ޭ̑HOi'vQ'lg uYvNwų_UE /ක{'4=Xl#Lvȶ'Uz # 4T=*=a6~EPC(Y}S+YϬ"(`.MZb08\c*H2PPd6&1v(o 1W$cX:x-q V!ok lfB~9Q`xn,@qrlUb.4Ћ#lڞ &R%4*;D578`3ġh6bDfK!Rc.! CV㿜R` ,uŠDIXiVW: qv< !U68>ڑJ@;p}EvxAcy3+g<*-ccQ4%s$eUjljTCLB)errJy9%:CV{Zjaf'lQ,!KbN.mY+.9G[ KdMqfA*p*j` T 4! .V*B}YKRJF7V_>ǭoT%-;L#aP"hcCLCuEqK5լB*tk+_xSz/x+&vַ, ӹ mwO2ٖ6M>1ezT|Һ" g3"2As!q`kf#O L 1z[ۆ_X6Lx1:NJzT`6e Yv`TJmP4RXC:t_7\|sboc/{ˈ׌Pr*8^jWt D=PخwF;D25CܡCw]%@IQ=O-%Q;n83E#XTj[oPî5<iDVfpP.`߈+Wj}̦64}#\-я(̡*Ա?*^7s4vc8sktI3;,~@7ѐX!qei~9sLnʻ81 A.۸ `ڀ(X1 BS3)@`+9@ex\ s5Q H*:\HR&˝tpOtX 3h[xŋlӞ`%˚4*7A<Z%'S4T<F XbE{DA ;Q*Br$Y$|}@#9`6<P:xF q),b2З4 ( ɧ$S8[{"fK6 (**ȃ5bH? @I@ 3j>TpەjFoDԶ(@j?@' 4Ð iBurP00jq/r 88k(ʿ+ I|4ͱ1[xj I$ /6XK6KQT;;x7l¬8u4&GEl{.T{Q$/I<$#G@#UMNŽ6c4$ڕF( ́R͑+q$D;֛3h(ˡ TP<ϜN GiGC!Br2^iO{Ox$tB|hLPySɎ, (H;̔ޓ ֻ2:'Hi 2s1ox1?`,!(X2,Ee86څZX3h¡PTQ(;e =7Dy6S$G8k((7X\R(1c3 =laa*S$X <ިd P@3-3 3$yl7 U /GmV#ARu`ȫO9%Ӡlնca n4NGղz.5sRrSE,X2pA+;+p̰K$j=*4nY|9){ɊWds'$y2y32%0Uɿ~j0s` L @ҞU ݠs#Y8h&d IQPZ Ii /R6) .uRXU𲸇!8 Fj򈚔̜ſ>m\< @<]* =%ՒpdE.<`R I\T`rë́.@D͔jc=I0Yc`]#T,P  T$eLȌ6Kp LP2< pEXMaL,@z%P}eO(@ X˜@DjJTuJ'Ҙ7xX O̎0:D ٝ23+*-ʐB |ީx%ey@|7@F IHHZ!]lÉH a jv  %՛-p ^Ϋ$A+Ǜչ|J;%MLiovS@b+zYj-,8jbflzPjݶ/ /÷nmIVwewtoqqَ``)GY:QLuu7fsj9|@ &\WģͿP*r_j¬i9iji@*4aZPgRLpנ"wEˇ"\~=<#5_g1y7q*,dDG7N$cv0CɀN8SVCUI7-דn;wڤrlCժ)"lG E~ѤGX?իZb"QcI&jYĠCR5H4yԩRPKR)Kװ`NJ"Iɲ kI޻GT+K5F6-kj[e ^l6Zos,ƅ5\T3_*+Xj^73?p?4cie-{q7͍/Nw KGڕVW%mӺ:hϰػUYEk,w&nYD5w<ը\"RqG~4SQWJ`?!GQTE9U2TTgIݗ[PG7I7>cF?HQ=Et[ydPCՍPC\sePDA=!Vu_9Dl޴'S=&kVS}.qacFXT!ȡtl1X@יIgE5 bޭXvKqY*әR%e]̮=[j(#nS{'AVޕ\U",Bdus\ Vdn.eTy57ov6vRݘei7VzIlU/901uN*ච^PpuR2Q21eqswҙ JD2" KHJIѱUnCj}.SO>3Md5ڇeD=YF'ԿٵI1 yNeV##"4b{>if99' c杛E\ݳՙU[vt %;i`=%-W.2W6ɋ]E#KJoOC2Xp_#|J9[s\{wz|ET[ i@Ecd~NBOfFD$PFD3(Dm0 ϔ5" S(?HP9bR7[z!#-#t{cMN!=O;آ(k"}]'d•R\6M'n{c|Š 5׾An>C.QCZ:s&7יĪiL#LB x,d( ^W(|4%7\Y΀3.j-ej]>\֓2\:KF;߽rT0# #йP: b^u o`R ;J`>\Ehvۈi(Jtb{L}:#AnhAe}5MOB3lרdaJiЏ`9*:EŬӠѕZy[<{vYYψڗE)M KSj~=I6J3u}bBnH7kՉR!+-L>gUsi-49Y^~8A& s\iza:|i^R&bJLgPo#qyH el݅jPT[2Mqk!3_|v0E2IL4TtohR ohH36Ů3j#&NstI] dMb)LhE Yo\LLKSw\A̓u"F<MMǰ3ժ]X{I/GYDvr1PR8mԶB M!?q-ϸfxIHm] ۘ 8 ,U^lK  ]Kl-*䬊6pMD$ofmj Vx$_J&kd^S]2F~G0&NB% WSs6q9NdqE5o ׫R4^0BIFeEG2 E z '!6Jq*\t ɽ[ms\=e5)C&)VAfd& ;?R phf_eQ^o!tS^Gp6Gp2ǘ 6767 }p"9JTKXItppI=ӗЋiJV`J\ .U^k&ZY!Gn4ZIPPh,J_d場MTag,KV^,Tn\2!wCrP{P3-C"!2RiFJ)xӡ?IS.ޯ'6 f&Q^P8n0&rPs CBF 9,G(jIPSH;ϐ,I, H딊qjc8EOM ]e90J]" UQDh!`E%V2Y`k|ZȻĵJ{+GȆʺHGӂE)O\Z\:3ԒP+ tt 3/ "}`?wFnrÀW͑ 4f@ХHb]ʞlfJv] ZkjOyN.^8G1 ,:7GL6@ѓocܬeÖ8X͚䟣]b=fI7TlVbx\aǺ!x~uzs$I!=6Pe+mhO Q3UXSNj׫_;VlYgͦE6֘j { ;QG pވU=egL"in>YMٳ?+L$М=sVS׮U]զq3^o7û kpǍ L)WjȸbTjnF3ϏzM=TwΓHB }Sǚ+}8} ЪK2⪿˺*,P?52O".cQ/!FI"|&G N.I)=I1UJ9G1d,'Q HԾ3/Ukn Ft,m@ f]L%x 5׮mW7/k!U/S5i[g<# 2]+,{&(״],Y8 RyOR}ܮP*:!DKA-Fo|Q(E3Fɪ)g̑,s.bDM6&\0^Q#oY HJS4/Ind9Đf%N$JDt&˗ G#i}~"P7[Rr9+a:TkK+U ;:xEV#95ltz[cd@f۔xKڇKEx8lV)7dNyRdCWeI>ǎ$,z$_S֭=7ȆaAD.?_C-*D F?ċ<8i2W$? !YhR[z.I:#u4hDڦ%iap8TC2 "35M_Vp4𑎿}fy"eU 6"k48 PoeYԑו1yc\8.) gc`srQb!"2 RyfP̓&A]b5AeHˁVe-m[`L+׹̵Tʝr=<1 Q@ejBOa3Fi7mΉ} KKV09Ab 2'A Sq^bAe0V ƚ"0 5܆|\ yC(Q ,$LfmZfHcA)%-ĒmIY5e bJ8ѸH)uZ)ϙQk7*@s ;N0Ta]89!QڼGrB =T# #&Bs׸-kv)lhJ Vw<c!G7 Fv]-`(~r)f>M> @4ٗlv?| 6-Hf68j#pwH525eE }֗XBS[&]'q[PbX(K4!ӊ4PMd;=&Q} GsA ;-酫1jύa24^0ZK&1I\JuxlY'ļtD/RC&5fD4Ggp''M0 0{i~RkJtrT`9NuT I7U|yGfKP5"!x(ǚ}9›) J^]Dvn,L< j$EZozϲ|J2P`T*Hh4FDҰ%t$=Nm>pNd*A"" TbE$H$,‰.pHzE" IF:V^yfb&)?ԉ'DfBhΊ-g| mbPmVxĬ\QrJ.=+W\ 1 Mo#eYzCH1s<3]E:hFc?Y2x/.A/_|41n1jʎ#|6'9K$&2%P Bq$V汆ā45UXHo(b i*%$f|"`vss0#-ETs8#-8FVhoB1e\fi,lN*0H*O/(r1t=0>+ 8r[N"R#Rm!9~*rz(4.!4ڔRd!E0ňR/а,M{32;P' $xRT|dFZw5"# C&#>.@12U8&Bއ:%9TRU14CTC1rc.OO:=sQC?3T.T@pdL<)u4F@9JUL!g,!m:bR̊ z`BMfRO# NDY~KÑjG'!؀l%⤜[FK: FY$A[ێpqIADJ'-G8]L%ѠV6yhUb}#UG= tو1$Pu0Jʥl=o/'1a_+,[Va-uo[PiB LD1 ӂ8!Es|!P@Jв0ŷW4 hVƎ|P='\1Z"", oŤfEFPs d "Z,0k kckeB_շ^D7^հTw/W,Gw>cWGDSe1aRLrLZO.)hru/GG<?/eLfO "8 *-(\U":9l?H,>OV/HbP+bBUkv2qK3؎v$7IO"WG(#3\(l4鐥C&Bip@5" ?B!a*W|euLtWq%7T`(-kKx{9,j"@v"NB RNY&ZW85(nLxs$H0:*{x#R KR]9&a0S5,@,GI~bEN4}!W%^D X2°A$a1"1-gb #ZPQEvLBZ/bm$*߰"%ZSOpp>O`"pumϪ":-!sHb0@X%]vǪR>)WeJ%xɘx 7{q>v1. dG9}RCd\1N, WOߖkKΣ:LpB&HBfJ(IgAt"a ߃>0S"hvC*v+R9Zu- W#-, ,躬/;ڗ0K4hx$-:<'{/=ę?fRy/v}Q 6,{.=t26' rigdɗw!(_Ck(q@XN 6ڽs 1|0"s%Zx1#C*[EpRaœ[b|)qJ41VVPNj`AlҳDQ&CVO=s2*5*֩YrƩ֨PAڳ:u kܹoҽk7/޽zNzLƝq{Fݫc [P"58˱C)WK8cشϱ{W`CRKȮVM<&~:pѳG+v/(ຈ <қT>?nS|ځᴅS8ڵW3~yȠ* @}-a.H_b~TR8(H^(U?L4he!Sr{,n;==b&je/oI}Tz*"*7VW9IRhQ{~K&V#Vz头C}ETfLKӹr&xvj Z:I0zh0 v,4BTv2.BJp ,LS BR-+Сc75(L$qsBE[mGπ{:,XⱒapiJy:d\>q8k钣(<lȢ~ x{ >TŁy,&QkC}h}zXt(jQXʓ=&WзuG7K%l_D΋2$c3hIh2Mզ:(/A'cr8#9:WCIJ:H[iO W:[:8, t]c\¹-6zKn(fQnu']i%r $o.%HpafʕdԤpIE,̳(5fo&ziJ[q3 \U1rݵH?}DdHGՃa0 Fx4,!Hhg&r\b:ZQ6NDRe)vM&Vb6zC9tj''JiqZђteGe7|肔Vx.(牍if43y<_$88 "}<"Nye[|8_S%hU{%R$GQ cUWuV[-bGvGɵrfj%a {(iA\qKy_ M(w#UyX]#<7%4v>Ȋ?AA! -D;& ȁ'r1bDGxQ#VQi95хlWnux} y33T۴43ZM?ԐBS)1ֆihfXǵi"0GGI2Ih677dT5QM>#SyH RNd7ggsjf'lW8xgI|p9^m݉cw:@|l؄}DGDYUB)U_g11Xw(T(i(yP.c M+tR$G\Hk= Kw,o (o?T<{5[hh<.yե^ IiGyj0=Jd%S&([Gx<$:p8X j4)g)IZoY |Xd8ZZmE}0֟ Հ8#EBgtbq*WMPcyk AJzzionTwf $YR!XV"jeV"H3GKY/PSGg#wF2ry>"wʪ7sU~5Jsx*v~*VBǘA++S+zlɞcvj~)8zmZ:fDt:'9w9f.(yz'*Fo zء^'3#ۇ#*:9^FX9c5ȱؤ-qӅ~w։tgih&Vs^}]_ERIטb3X*{`+_)tЈTXF:26fi:z+zf+鷒c6)h'.rKu iTU.E iM3}ay"x٫7)zMsf-RxcY| t۹u#9&mA{W WA+~܂B#_v+eeT gzj3xW*tɊR[oJ7kx۷Kw I汥[ k%S@VD:4T`?_W[]aioسƱJJp2IȬ;o;5O -Q;Z~@HܪmG&,VJ )'Q:ɨCٷXhŷ:|ß:Hf,8ܑu:-W,؜K{$ ҕLDll֪ȏ\jArG]bܸ a#bvv(|i)35y둂q<# xw|-ʷn|`nl K̾Q(ʼ|*|~ϩwHuZ|שeoF{ܜroܑh/ő-J4gfZq'}ҋ ˝3a8Lkv(KPiS,[}ϓLZ }Ͷ[ ڼ 0YL;̞ܰ~e'{RK l2l۷xz8=J,xLwk䌝a͙'廽($ɩX:0Bd:m|gmC} |)[Yz%y+)-x ֆXBN P)c}՗M),C>^bMN~Զ|>վu,,S{=}):"M>asx=Ӗ;&\=Qhݹ<{lVuB$D* tV巾Rm4LʎںXt񝹾|eBp*m傾r%--3̫T|bw/ьzRH@jgQO, Kv!z'_1™Tga~oϴw'.mdU&6ut] QSA*.T  NTCbE5fq#Ņ#:DcG5 S8K a9 ̚$P8ZT 5)&PAC! J+~kEXtE_q,ƻpT)DbR+V,"ЭI*G#q& mcmKՔPB &nJ6lSʧ~KӫJ[JOC@nHRP^ʏF|OK,zA6HIRL43PP@0I9 :<Շj$͜ .rWy##n,,ҨbpE2ZEy-Zg5 [&=ҝsk<2`+Y͗\N(S%SA"5[݉nKo*9ZB3c|Kb la?VyOC@iV2vK!RVbٜv \أFXnf6W缌_yhqNjܺ\ijsMWX~6Jjkp;LOlec·J/4rE)ZҘCII4@9ü:}v6ԃ4ͭ(CD?r +ZUzk\䯚jhpZsaMFzƵ;Vclw{zLTƟg[jLw# 4t #.]T0% ؝^ Թ 5gaw( ~0d 8x{zBزlea4(!(ʸGD3SJnF54e!dl)`h`ѳ7E k\,@P<,/[쌮xh,%%p[Ux׸#5I}w['q{xMMQnz!ʄ5o!60*:t2\Bpt PAK~o `_(u,IBpa(O0GBO0$=z8TdvQiֵ0FG5 JۉV4/jQlי0. ip2ޤ(Nǰ&!IBzkq@ޣ,BDp~ψ B֯~#Ct%MDkT$QG2*dy ԗ9FP<Y&rkIITa)Y8_BKK:d Ǚ'Y?2>kkťHZ zOȭܲ6e@ٹ+ۗCQy- d+Ȩ5l.6ek'?9]r mC+"ѸƮve!j0̋ ly[v"mnWoF9U2&?fNt(VlDҭ4$oyqmDMr9fPnz70Meh[pEwJC'Ѕ3¢uC>eaXi*N8~YgeqW&ܜ?1ٲै;*reXWA7iyQ`3efR~Btn۪UX$̕Tpe1JTV=k͙txtp`0Bla-mdOC4XbPd&s.v# Wzc"Hi'M?VEuYpȌNvMm4y4xj? וυx mpol"/|ͽ_4?)nXl E/5-u,ik%ޣ ޗLh$xpyRX|-aV{{G-"-UVc۪ਹl ctUb}λݨ%T&zK_&Pit/݆O?~u2`9kE-v둫Z[Сܕ *g^0~XYi8bP-N ۞IÃɩHVW%fiߠvS@P3ܞW3/fuT],ޘȽΛ9wuߦ}}n>sYV;gD,"LyVvZ8g{h,~i$"C_;)rJ?P Ѻ9 :áaoA:,2$,c3Kt:.-;)3:S7;+J>;ӳjz"Sz00B05ڜK '[3<1|;'d +j19/pHB Co$!I.DH_ . Ħq2$-*ܟc"A=LlL<57A;Mj{vSx >Cyz2 C#(ep5?)+4F`,#56;|H?>B6iLD<7 IZY:-Wc>(ٖ!Mb)k-f?[ TL*+cAHH\ȋ*PWnDsER+59"%[/ Q`E^8S$yh41,k;5,ብFB!+ƈ<‰@ i"DYBī  D 3C$˥I< >@Q`|Kӻ=23Ior7$T{>/YiFiB4y\k˕|30k?+,MbD͖X EiơӴ#X0'iF9>&5 "(Pe(a!1LƫZ4ӡ2\<$L4sGlWԘ0+B#ui!ް (,̿"Mk<`ӻ.HȽ F,d‘-J3TD݁a9Qmэq=? $JpָC@F3.Kg{JM=osR*#2 N ̲l3--d3i[=*=ڐ;:<P?*ͤil 3Z*hPJMd #e, IFb,# FEƽ8MFƃ IM̑ ^p&vO &C  3$GZ@;$οC) l,]:4t ]U^*=ȎUKLW|}%e:k5/)M=.uڵ9Nrbxس[{Zbϣ*\rbGft>gu Wkg}{('V%-gbW`--FhW%5F\\u~Nx拖g `]QGKIXdݔRjk˛@EdӐdFf/GF_V٧;yg~YLW1nZnNz ,XVW5Wjgf}tkag܁nbn"|4${ĭ [sUa1A գBD[o!,ftfuN< k vhB] "P펎lvzIF`}Bn0 {%f$]xXiՉnnfiװcޒNjR%Fjh=ÚX3vd˹HE>aφc6_#%jhL{jg 䉎ڧNcޜkְbDVVWF.e_~ k_5e3F\UVim#alqUK0(L^ho&φ".munhS6{m,OZݠ?.m FW'wioW^o>+ ;(>oG=ڵeR \ndI/8sYHog=7p95pQm.M uMr p)~eSYkR_sj`5kb?N܃5r>q5CNp8QY|V!?ro?v,mPpA c yNL畯twiyvyԢe9JY #Mw/ V~P{~.Z?TmWcOLznϮhhwJ  5UIPaB5 6|(1"E!^"Ǝ=r(2$ɍ&AQ B,tR CBޤSN }l(P UGiҦK>ep)զBbeuV|TlW\5,۱k݆e7m׳m 'թN ,upG 7qCƂy4(О%'E٨fʞ-,rʒ [BD:5kԐD);6Nt-/Gތo/n .P nۦkln賟>];޹o^̈́Lou ש> #?aV_Tt`yeXVe \Bg'ǟ{gX{!"b{9'Yh3G#7Y#v%x;BdQBJ2pN>&dO#} A%\~DL ٚO7֦EE_gv1v'qxgUs٧Z6\ %u7nhi}*g\g&hdsQnp)dQY{lP]'oN4E8@,Wb9Rڐ'ХrcVq6 -^x -ꎻxY./Nv|b>L1#rȯ`%a.Hp FͶg\oJ;߾!ޢ>Dc.2 %KC2 Arz?;#IpVAN#/CWrp I 8l.=4Or-T0/u-m_@*zQ2 ak i>C51oVW(0< c#.0",)mE:Y1ts!X́X;2+CFD 9-CvZUvڥsKMt:COc}4=5/R#Mj ؼXe -KP|cRSX\<3LOB3 4UPk*D[hv& aVFpY&΋7&~N 6g$xLLh$2& [-{d"%qc94@XJV҃XVYR\jX2Іͧ;@LQ6 (47ʅ*a,U C2yأ^- D< s I53f RSͬ[1;*8pxo/\-wQ.u[:u򁋽 ^c}Mt],zvO֩#>ɻ|G~:NsKgJ磾r>腟WcN{kq?>=)z?O7{W^o.\ w=zڏ_ .w_=nG]Fj)bpr 4Y0qZl{Fj(6g%E=݋GS@#w_Ak G\|Yy'+VWڵbKZMvHy5&۪tɦXX*`y9h\( 0^ghnDbS9#eݧbHRK+M!Qs$pdWD;ZW]\VWaypUHb5 WC5Gx]^ں3?Ia8C3TRL, :pºDP h^ ֗T~MMMܫ-٠ -Q;QC`5vgkxG}wB[Ҕ*W-˚9! 3h qR=( ^џzho=fMz(/J,/{YOAϋ$VVIQEL%q|^+ī|f`>\hn9x:&QlQB  I qJ͠:HPZ ]mQYp%-b@&)S˃ZZ5ްd9;U~X֨m@g{Xsq) |r-y_8H/gsaF eEz.82-U-s"D}@1J%g;#F1O#*iAP@DQXnHD^yjNBQLMk ?2u$#;V$. #^DJ*lpH*HMdUKDz)떍l!q|hB bXZd@Bf; rQsDQ#՚9uLe" _A#fRgVe-'ZeLtO)ݴ7(DeKi:hM6sa\X-{9} T:?oP23Qia!'m*A1O̡sȩNwS=1ϙj'HX|&"TmJMcJRaqm@-() jʖݫ" Xu mgy(.߇mUvkR^ˆ!J@HFVijZqi(iҕopS4lg/G9*yFG =g ekPK5Qu>.ԢG"E_Y6K^|%4[C;JW$DJ8-? R&)N +!'&F (k|^,Ƙvd!M%hSn^JOQNj.u# =MzaF螡HU@+3*Ⱦ !u'@ VZ*X@Z@T=jJg8US]Hr|~l1QÃav^MVpSYL6hMhq9u$ ,28wZ!J|lv,VpW%lxxܨU TJ^k酱kT$wV+ׂ7 lWz?!abQU$UC XVC$gĒ#HV,D$Јe3Q3doݔiևoOzhV͒+Za 2%Gi1RR^5qFf:Ie ?ҝ9|!4t:@$J(vl B#6u%Z?;MHHG9$NH$eH AI.%!i^Axsx'˗]iP^:T8vYx|JVw2rHmyz:<" , Zef1op 0384%=YXodiCXHpIo\yȞS:ڞ y UeZ~('Թ9CuBF(`Xb1jp=/C-JahqjD*!'ZRB=HKB(H 61S"-DT>a~TSȆ$PʤD1G >!˥K; 4ן${a u!8#K$7ow%$ܵ59F$5yf(46iV!,026]48%2,H%d[A.'rrCYg\*BúwMPJdOKQC!D,:UtE(ȁOk&q2p,={mE1[ps:K/&hNd0u #U!P1%!o4DVIhAnԛP|;G)+?t3#zʴ#pBLP d*$CPLco K5 21q*cu(~Z9Z0|,*,\3N}PQX]1 [$;TfFP܃"Te=aC$y c4󿥫yM:̂6#m~yl*L,a H(:ePNf)1#Z"ǶمoLXfdqŵ; z0tyBnݒTNmk4̙zNӅʣ 1s=Ѣ<SzMLPC>&:M0{4s'g`NFfaCМVd=w4Z."oأo> h$49Ėr ^/QS8YJP,=AӖ|ViR28,TWGJ|ouB|[ϕ+:mHVMDWKz&;UٴRa_" ^_ȹeP0z$ ; 媑 3+_Ah?[RhK#!WGR#<_Sa睡]7)uXy@iձ\٪#'T̡r,5Dx(̆, ~XEXcm>Dv,^vo Lh@'uH#~ XLKU7uF v^%Jo"Hs5A*#;ZY]n> Í}=:/-y^ZSwʱ`^`\z6F1rywwzbB/PqC2Z,Xu̬k3EZ69~cb#rZWQqJAB$-0/GQ}#:1HLQQ/WkDќ(P'j~lj#V?<xY,;CwH\W^L~\/kG!Ү T,1C3!AC]~!*?1hQJ (=A 2B 8aCXqQË+v0#Ċ)>"Hz\lՠ5i.=i)-[Bmє)LbqdC AUV]~ Vlنliꃸu Sg``ɲjVےMKznx\ʌPWgZu*5Y`=R0*P@ ١[ PF-X귥FhڰYUME"&FmvxR|V{>g+[rw-Pfro ~оM;o7AXZO*!+FFCFH/a&Ҩ$"#2Ppzk+mQB BPl j BJ(C*Ӄ 6TOF #="Etӣ`T m*K&uv3Q%D$4J\GCH*2( ,H-8DA+4$s - !.B#4( K$%Z5^j 8h0.ͥBleO`8Ǭ2)[JK94klUqOZJ^lAܝ[*[9\ ɬ ;Hר. FsMI&Ζy1&QB* ( u(Hd?)SG0&TuxpA4 #E\//xX҂ʺ4–&HGْS+\jwsh 22: m5jUQ"A۠X}|W"fi(g [qx `y$|5.hA ޘ:tPqQA&TAd1^yY{!&cdtF'V5ͳj^Ow)JV1B߯#{K.\3ٸvx^G{{tl_2DNhDA'"2he#J|qZ壉DoOB#Б&;c'¦n)ETG}X$qkDZk@ 3V7,B PuҒ ,^ 7ΐ<<onDgdWJO-Bk/zTrcYٝq!o8C} uޡS{X7ƍf4uKMBͩXcïtTZ*BX.dV]B^z} `qxeBL l9ef syPGh)LVHߋ bXeY`8M= e._AEntg6ɍ3' (-#K)ն&;>4zek2}# ^i'b3Č{t٧z].A2 d^tW.e(  +Ův`Y~ae﫟. `ԍ>'tҝa ;"ݗ}CFޛл% LZL2ց7ܢ%NT¢3XqX7 B.AnN ag\kg7('P'+ҊыXTFE J 24 m c:1w~4NhPb淾Ev(ґFou/Z;aiK0%Q-@-)0 .6Q)˨ 2`^b.`ZC8`jf3:+RȲbjH*H OH) ›7')—:JRxAHH ۋTI ҕx0U; *:l l!* dm * 8]B**y áL!*c@k% ˾6ILCnDN|EO$j;09 zt`붧0TFKPߐG=1c?m̛ 7Vp[T+O9&pR9@4 )G8s;ta=6 Ng,/hLD;3SQX3%S gVX2l.DHcŶ 3=8}ĐKL~kN `89[0(ƨHK2*UC= xzB+ pc|S`ŴȸSo0x@n r6H <X nؖz!z*3ߘ@`.OBOps j-7 ]7s׹뎹jفj50n35 INї_yJNIS9WUѯz3yX̓V$\p0k 1ˈƳ| ztiG&]~afjf@7lˁf+1&Y(`e$O/[.LǥG~\ AM5q%RT(q&UU"ig FHUFϩTw hAGH2RJ\DqZ DEwYBnEp5FD Yg4$$V61OQUTQ9ʔ>Rv1Xy4D?sQV&Y1RF5Л>#n#Jq9R$=0{]HB NAk%eF}FTi)%X妕LzWXQa)nVfфKRz0bA)Պr%J`j]V[JE(ei-B+PcEVg.H54֐QA,ӈ:V}Y.X4pLv,IJ+DΗ| dJ4| Ц\6اFQUv{Ze" ĒZw5_Ӂ2݈ \"XXdV+sR@0t|7NK9 ͍֬Bu\I|l+Ǽ7W\wh"|b>Fix_MtJuJjE{s/a&lY+*jALYc;VΘ)S-"Kk_DAjqQM(ihiQfrDYs'F9W:SI=;~qT Xߛ&|![6N5peC&`Q,Hd$Li3yه n$!PJQU !.lX6Rd-_w$T@X qT{Gn$6yk;PfKCIvC6fmi+<3m?~]:*B,l}ԉtIg x:oZ˔&_CX?YYnUAꟂs6͎J225)BTLϔu YӍqՓ`4CP|ĺۮLh"a2u %k)EnV+ hpƢ,Zsy]"r"zz2a7ƊEhD39'[ 's*=WH=7YvMuۥGXJ !ܤ$Ԩ.)*Q=͚@P#\FfL3EvYdB/W +d|֝]M aL<2 8r#YދG0'|p["pܲa:cLjV0V o;^(<@ q='0S4FW9 &`<*H՗qU >~?}M_i'fG4D"\h]KgH%DE(X0DHCt߬w>x1c^ϸX١IPt0żPŔ_B\|_~{#֕mk8BIW^5їA0Ɔ4iH^)RP"bOFr 8ZT]ɅqP:ZsPÔ>gTje kaO2YaB4Vl0&F8]&ɚ,QmKhRH[8ƔlŁ/סcE Y׹v%ޥ?Ղb? llbdx9^0dU(S8¼:V*둍z1ѢHR- 7fu/g氰LΙx6D[-G]@X.R0g`o(J.pa6SjbZJz>e.~[S1^0~`˃2-F Y2a ƾFfV/l82j`q1Җ2Ed`i,m^c[,E ++$sqhњ r=*U[,knq(]xP}E ݵzf-pu[REpƤ`K+VH\<Vs] [-ԛ4,$Th 4H=e3飃$"44Bnxy4^VNq4Y/5q0C0<2\ƽ.Rwzk7a2M89cu J4k_`7};@-R#p$GB)e\u;7eY䞁vUZoxp }i+K1s>m%g"nzM$ 6u)J`GdoD^BHHZ]3 ݌]j3 HՔsܧx3jQ+hl,DtAg!ȰlS-yl5xud 6:TOipĮ7y؜ &}/aB٫Tw?575z#'zƴ `FJ!OoK$p#( (G.cxW5:i+ -Q¦mND`55w5]oEL_؊{j/@I @a)DЖ [ȱ4‘@L$ FL*Ȣ l ;-FPm>d"<TH>@ ( JR*Z ArJM~/p39}r򠿈bNz *%(/(˽EB,Z+ՂRT8t;R =  /sD&FẕTS LmK La aZPK@#Lm>&CZ5GH%]%lA}6S2-y߫)zɪ|M/GOi$/F f}ap#KR@)D(B< STѢSW0!nIOF^ T8hy`!66w10Jx@rdeѥ"HTTSΊͳ͞ŭ*Q4,@+{*Pi.-tDYڪV'IfL2r1kyX-vj5#x2 @]7f2,sGZΔCUA [XՖ,B;:;z 4 iٳ"gb LcLTDo,e<43ɚt/q!&NT(`IԳ DYRXe>Tbxc:Z5!W`DB s@g$b3IH׫=d]$ǡx7E+Pib%-.G⍃ (sYQJcկ$IPb0:<#t2XW3U/#zKٔF.VIZu0Ko9\)EB1zBP=IKQ!5EEUv+<~YL}ۏe-&wg72Yu6]Iۦa(W0DNrƏLg\(ؾ 3Ћh 6G]&4+OR+B*ɡ& BFQx6:E{Z(IO*h.半k}ur4 vlTj np/ۨ6Ba %((70Kw؎BaSS<Хr*ͯn5.\e-3ddRZka&H,VT)KivgY|V[bA[hxWl>]v@&KΎ@{ы4&tR2sץF -s{ U+RNጸƴwJRV]&BzK^/v&&U@&Pfn^\P ߳$ǥU+tjv9H-Ҷ1'tF2f4f\k҈&=1J@P`8B7 FGq۪*] ܦa7V\ ;8N JRRAA9tT9ex[e7ZC֘.0 ,3!ٍEߗ͉i4|T< D#FKVC&rO4&tt1]7j<\= ^qR]XbFPU~7) æ&zY'.i~8ԇ^(!oJZSb6j GaW!-\y-jgChL-rŐ8VEW4?%ixeԡrj.n/i'g }&Ij<{C^d2F)FrPp;6f9sġ}f6%̄pN`ԧ~؂&C\ K Ze H Pfa"vd GP- L&8FJJ@(V ΤSlod҆I" uq2/Zld M.%,$8 uΘ?NǬ Q)CH&s #!fg+B_"./l@ *@IsPU=jm$6J39+>oM~9A`-rΐ.t)J6'MMPIFqJP5O-ª.oy/h ROr ݆-A;@SD6W^NH?[.tgbLV.A8,B!PaZÔb>2n.8-Xicp>qD{+%?KhV-dAvG5/BFDq#BH5(:gǃ !7R LLl,#RKe `yMSl[N5R( |1tMvca#W56-xH Xu'(.͹BX›(Q>^"NAy-jFu@MCouz]B̗,`0sk9-!+(!N"QTX/5aՐf Dv$m}6nZZ[BEfԭ@5bz79 Ii'ܣoi9s5)Sư`M wsuX$&_bF"T:ew.x45v9bvXc;MRr:MdC/L6L5dxs6]~NU87k'y%g"hb)`#ha@54O3wKZ2LX}$dXRm!Nm]2[6hh$m*sGw4Gpά.L̕A>p7/1^R$K-Lq˔IQr+a)w,"q?Spv"0PeU"48Xh7r.4fn-xgw 15  m,N_x#rT" @У>Yz9z7Sm7Wnj&С1z]P}@Z?O@8(2̳3 Oٶ+rEI}b¸$F@pA,٤+n(¼ [@ Z#ov"Q"t[ VtV-ZA :%L9ylsu=Y׺"Ϯ 0N ]Nd}Еwsg/<~b]q*R. bmnD $!VE.Lc`^[ jN.ioaBVe`Gewm"P7xЄ(¹+*<<+QtH˓uv[0Pa)00wP.Ҵ_r%5+u5n–h؁ƒGnE8<@גpg=rNy3¸bQ|h{1d&#IGd -K-ƍܶ϶DG:Rqh}#fzƒ^=i+R4uYKqb$vMAM]A'smݡnnvo2MNH2m9+v$'cbG%ObN| <0A\ 7%'Z:u<zU۞;t;ʿIܝĝDR&Vv1 Mrby޼ ? &38A!%"xt!(>9.m{]$NGdWRꏺ:No%onWҦc]uAsҮGx}#fs/&_G6V)8#BjbvgиحU_}q{m"/dC/w[əT"!B 4 Pz*&@XQO3n1$ȍ;n<%ȑ)S| ѠA#~|yҤˏ"{XāZ:HZ?i:m )ui mv Ԋ|ҹv-u *`:Ha7tްӊp=JtJ' frǢo3"p8D?CȚC8dcAD)4-uOBԓb,@05aLeFYh<'Xɷa%`gQ^۱1P0N^n qm]QcY]Y+>UTZ*%KRDWP14dW 0jʢQ+*^KF bXu5Ոbu8\)y$f}l>l_C}=_)} hʗbZuݵ k .u%F,o k.+Y0Kj440fqQ@qd[Hq0U|1kVL&呟}'%g[:i0(~^]0BiT!`k h` r T-Ma1ZQO](E B"Gʖ5Um(g+V,g$ Vi_rݖQ:*̷~ ]j[Ag^$*&l>mEmaz|M][;`EO~23;V(nb+Yk3L$-Vul0ÀPY$:风*k{J ĝYsę2ڼ#z LL)JQ,L) t\1 KtA2OWBe"+Jf$!S1_b9oph`Axh ڀ#[~%LXbD++bYXJ9y/H+X7HzЗ`5MAz/;t\pS{Y)D!2T3z-΁C#hD4%rBBxi# {:uR+%jRƄL#JEj̋&# (]:ZoA 8z`@B.(58ipDM>B%D"*! -HZ#xN|r`p'? T"îG\RG7m΍z棔Fu Gb"څtEܑ\]ZHĵ*&9 !+/a)f!.#'=yäpGe*S;fGteēJAHH:dm0bjԬ$ P(_K >fA UuNԦ3!!H%oqiQtJg>#()ɮnco<ۢ2V#}J=U6Q7 A[!<1qF{,Zo wZHv,KⷮeQn=̅VUЛdh R&䙓_S_+H%wI8D[o`J`+S{m1P|f~U>c 6Ae({*b0MfлD򛩝hbԊ2јkI rs ѥb4"aBÄ]&y5 +)t6/2Vխ<6NbϼT["˼ pbV;=Q\SE"ȴ 8VV2v@eȒH4AlX#P+\&CؘHר69|*u3(LTG)$k(%Ȋ7C3`}.u_L-|+hWh@-xMl$d21jLah_{j~^vR"9eL/[4!etۤ|4cR:A,OGXU5U&Eib d+9øM}^''Vnܰ"I0 ss%|DZmNiaSlbcm7=0K`!Nxg\UBx@ \!BO+tT楘邧G$fR<ʣUJ6|;r<"yݫCG3uGm22k* %n.-6m$mlN AsTX|vJbSWͧ~&6v(CTw5 5,!c_#awHVdEq64AOJFT#t~-As6g_i{^w!8hdwXx`tc,bxf1F!H'l@sP,pI0aB Wz҂5/$Wb ^ #{}grnCw|GNC|ixigeF"O!3W@W_.xwE/N>ųqG}Xa@ `{,nLaK54Uc"ZwV*uJ# CnHwX#9}8qn1xn4sx_Qc$[eQ3G>Po-"b5yH)N3g2z*ZB1ұoHhW]X*ђ,^>X2rS5$tsK(e~$w6^\y/%58{d8' z@8V~$aؐն$b(`yoI?׈EV'aTiSF]ip|Sf7e #o.&B::AR!MIz/ )'ICYqfU駛f5aJ{p楳)D/*/FA- ہq º.ə;yADHeӢ4:H8F YE{g6|lGu>h^^EjܔNUA< S7 >wsO4!y),¦/jeehW xeZU?DEܵJ 'Fy },bPcܙ5Cȱkf1Mk?x:qi{r Fl)0yk'tPgڃmZXS[n:VAc<:DLz$Ճkۧ5urXadX Uk'+X*~h!H|9Tɒ/ё1a!h9/oפY8"<;/$aSXyY}#BaThUd^fۭyT#:iu`늮Vf_;;#)t -EA?\SDžYjaJX":U i#mEK;-gB%C X8ę'8J)S0#XNsIjYk9LŃNiiZV[6TY!#h?U|@,V{ˑiHHܼ%#]$׃XdZ̫5[}}ݿlejQOtt=\Η&N-8^SYVl/YTוݕO,Ԩj5Rh}+eypz\$2Trjsu2}3y4ìIu>9\L9N 6]rGMI}YۉcbM*LMW]jMLȊ,Fxu&YB$؀-í!tD<׶lQCeǑL켈جli<̛ % A!$y ћO> Y\ eVR QЭmU+#*( lk\mZ(7ܳuμc"UH=A9>5Ԏwn۽l>~ {@- ȏ:5ŸTo|ޒ y볞^>$BY$Py>e.nx?4=8f]6-4VY,UlB.L2t("ødc Ɯٽʾ]:芭CKDD# ;I5ɮaKP=.վ,^Qî ͽ&B-*eLԐN5+uMy@o@ԏ܈Eޠ'%KL..93灒JЉ BN ܱC)]Ȉ\Yn>qě\$ڶ&ՅNR1N5NTOyv?G x׌>q}#S3׉`/gH$x*NM+_?t4_J<zD .<@ D "2hƈJB$" DIʆ S4I%H9=n< Ɵ>{'BCydԩP J]H3k֜ѫѮ`oĨl`NeQgAwb$MrЩ߈u\aÉ/VLbRi8pդmj3E\rŝQ>ݚ5jΞcVmY[N['?>QLC6ABM]=uP?|!vG_8TWيUuW9._>UvRܺ~S.wJn+c(v.4k? qB.\-22Ͷj5ZdJpӏ4mªF"3HsG $p;$7%ziRU^oE۪j#:_%1XH \2Kc0wmylr͚x́o755΢D˭$t? TO\EOk]=S`_~\gȩR5pbdNp'\,{u*6\bCZf->+*+zȧNt}۶S^VFo(q[Q. v}`뿽Nss^tjyIwlSlq{%ÙLq!gHB ucKe$y5d:$^wI$DG}zKҼwe5: PVm2z.y+^z[V%jKZ-(m_\_.n2SE(%,N2qCJ:@KExA`1)dYG~[6sψJb;Y9GAL%*@Y3ٮu{NщKZ`)\[s> !@DL>Hfi-N!KKZZq,>ʥy%]vE+O;Eg(kf)'; q#Je%أ%d[S!9Yp^;xRFԃDŽ8dR2ZXv12z9fM- YW3cL!;ZCuPhQ0keЇm~AK W]+@DL^9eJ׼HebP!vmE$1l,>R %ȳF0ٱH$dv;Xӊ|nt•AAҊRInᓵ<%LVDMt֙R<[ Fܣf7ZT/`7%4z+%< :(^= ,ltV%}chTNMêNbQS*amE̴--%`lD2AVn510MЩTv8XJ (|9Feh b2-,*y;d,gHe{UA WnSyWYmxgB_kXJ{˰ӱG [FkȮ'iyFi)}_B'ӝ Kx˙ffު/1q Lb#*z|^,\s{nmDꪊ4:.SzUGvM\"ʰŎGvs=FEi6* 8I#3#-q1Y3ʀ=d(ġH=X |B`G)hblǀLH+qc213[ :+i {cZ"HCBpy+BI+4K H"3Ds+ ça iJ<<C 8AHK1HxGrTc 5Qj{6W9&L Od,QF\=/˻L\%RەR2V<\kV듳1ˢʢȨHlA[h` a˰()iR;LƚT$aϐ`Fٜ$!kJҙ Ѡ:몮d`/=q0Ӧ2MYDIs&;΀[.d?cԠMʹzQ  !пԍ+5"$"e jP* 1i'D9 [: 6b dOLVqH bUh=N䛿p,2ɔIPpuJnu ,% ֍P'Bw*B IQuL*Jt+=Tqm)U@?$|PV-NIDx5uz *%W=IaQ=^ C0TPQOmߨ$RUYILOq$핒ŗVm^m-S >rY o ZJE'!͉h3WfL9ۙAٰcc W2"A+]5]9ȓKӠS!VE o5ڽύV8M4q| eՇ\ ^XPIsƽFvM`.܀<:ͽ.m:i^&ݧJ?5X0$JV S*I+D=ʪ"Bǚ[ *5ӄabJbaa\k!} KP,OIUhs㪐Rbdb֨` `_f`nL5VO.\՘XZ[CclRFy}N@yMEDZ66uPd^guaO[zfUڟ36qO1.lMS, t\R^P5)fd67j wI@xi‚ӕFu;BF;Dd^I@} QD[KޅuM^d^"=c݌!Pܱ) `Hebed>pdޝ_fff`h\Z!ً(ZU[s=  U~jD e?>X׎NaM\zUX}vLj֟TmՙJ&ȅ4^~1M2ahm)Lh^-$s%)LvϠh>iu]A#Hi>{bT.k_J^^\Ƌ6@Kֶ¬ 5=s@ڂRN>޳b.kpwkq-y*Ts >ϣfa6lZ) BmVTBΦm,kVn*~v.g(ҞqP)WrFn)r@0HhX)F^sR^\bubܶ~nMe!5eac6mg-j oY/7[4Wvomv;CjpOBuf){s\a޽">dsON sq^/qVUWWsNgxF(Ͷo͕'iwv@ͶmGZ\ppOvsgggkv)Svڮr=nれTټM7_VVn7łW{ogz^n'](PnFN鲆tm0xi!Q 3yH#Yo[pRWjc.wp_Pr&<ݮqG\@/ozzq^'GoZ 4WUn=r\w{aшmugwN~hwwX \d@}{V/mDocEo_>槁ØKGJw rJ$!H{'[Wvз~'y rj.k8ki dl/j+2ےRo2'.$v*fuW헦Z%m`vb6~V׮Ǭڣ}x2Y㦋.[W""q*$8h8RYbR=Ȱݪk#{'kq2.zsc>7Α,J\y)AKIfSG ̃tmrWGYs.)jh&S[(B :Ok&ZOswrqj~A"8+%zM6 Y潒k_e6n\p"AwjC( º &3rM :`^.svn2in}=vXQn*4ɟߢV1ʝGfzSHr.U Scaru /if &q;Y)1 'hJc>#o'4P] 'qv#" A%㠨r0$^ND]|k 帠r&1ZM'|%/8m,񔮭-CK񝏗x"1&"!bn( B;=S$bkURfR΀$g)|&MGZ.]hVGJ}9ô9a"Co>eEԤ]I+Qm0+UR$OJԐۤ8P6Qn"R TS{w-jQa&A Vstƛ0Όh$_cZŜSS FsZYe`wKex^ 3ke&C̸Jȓa-=3O@W6cb[7dIJa vd!m=ov>y7 d?F\8[FS[A38t٠)y;dirmAh P*n ZCԞt?ڂW{& 7z֞+7oH6١nrE$ jI`SJ^RmVAx  FiV62]%%i bm$K#C.MK",:ܱr;`r1+r7&a5RH)!ˎȭ g|if SRXNx7]kgV74gɨwv)nm,v pmQEIm,RRa M9e%7iSQCBRc!-GkLBœi)Nz/\Ē ,d,2Vk&Z{0#,U]T (S'k}v;묿<;?]|>g{{?v^/ˎ[okzÞoyϾ{v{nzO٥GeEM^\im^]%!f yY`rA b`汞 > `  >_ ``*1Yaz џޑ^֝!ߙ!-с! z)`a a!" !"2b#:#Bb$J$Rb%Z%bb&\@!!,@   #&(,33;5M<dDiIfGWGHGHGHEHDHEGGGGGGGGGGHGHGHHHHHHIHKJLLLNJQJWJ] Jc KhMoRyZem"r&v+z/~4?MTTTTTTTTTUU{UuU{UYa{dptdopcmmZllUllUkkUkkUkkUkkUlkUlkUkUkUkTkTkTkUgUfUgUjU`UlHUlHUlHUlHUkHUkHUkHUkHUkHUkIUiMWUaWNfVJjUHkUHlUHlUHoUHwUGUGUGUGyUE`PDJKBCH@CG>CH:EM6FQAHUGHUGHUHHTIITHHTGHUGGUHGUH)UH$UH$UH$TH$TH$TH$TH$TH$TH$TH$TH$TE$T=$T1$T)$T%$T$$T$$T$$T$$U''Z;A~PXZebjigkckikklkmllllpɼҷ״״״״׺תתתתتتتتتتܪ뵵Ĵִ״״غ1H*TÇo}C/jlh ? Irȉ!}Q9˗/Zlɒ/6oRXgG@4bϕvlMCݍOڠ=l)HiT/X 84<0\%; 4+%@ٯoU і WgNzbsBB ש/87څ|, C]espիUDe3[\u |).MLAJH B!DZ(E {Qm9E,Ӧ2,`*$@ CjihQ61lP*yKK9 vQ3 U7]VgV#ғ4%+JLH&{ʊj&$UUt~ОlYOVBTݛcyHBt8h ^}% 0m7VjT[eu"#uِŮr$ iגx1]by%$:PQ&g÷((ŵgIгcPن6/%諐a^8 Vvw:ex[qg.:{체ܧY+ :Ҿo.l϶pt,Ymp@s :i@+^`f_ٵ5l-Lۋ" Y*9n+Y,R˵Pg_FD0ys9ԅ:Q1g.PiB=?'ڨCmYT2ɞNa6TӀ^5,u|΀c"FIykȞ&7\6>U?p>hbc9(3QHS`= &&*zrΞx*oŃ{(xTJCKp4ॆrL>^qy4 p? -E әa2GA͠KfnkMjTS `!"y%-P碛:̉{ƜN H&bq".aic#iJWh|$ vB.+}_ńjwS^\`2Am^hK/H' Yl`:(x\'ӇUm߉VǶ\EI*s~{j+)fg#vRY7t4UleIb@67W7i |LHbw5RQPL#Q2XHFłe&Ad-QHUp?ehv¸{R4>5'DB!qBfphmCx'~c2rw% 'Z8X؀E@X>|'$5Z:pQTQFW@.xpi$A$' ϕWK!%hC<@8jitWUTɆRiJ5tVi};i RHjjqiPDqEЀ q9YwHM$AhfQ raXW_v.׋ALyRfm㘏SI0 kPz2 ilC`/tZ[) Vq ~7pMj1qneZAi7pyȩhqs-y>0CPEA ܩeH&2c15k w{DrY &oAJ(rD* ta"f:znd%7piSzZ4 tq*f Z_0,SP)WP:0g8xDދ:aD#Z=ؔ"mL׹C,u m$u ġIM,CdW'G6E%Qzc}#WU|+ L͏s8l,wVfx(ADai^zq35jWF4| * շ|Ԥ~%,b^](c$(g;q6[S`A/vS@G6+seEKq.:$!>x&Aa.",|Ӱ!4GI R1[QC"QCA(F$5Jp|鬞{ᾤ?ľ{+[s,k] :$MS[(PB/$֋ 0: ~ DY-> CIR,n!mjd,PʧA (tZmL%Z;)HZŠ[| *Lނ>}B2y!V;( ,ɠ5ԜG29("<ݎ!Hn%nij,x̪N5BP(D!ˬ@T>"Dg|+"~ "`-gW @bXd v@ EַQ=pnځ~L4MtP$WM| m9 D6D.9E|sȁBH²ʈc%ߙ\3Lظ AhaۅhC9fiѦI- O%djΰ{-Ř1`"x""eFX z]Dag-ii꤁ۦlǯԄg(}bz5B Mq@ d KPM NS*Sz%rɏܱ$zԸd25/Kb;ԛLJbCC/mHfx )g{SEASoLS{"3TԜ3!^j`ǂa-\-Bc3q(@ؒ*%M4 h 'RH2"8!!B}NIӓ<6a(+!iqbiB aD[SȐ#!%c9LFf",^עzH(̀RʗAak W r'[a|A "я~xU;AaE?@Y+JT浊S[hqYᴁ&d1 G'Y֒ykkFY\xZHHvr_8](<6%MQ8 N%[:/)wwZN2d7$E$bJ-?$MQJLIGN3RιԤ!L@6їE4t K_Cil]Bq1KVC I eK-Di ?OclSHĐOM7 (RrR W˝3KʻM CnZR3HJj?CW9\Myas2Ow !P4-*NyJ|4I"Ӄ|{UI^+WJ?03J}=39$9 e0BG GR g"\LaEN!+8)EHjPcl-MO']KrŮrAKlϊS?,ci<0/J"Ϻ̥87)ˍuf;P)h$l5ûI{Ly.C_hN:^8սL}nq)&sDL1V$K4~kDBv )V(rUnA0vy)J<Fxmzq,H8WǗEY)jA-= [ C@QڗAo}hPp%b&994-:.Agt3M.kKC4Nu`Yy:2%&>QO{ 'r jnV`%}W1kmnPwu)6ۓz%Qe X1e #k8d/ lp ha-Џ-#`#١FR:O6goά|ObQ=zlmi]|e s mxyrõRɶ)Hۺé!˘x!hA$@͙j!%' VDCum0lIA%?*Ɉ !s7>lnI=Ь*LDŽ kFqe4] x" Y Tcl޾ A֫N[)t/jcZQUn uu)LO+`MJS~ʔě,FRoRLXQ2r4mpG*H+a71yzpb7q R Suxs {&qT6)Vsz b({j /)aق<:v@31iYA05K.x:'96{<k S!9s2[B + 4:s{ɻ+;) !)  ٍ 4" 3:k$ҎEDL9*Ù& ёxЌ؊rѢd?s =㋈{I{EkʋZ((bD< Fct'N5;OJqQ&@XDTM=[O[TC.w53:o5A[1#{#p {҉3ubeء> (5(}JB75jx5u|Tʴ"'l5ɞt0:' ʡ55Á<&b 8"b9&@,s,4’h5E[C4%(J nQ/)3CLd-*&++|B\(! z(мԨ˕41)9D8䩻tPY: C4Õ0,굝ܟ ܼ[t u>'c%$(Ј:ԑ.G2p>>锊!`\P:PB&0 "R9t*aix6[--@&䚆g a`UICS,Tj˫ g"7"Pz wI\PT 1 s`/73jÖ [#ňi J;h #LJq"#99J Mʤs# 3q2ĠKQi 9Ч(6+##5@$0! \`F{ jMG~d(0d?%ZMө ; z2@ڱ*8)#Z7jIXN\;ߜtTK+#a)AgQy$İM#ɲ'V^-q$M H+!J#P) O[x8P92XIr0at )Ԣ r>/ɉ= 0Iz1 c`9I A6\L;JYO,YiE 3ѳ;i +G% ¸ҹ# #J!T4+xC.œ2̔K.S yTi i@ΰ@Lⶆ;Q.E z6%عSÞ3̄TN5:*H)EaI1D蜨ȴ5UzZĩ\M {[aҰS)/| I cl4hE&, WOI۠W179Pg ./-X Pa:Hhz=ҿuP]Q-.%uO_kORJSɃZ"ҖzQMZ(LS9Y$Ed `Jk[-2+ LK{NI$[Ua+ ̰57]Q$Xa-<=|@&|boy0 M)-*BKMìc`Z3p LkMOkM7" ^ͨxE*57>Dl`% Q{[b2\mVm/י*yX\2V:=JqaZ057QhM)龞M(ih[ I5GYbL\ dž KXUUo)s1O94<žFl(;`cC iY[ҥL+\azCP2;dzM{3=dܣ5:^Yn2 J!a;# %0XT8XWH(j64"1? 1Sc$CǸ$ܠir-j[y'4VjԨy^q˩5M!a Q7~]y>enjz瓨iK#o\I&f [ݼ1U8%t[?qج0|0y䡊W]k Y]'X\[xM[mÙ^]4?i&Q< \#Bb,EӔˤp‰ϥu DZ\v#-t&⡵.kMi<1ۘ}LHٞa" 2WE&ʧXp^ĺ"8rd0(1PcT"U;cj[ ð' 앜Qi#K$#2Ze \޷ UV%𜬠dVPfXƱuY%~aˡ: >r! AR0"8]A^?Va=Č^sR\-lQZ]NxoO(@'vs8'lsPpEBLj/.JVJe@ʠl%`q᭙J$9u1B&o!({S+Us)sc չpA\$!h1/(0!V[^aBcbcZ  >pvJ#GԜ9G#w_<6 ;cr}4WE2tۤ Rr| 9W.0P,A;Sʰc+ZO&}&ó ٶw4tLk5䡊q\7ZLNc P֢cy"w 9o_u XYz:*Z\Km1)Aw)q/O#» qا_VTnÄ$!ymT\6wO/²ROӏe/a[w`d?䶫 -FwB)Z=v_^N0H=uU:t/Q|TAHt",paC %:h1bCtBd(V5QEH4 LI\k %3LۗiMKv+X.m7% i!UpM˂ɦMs3XAH sQ4d<ő7vY:ig;%K-ڮ:"|8#(qݼ:$bTx)#켒[,4jԚOteә u'swϣ:74yxQ]Skݱˉkl7%iߣ$iL:V@:4$(LlIL}H1UaY}5!LY閡6\\9YAdq!x2&,ae";!IhHzϟʆсaU4I8Q&1zN-D[mZ*U 1,^۬7Y)wr%tZx'po Q`6dQ DD@[naf.*da:Z3KQ2Q.JJH & VBԫbL*k0+CJQ$`gZڲaa$PXɮ(*3]JyG'C0ɋ4:l2]+PM#q݇ o#F ҟr M >5K2M6z Sv#0WTG:h5X'6Ae7>bIXbC D|->3 +hG卋TUOfyhMIH#|-Jt͂O)IrL>t ez?ըpIJBԐJvkvڤc2ɼF6mLວd֤dIPv+vWRFa)[aK1k&HDBYmf:}_jݢ F~hPPCҀ֞RTcn1-T@t]TʬQ-(!a3px{hx * ul8hRX0/a!amP)m-Ŧ)E O1F剏^矯mHBY؉S@r!'(GŔj Kf +XXFҩuDKSCbku_*[fq)M(#! uLX'1^۔ w lBž9[,Sb.zH)J )k=X^PL%1R1f9Z}Dc MV663H(:xkU/FoflUJ:g ȗ(E龾_=*Di4a5)_r ;8[W:`(<(牧+$X8pzuHGzyG5m)L \ ߩ(|=qXKyRj!y%vʈfL8 ͤ#.WvK#zJo 7% x8̆aE6ތ)X%!qgSR#:T Q)t-5"(`7~d_$|μᄡL#Df:e$B*j{HSevFq{m~06:[υ;_' ۠7 b D}(ڮ$tU,MaW\<EɄkȼ֝F?SCdZ9TAUHD nH/ELѓ ڙML  EPLRN]`E $e\=<IU!U|8o8 UܐRFOp(IO İLM%6FAoK:?C$-U-]@Za9%0bTVTQDߓ_FHӺ fyGn1O@B @4G s4ŧ GW ċ)œJ ą6Y0Hdх,N ZEA8T"ƸJiP۽͝'Rܫm"4$o$ޛB  b!Xte!ې%&zXLa["RQ>P"]8CnCo|96ŰEP J[lDNƞT4EQ`جeJ$B"IHRTVI a׶l D~FLXaJ]^}Ƙ]SF I|=c4DgMc#2n\ӌ,P̀8%fcpZ15wj|A=daG4vg>hHNbƅT$V 0XTDߞi$r pTZ:&j&rCF$i~Jp kHEPNڨ-InGaMC(-aOD%:URGtL$ú%VZ*0 L$!uHhغ^ ,evi(Nx b9HUZG< ,]v @5f3vX6S/b腄(lE(Q_ta#e`ݐpV]HnX8i_$Z I'`A,vaGag,$g mofOLK]` +:C5=3SI\$YXވJ=}E%MI *DNLEM,IBfi荢D9ݦ.YӦܮ$CYLn"taW4 +y0#+MA20-7Nx68R&KЍd}/FuPi!b[|٩Nł/Tñh5uS,XNwGL&*n$Vg"ײI8g1BB.@^|%P.d Ƣ bRƎʹYܐRF+*vj-BYݖm"kՄANrRlMQR5b"V#]Uh[aNڅӲ.p1Iy+5TTp (Y){CATvvBafdf/-Ӹ%`fBg\3ie[ipa:&CE鏼H$pIM= Y& L60r&PZeq-ulQ!ΠMݎGaP'0~A r +@:: jH"ɪS%)\6b "4k4h)Mr΂\8qqH( "ߕ޼KU1DajqݶqObIJ4L<2th~6N4̄^r n.NJ>2T-O.U."o_i֊a&C/32 %Z|˞| cHa}0zcp0{vD6].Y<δjrlI|t![H鄕 tᮯ]׼4z{zQB"^WOOGA= 镽X0j*7UV:r`f<~~rvғ Su %քL쬹N|GSDˠصL0_׏E_`#i6x. QzAAڮz;{(:ZK|p و)O@N7g7)<5TM$8;\hӪ9FeTފ!qDkŏX\ZMކ|I| `KosZej.R"#*=f QJXTe*h@@e`A_&$!#"f+ $A^H I%Q0J>q.a|i.fM6q9M\+hуk1tZӂ%K:5JWriN2kذ 7Mw'7g]v.[M#ÔOTxbQB Fc%*54ߵm7fkUQ<1b !ױkɶy˴|ĭ}x>4;Is&N&繽kQ]}ا^C*5/UOkd E%rܵQ.@ 09ApK<ǷP65/ [8!s۰8 F kĊE}(3r`KҰ j֜$'Q5VÒK gYH΄"07i;+ER3=(&r ,%/d,inѥ&?Mt!t1K(S04ES*4U213Ց2WLX.cMJd57e8aN9gŹN\"79$Hʅʛ/F>/ⳗǯ0dKm܇˥(X1sh8vKxQdx#^{aqJqDH#ٝMH(tؐ$PDJh/pCR٧ө9 ӹ@{'?j/XaB2tЭMіױ)&.M=(2K-24M!( !k2ޣ,^{@c Ӷ!96M(Yʐ,]ui2pӶۥkA0a*N*ط__[ C:ڌQ=t@j-PݜLцɏv2ys.if9,b3!IP JQ_@HNɒ%Zf%&ȴM/F]緩e-yU% Ҋ "{$5Ј rޡf$-SSPv9X'W_T7)e K,*R0Fh0lb#$$ Ɏ9^ {K!Z 9\yR6J!_3EKÜtvda 'עgO!zEV\kyQ4fW ^Ɠu@ԊX%1`:( vSJi&hy'Ҕmd#[1E}La3@JڐbT&hQHES4!$gK&wRMFQ/RK^ҷ`(#`c.(G4邲b[Dn *[&4NN$7, 1J f z,ͨIF2z*_sD+UR--Ck!7t &Ͷ':i Z5OK62^\H.'G^8BNrjiAIΦDfpy5@.W8AG2kPM/qDMe fU"$>8-ɛUWqܵ\n]kt0*1UAv)yg f#" s"ed' ʿ$3{izL1 L%B Ӥtt H O܆S-£5IƍH|qWf@:sP6*! !g"SdK*R9t@BaIʜmo&uҙS/Ԛ ii.i͞T~vc@(mY=f2qyJ8tjL`\ox6Vvxصjx+]On/$i$>U!TGV[${Tr4K<%O\X HO LdOfҰ`uH>H,dη|bm^/7P{WIMH$l}o9gbz|.hbLJƗ` ^nt4~JdH@E(!}:#$MB><o0 b8aSb|!l*ԔkfJ E[G0hdt\D7Š]^n)v&!ʭnZ&ڊA\{`iL*gd\19nBvDz qB.+&~*Nohg(6PLLqZ uL+8,iGcl C tib0In|#Sxv I 0 1.keb29#NoQ qCpFؐXb1#*H펄Oh#`Z9"fN^ﭬ&:,\!bM.a2+2r&ά ^b_% $ϭXX&waLdd*mi0.xE8 ] *. :jA !a2$GE boB(P3!R5w 2&nc(Hp"n1'j]8ehfJ'e2.8.cU53(1&)ȓ{Z,!VH-\x!Bpn|dQw;NSN{'xְJYnF!U/ $MEJvpӑ5$G!,9k>!R|CG“5%0 sbk5TG{n"En-Khלnih58dTҝ3OBsCH9ą;%n*O[ҡ-T% ,۬4[Oœ8?_bv%RO9.&5]ZDP*d+K9 NA8l!n&FMF&XR念!VS@kk -;b,ab 94ZlBq! $ODC`,(E=덁$GDES'P&38GF86)iqk#+BUeC@6T30VgiwimRX2%C9BSS\Om")mj%m~UP(,MTp/qqU ioJ5": .qյdR_Y'v#|3 a<(5Nz+:N0\P!-FLd4|ȧB% Tx?C>7ivsH)Uy}+hWbox('h|+5B"jf)kQ r"M옻\m4 8834cپB#NE׮/VP.čƎ$X8B!TΗ| ?e{v .NEPIX8*IY (/r*Lت9L` gk҅ "wNٔHoz6*RW/cz50Xaի5zbj,;e0);dnoxoXZdeO#>FP% zZv$3RBDLcMT7Ox;:)b:]4"x2R8( { i 2y=6]j);h!<"e2!6*w No'Z &y}#3F/a&GQvS"cFA%-8j>km7Ro [" {i(cjT]WjZMg`ec YvA aGV]ĨmZ(6dyYʖf\!eaa[;b@v,A-ԬM̍A7["Dٵ눯Vj(1zIzOMH79JďyF;z?dYF,8*N G2xa"!D辮;FjaEUOiƬ‰OnD.n=F ∴(w[c+fd1{,M{"u9c|bpG';/"{"m]wecOdh+C qGsKGřg-91`K6S@ u/tjUzˣ5P"Ŵ y#DG]HW7YEfƖ{/sLe,C(+窕9اI8:lvX֛&fgʠ"@G1"@0uy4[}7viҙ'c|C=>5,jwEJ|MNΫ7V]]s(V 2 Npm)/CE"(D\墌*bj9Sp} nBX%z_FQh:ܼco XY=ߟoa({EyPe*2K҅Op{Ĉ(zcN!j똶w.wypC('׮S6c2n $,„ :l(_ >|(1#AF eiiϜ8s)Wioሰƃ_>,Yd/_KӉ[%{0QV2)Kk'&`J_jh|ֶ-Z6JDwmѺ{NȊ !A8-ɿ2k#yK\qvl1g/l$:+1_pN:6ٲM;@I˦khӺY>N<!FYF_Zz][.{9[QVz]zۧw>2V9N>-QAI6cA7Zp]\miaEEm8aUDщb,:H#n"k<L25fKKI%`9rxtqkAEKT7dY0mUR&-mUYeL9AN_u֘$)Yg-X҅RkшkVƐe41fKEX:q wqJBjڤz'ꧩAQ'e\d"tmLX;$Ůr ~kVWiQS]b'%' n4͚@X0J0XR3%;OLkxb,QE.;6kbŔ^lqCP:E_(ODFqrl0L]NUIWXYW:4%Ԑ$q +kr%g_%`k A$%L`ˣ~1+jJnXtsh#ht4wJq_8BQ8kXH0ˉ z7AߖN岟>vm#=O%3(!ۻ&^8ަH^mwɵM}իbǵ%ٙF4l' fvGeK#A xv%9epSmh#йICJd/(1~W{$dBǑUm֫TL)QU  Cpn2 V D3qFiY 38V5˪}܃-v%Jܞt&BHhF.1 {$xӆԕq$k0"ů^ jR"}*piRv2VEgJK>uF4 B6{%AqP1]mٽEBe G19f)˪2lI$.:,dN 1 7e- tS5:IA ٬OyGAA$>ѤD(CNuD*Q%8PqsD_<! PG iU^yjS ]es $1I+m\nOhlZGĐlN:_Q2:!Ih > ^AMhJUn~H_JĻ\ZRo%pPe JEq斠(̓,skXbcpGZ,28kⶦ ]+WUqrb8;^rL"fy`P44F$ڈ3'j}8PUmϩ :+a{;-\|P"hWen #&0ܽ՜y+TGl9:9\.',.9ʈs.A-ʜG ۛ":B"x#Jr 'P%cɅH/q|\5DFlpZٹI;?F ݶhU:/ŃȪ~]  )ڷJ ikaͲ$)ڢ"5÷FpW jҲPUhb$)('kiIFʞa/'1g.Ӈc bFeQqU˽z򷟌zE᭻|R9yOGRaVNEn-O75H:[1{x~$XD6 !f,ʓ9hhwxZ¹Fd$)AkIɥxgofg;&%!q\x<ǔ f+=ɭ裻s*:cBJj֣ PVdlUʨyp=3kq}y_u'hc=Es<2Zv;F2 w4vyU2IEǖdz9Y8m X%Yy,Yx]6 "r4 9+Knw2FWfTdF5qsis[t1)d}OZdʊoFVuVaN L6ө:9Nx"3&51st{Y3ڪZhětZۺ[5?;9z芗)MQ PLKs 85HKHxfgXOyx¨"WyM8|jT5j V@ Me@j<7c8I i[Efς)2hdlcX A"dVedn#WHcn,(ɛ5d{ OyJKŖ|㽊G[WbkFkc+ HQG]&c2 6MH^ »BHq3P5 *HIC7腤Rd${񉺟+j~[mkJi뉞[Rb*lj싪(:vZwɻ#ڛk,tam9g83uûʜȮ˽pzˌ9 f,"ns;xC|,Z](q}66Kt{, y:Lc7Wr"'i8z<ϊKoƚn 1 \eMʱ(] x-{<\t\nlUج<ɛ%|o̠013⻨ ŭE}|˞L橔=8ժ*G=,Joֳr[?J5-<<$3k-߱` O޻;.nͽ "$56QG췊{]5=񔿟fx=N~l ׬) v$RU\}l}߷r6] gn%4tت'dc۹ c1`9. }T<= Ú9oz'%."].Wq|^=І`J.})~=~ h\A!r{6Ǝl6óݖ*Vnݲ\ynR/K/P "+Ot]n/4xVf't^k1m.fh/v}ۡm*p7-#-M_JDjK"t*?4O/;?t р$BZFȰC-jL8q# !~ %F Tْe:Y  fȔ4mBK̝:k QI.UڔSQGY5(Fu˖KTfÐdBe۵[q~= lYu;(ߖ$DdXq/%c t [2gFxCsi6ciU֣qoˁ'^nU9qqz6rg?_pO\{kbN< M yN-H4)|o0/;I;"B 3ꫩ =\pDJGlEYL/p`xFM !1;hH&G !&3h9rSMJتLJ*Ԓ:,b\I"LT3M6Hx 6tʯ -27ܳ;tEǚz@LѣΣWJOb ( E[UXZ˫(kM$d[W}׮*ר6i[)!^IDA6Z"F q p[sCϒs:{M\cm6w_ 8%H8:RmBGz#э4\cM} Nyfwe`zՕu_Nzk5Ntݩ;wZ;YŤZ Iea2٠^iöo =5'z5[V&T-nNfФnd3tV5#װnٯ ԢC*MFR!/s͍-soiʧCr =0JV_=Vef]A /tN}x`;ч+z vR :oJFƶ>k}&#ruӎ;K൲]z87'Zwp|4HLW1aK`0,"#CNT Lф6)(efwB⥐lKאi#ij|n=C 'dEYЊlTæ%$K"Jj7݂F11YKRSV6ʨLʜMnYbȶ6,p5dL#YAKT[\u qg3C^ܑIń(HP[T+wIKfQBs`24/0A(%~A 2ZDFJUA `hŀM_.K˘D1 bCð)3YB|hB>a[D Etڄ46i$!MlAPQһPx%j0,II w=_⼥J$ȊnLc$vR:L FJq2 3%<6)Z&0 Q#*`</J+A"q6mrLcg>#hBk ‰-H"WsIIH!k R-: &y0a'f(h2MbɏIeFkPJd'xZ:.+ep:WN'jok7>))POJR}`<e̅5 {ic`kRӪv"pTΆhCg<(zb/w_h MI "$ ︮a+ʄzΣWdBo1˫$- KFdaa#7&&"-n݋1n{1҇ơ;`f֩ l4VjcԁHv&hSu!&w*$jY#9VJ ZUË&Y+K3`NzOHl|hgU-CIGZVaߡaB,L#%#@2+ll9Fhu~KRרEtI9p g9AokNlpG1L0/P窍>LETjnO6ՙm>X29uݛjwn,MRaOҗX\ )\eį_ͺڳnǓ/\\zѷFYoR ¹li+>,Qr{3 ǹ&i^,o`ݹ?26gU~ЀEDjK4UYэB=a,W ``@uv&QTL~{f{ mgmU&N1NiӺ?nIahKI( KZL|:dhDn!޹D޹Ckg?d9}&!epyi>}w_ wO`/ CY(.McSafEcB5H{2(i/)/H Թ%˹ @㈠@ĉ3ߋ= 3&JJ2/0%eV03 :+VA)ªA 6AA3!H&D=EjŲ l84q8L&Hӣ01Į+*C,b4)@$D*͓1;1т̣-=D:9> ? iIEZ0#B~껢lJJ[U*F8loQGLd$i#y-&CNȆBˁ28\23K$OL2OO?¬p`b/+%[D3s nAsL;;zLa|I(lP𠔌P+DGQO{= ʶO O3âè2hTI ^8c Xt,y:PPĴ\PdˠJ\|=:q LMKKI+i+A H`JsP9BI&H:7TBx,!]|:ж( Ts+c}kFLM4%P/|(UQOe@bGu;;ӨKDxLTf|U =#2O[@\=T2AP( aK&R,!?ؖFKBa t aB+DlUetKvOɅp0T<ة.5KDy)vV NtWX@ߒ9R#Xұ -=.-,؎ Y~%lbꘌKTNQ)3 7X"I#MyF|%!-F ݪ?iqMcMxT23ԗ-lYyT\;q ۂ1 Z5tK:\FVMMU tFUUOC \) NI)CYaS-P 0)/&oVpU* WW,DdLIHVzWsЭ ]_Y@7* y1#CyDWCI{@u\w=^,kN%YE߼) JٚDUd\)y7y j[b:ݙ=Z%`m/ ,[6W|!$ KZ-M`Iδ[^ąݚ}/1M[z?ޔJG_ة`\aRA! a-5b|]la_'` n\<ѧ҅ک W+ɥiUAB XU[ۭhWc ce T]W#ND1&[(-h^V2<}%M_S.eT6_Un'n9{:ŝ \f%eI>~L3&st5n*Lif= گaQ@ %ETn}U$Ht]d\#U\^u}_GTxeuS!& \ܽcؕ^ ꊖMZ5\92vQgkiҲc ueVf>%(M&dS&%һ$SN{eb;A]硞j YM7#U%{j`g1?uZBV~Exl}xd&]l3]FgA6۸ T3gȞtg)bxv?fSMu}Gj\uDu>O~l&mXrN "Ԉhvilռ̒\h鶝bk"Sv㔆~4P fCuԴ(3blmNt-ߎBn 2l 5_sO8c,,n ㌶\,材%TGl&i&xe8Gt9cFhd53_3rlmo<,n:`aDBrXU/^pKTo_v  ƾ6\ o/&ƞ5N/eOטf7Թq<^iq>bJGrol&nSj^ hb"V~4UltpmƵۺQs\v>fSM)86I: љ?nowFeEy kfuuK^īa^t/Rי]uyV>2jx]楟vj^kgZbψ\Wa=n`-@WFh"szKIlv(vvL{S1nyQ7fW||w{|ulmVȿu_VWnk1\l5:g3I֗s'x<.s>}wMV=LRfgT5_@|O}~ie Mu۷uW{oz`__?!^ 1{5a?vut]I@HDx 6A%60bE;~/&O~DJ-UR&̙+oĩ3'ϝ>{[)SM*2dM:U*u*UPbJQcVz(XMc9`ZMھ\HuKW]xU}I'0K3ʔ>- (LǓ+cnΜ?S}Y4Ѧ)kFM_$S62_U*Fn/QƇ;Xr}"|[iÂ;vݵs][&g'D0mUŌշT5CqfirMces%EwMf:gm0Җjar?~d<Ï$Fx&VڲC(h:9O!BmeZy mMGaݎ>%͉ZQkqh~Yq'XbVGڼQtF?M]uMAnn\tiyu,#!HU_6uM Xa0I(PF4VB[\ "/hu~D˥:++׻~5B䣳\n3DI'{-TMkx?&453Sm}>ף *3,dTk3ۂө &:Uq3¥p㊩xQFЦIB+#B}xpmZlsSOi6Ԉϭ(y4Zv-Y;_rvzQԐJu7В~E0?UFd8TiT]L8`0/5*9Ju%pYc:I GZ+JHG꘳{>9:vϦL@B*X_iI2j6Q c![\Ol^Y($}0km.mbfs#-p-36G1gm.Ds[=4&Lwx4hzBIxU$-HcTJgӒvn`(Ū8$gW\;CZ-BSˌ;+o6,ukߥL6ap0@>(lME9&&qe'`[7<8 n#< _8C<8+nc<8;<"9Kn<*_9[<29kn<:9{=B:ыn#=J_:ӛOR-V}sUÎhgxڳ^p7zۡnwc:ߩ}{?-w?ki+O_W|^nzʣ^'۞o}=%y'=Ok==w=ُ^7_=Uo_so=|r'K?s/{O}ie_%QMV __5]B9>b5`^_ ~㹠 ` _ "a Z`*_aΟ=M _a!e ]N.a_b"b!.! !*"2b#:#Bb$J$Rb%Z%b!!,@   #&69 DDFGEGDGEGGGGGGGHGHGJGQGWH`HfHhHhIdL]SX[Sf RrXak"r(v*{/:KSTTTTTTTTTU~UnUlUlUlUlUnXt[}|]r[iXaWXVPVJUIUIUIvUJnUHkUMkVUjV`iWgiWkkUkkWllZmm[mm]mm[llWllUlkUlkUkkUkkUkkUkkUkkUkkUkPUkHUkHUkHUkHUkHUkHUkHUkHUkHUkHUmHUkGUkGUkGUS/TH$TH$TH$TH$TG$TG$TG$TB$T3$T'$T$$T$$T$$T))L00@55@<@C?CGGTGGTGGTGGTGGTGGTGGTGGTGGTIIUIITIM_VfUiShQdXi_kdkikkkkkkkkkkkkjkcl`lblesikkklozѷֵ״״׵ʪתתتتتڪݪߪު۪٪תتتتتܪ¾ƴֵ׼H*ThÇKmhC/j-C~)qbI#x1I5~d9ǚ@lNdSQcCبeH vT t)ĦP5qƭ@rʩ5կ9J"jk9Zj-W^Z"O[poP~w0?} 3`ƅ ~d&\٢ϠCMӧURLKw 7ڱոWܭ%ݺ杳xoو]{K-gs:yn FVxŝFZ῞M+a㗺p߯?ؓX1`r9ڃEPD!֜DEч[K'DQ(L`E5QSمHf%#]!ǙQtXWV8[t!VK X^fIP`h[^Te 1㦛Ϩil9[L~F۞ِ*hG@NN}NdS9tI.*tuRuW}g(V╊*zr-G:gd|p j"H 6 er: ȮYb bi?ow cYn5IϸIj*;2"KRC!@M]DTê-!<|?<}䁍-6AL: ڧn#>X)l+ =˱UWn+5aPr}E%tb-@"e>8 ^%BM~cLgv(Bdk#{1: WI_ËoNrI\R86]mpW 1xDg8Rؿg6@/(?R2/c6%FI%5hlP@#<*9%y?\ D57k" X!0r:'Xe'9! eh+6P| Ɉr:pD֫wĉ(=7 Ad*CQLJ)8$(yBc&ъNkȣM#FPq#NLr7$GrxS8LzC}j0(JV5IӮbP66T%"B;Xh:Jg b%t%FdyYJ64*9N9~=E8Z8`CFN@ jC0qy, B:-dd$#UN\#3rjJ8^n \Eo1Tɰ3lh e%.s%xY[++^-1+婘2/L0(\J:5_}Y{܃2UW¨"BdsKs8_ PFMs&^ TDu̪519sr8@aPtujֽ1Qq-|f2qtmى:إo}{_K8ͣA/yާshaFB&-TVfD(Ȕz1VFYiɚh0M5OjVKPW7.zh_"^x%)b\wT=؅A ![sNnFd9g^.~kq詠@9O1K|aN#]o{Ȼ"@v8b=Н9ZgGrԉs¼L'Erk6BLrP3NPi\;?WŖT)Jvi8Q'l7D:H? yyu%d Z5t8zI)Wʆd=Sh7nH1U6?=T"CEi )B)]VUs_ub2m asдɤ 8 @^1w=}S50/\~]?U;>uup\ ϛ7>pQeʚ4C}xf  &;ZSExSs6^AZ|R eFWRvgPat 4m*-L!,-?_1I>bِcaJ'S>OWue|#tF6TYU+XQAd tOer/]Og$W#ZcBDhg9p`tvVűlHJKSG3/ q=jcX=Uguej#Glil ?FX3 &ȁC*, Ű` [r,~B][}^;*@?nBn(%P !rSd)Xbt)'V9arf>JǀZ&q3q'V3&Mh| a6)"WD;OG r.GpsKX n@)- , (˕B<=q2G UU S_ 8LFTYiJpOAMD/"("FDb`򉽶1odFxP@=H<B/P exQC7LyAGXJQ0xI J~6`ce= \db(&(!+)$g!/xj6mԄX\qG|q[C%}"əB(hhAh  njRAӅ\wqDmw6.W&Qy✹5&¢ (lu[G+Ӏ*2! X@ ~%ȁ8K\& qAHRօUXwAO'Gp^BSʠGB:#s5%u]H>̉Tb I-=~;obg[;s["䆪67yǣMqR,pq-X{?0P\Qt*b%aq'@*f|8nT ԧJM0tUA_U[9@{-C O YD]_9 (xn:#joCYfd%Vhq Hܹf |>-)br2Lw&)`9qѥB%#B>gvqjF uF/8(j=h|ڠN;*/XvVR1xv6+*ML.۳J~yyuwyC ;G.F>k gwx籃_uV1!3Ϧ zJ`t8}`xVS8O@)Q4ةtߴP P8T LXf8ZM}#PtAPdB6o+LNm6طKID !aBnfӎt rEtɁ+0&( F.Tbf#vȤ%IJ2.m(1*'HN$"/s/18 g"N_uKQ!V zYBډ<x黾hY4qzZ2Z'4m pKXfFTQhK{*&G7!-#R8'ROڏም8{#;q00[@_#"S!NwCل+IFqkS7b=7UG¾o=;F2iVa|0?$s&zAvңV9ײx7&tvɹq-пUпr2%) E?X7AQ$AX%߅ڡb0{@cN~ιbAQ 3 P.qާB7zHLXXP7k (7ΗC\|AD!2:-Ͷswփw)Vd"S6E FFJcrj4Ci7u@#we-ҫae>:FKUi[m d}&0" #\!U(k]bT 4HjwjZ@RdG1F`]-׽Xh~Ck(84tpU5*}=U^ZjncB!`5p ϣ}CLR&n;wR3^l4)>Aql4FlP lId>]0.o1ޒzW/NCվdg1PۦhUSg= SN1xF Qu;Mjdk |Ƣ '%p>@Ǯ(E>_tR%:cL+Ѵr@uF TC7dQiG@!5n~S[mnj'P$F|fc}³V O4Cbȵ뼮ޭϑA19!Bq$su4?‘;Nv8’"XaGkʡ_qB$U1̢.H#?`a<Ӛ AV,W_Lq-l,qhIc-:*RH%MD?]z`[[:ę͕,n gO:gފ-bR@5Zgԕlz|2P5>-YՒ"5W H)VwEUn10̗n=jL2ꜛcէA^~fTK-a [05qZъ#uHS6RڳmJڽ{`[MW٤.21A!z Bt01jq ];[S5M[ Ƌ8 ͌6eϲ&++Mʲ ^ o#Ƴ z<?1 " AoA ˪ϡ B6(11-'8qBΊ0x@>aC?q+3E/;=_$X $@Ӻ I b.Gv(3B3Fs xŷtZ*X&8P3Fj+, > -#4ȏ"t* r Ҙx̥%-t@rQ`0X+*4YMKMPZ#݌'E*MRNCU\xOKaB6X`"(WA(N" A~.SxqGlÈ!#d|)Ga/XϿ";4Y$qՊjKWؘk|oRL/QcŋWl|F6Ed.C-uf[ZNˏH,3|R`!ހGGc X~q~>`Pt*nkN 705f(qŨ]7SI3K5}ƸBTPromB.-3SA%"SW>cPﵶ:izMlf[s~̾M^ _oO  ?4Wv<|@<#d&#z+̾h*N\t X~ψ3ASNB"_G?y}éNR80r^^vbW-s˧QYM#co;)O3v}s?}Tt J5wVqC\u\81. Ű.22 .ŷzKGCD;D;:/+ETY <)]P ,TJFkBxÂvSBB8)ch Jx(ҡ: ]K1$`!1i9X;yP9,d9s#L[#: ]S$W˛ihc oQ7[Z(B@ 6-28+ʰ]8DAdqsX,x`&?K;—[()tR)>3`Aꣾ]]sOclxMS:~>ܓٙ-4ٴ>-9gNy陱2jޑǣh /(O xۂ_x Fo:-{ʰ:FګHۈdI(+B d#j%#IB,Dg\ `i-dc: yĂ/Į!)6F Gѕ:Vty'3C&-29YzJt*5+P ʚ,(l kKcBBIi|˵5ɵ]ˆt \ccU-pYoK ,# dT r$G5\C㊱Ca_1դ (a!{C ȁԹ (Uˆj'S G?LV#IcbJz.PSoڽlőlO4P58z)JQGlJ) GL",19Lӹˊ N|:T"dmC1l:,L"B0$K6(+]iIJ J˩ӱKtn  z-2U ɧ\ɄL!(RK5 ,Mat$EI2N~|HU 9I<̛OdRdHhKd =|X$la6slNS۶1D~6ߙFh H@1 :_ƴ<&V;{C5fAB]C ] -Aok.kE!Fi !քNP5W J=SkP@Jg=BTi[kEɈыx:P #I RAHڕAXii$ASJN+y0"T:0-{ݣ2N؍SM|J[X< Ek|ȶ$RMw&HO:U;JmK6BYttэ&9GWՌDBUь[SLm@/$$`d ~$1@6hIB0 \pH#٘_îW)kV'jW`>:SڀaU5{ɢ> 5SE K-;UsLmk]SJ.BYc6^F]/r-Wb{2p+|=QYM>K M#PT gY`> v√`lS1^q1 d;6,[Mɥ:=tUCe4,^{XrҰ Ja ěT \]b331BREI}Wu""RXmS#f4< )P|`d&0Xs KQ".IFf Q|p 3Y 9M3d=z;PdJ!QDјf+<*U=ô@]ƌT;+@ Uda;lE57u">U ;{=iܣr6d`>t\ɍ(ŕ)h~2xM4HЯxձ* T6~4irQ@V!@TcM3 Im:D ,}s!+vWhKi_J$s>S?u0RKpOŜ#ֺ`)`*݄l]QC6ˡ 2Wq1K0\ЈP<H&^B| 6ؠkhapQ4Z6g_H1j7@F %ߧ#$ʽ[k.PcB2Gq etnYWHN-DGX]^աd(s> P]KNs \zVȁ^&P'k FlJ ع)\-aEB$\M~9]_- Rs) G4u+m;';kqX#R#^\ mp"WУ0dV$dQi>+ZE8QV]2Fp=| OVcB:"=of_dߩCϩ/,S5M jT<6*/ēe q\fJ1N%.wa!hXIq|6o;D~ feW/́ KTGBx207,]\AĪ@3C9z*vx.h*$Ո"2rCnODϾ SCߡIP.]Jgc ڟ7#wzFC6p>* q +.mNl,6[X9PMr}>׽aRS+W7mG7 tY( pq@Ȥ5N>ZiLXcԬ=FO:Y>z+-#Pxf%an3?s;"_XPkUܨ G;jfy:Q-R9,mB6!0Y[s($"B fK[R#^RFlhR1`P[4 \ʐ+!M(xDe4SQ:u:/R:}° bdH׊GVkD ^Aҝ[jѣLU̙wوMWbEȃ-Jl̘7k̹ D,x4TVr|#\†r,g oLykeI7[d y]ɦL&P/< w$Z>NՖxeiSV4"ǽH*Gg ~BrO?LKv4WHr_h2ϕLiXp ҤEU6Z5u=ar]#TDU9t==U@^VZjUa]%XhB~qbe2Y$c)2V$IKCB*E2,qu׀+']#%ZluygJ@F$Q>M䓙Y4}id-JZfy]'e/KFק EX(Pr)iFja0)7J tSU[]m6G]H/_mi-nպKӈwA\2A3ݩsEtCer \'Zx} mQy[XšJ\}Tk. 6 \{qdD2W@LBw'bvҪw$UG5>n4Li 饖G *aMIVgtdl.'Dm-ptUd_ ohJ4(jEC3見u903hˤSz+&dJ3ZŎcIG4+}~RQediO]eH@ Ks[JX; OxˉH2E5F SƳu.h? 3Zٌ2DKF*F [PgqcC0yg8N21Yd^R=A96$Je#،E6wil?z}b#+#Y E~Fcs 倲eP/G|'4D. ɬKMPVܘa !]29^[H=naa3 =BmQmjZ gT9=2jCJ(S3ueS_$<#6d&V' ܗI*k"O= 57Mɨus^j/c~LLڄ0dl!T_v9+g8B&fl~5R|OH!Re0c/X`d\.!tEghBDwIFm&P6ZiIv;:ysYi;' |]&$Q r0:96°R{R^u./zll'_vj۹7$PVM.NxuƱh(Ԝ݁zwx@67q4,<Gyq![XMGv$#Dpz-9T2 E}jP!8nh9Ԏ֜{6NE`47"hF \\ 0Qx 4u[ Y}HmnTѐCٕ L*E*mUP]XSxQTNĹpSD zGLma[4]Uې Zԑ<Ǩ R\Oiᵡe QDqQ|i!f.UՆ _`L_I qaҎH˻E*)lMt+dK` @4ZQAtMpBAISCBTlY&ՄRmYUgyۥTn  ay%%Hs^єvEO$UxQH9 &s,j[,ES ʭ[`]DmGSKI\ dB0 ,#f4X~|̨U M @~|ŰO`UP`UTmfJɀHWҩ`UKI@UZ@]Xe< FꥆAHlրOXIܼHDM lT8Ý :<* SbMͲmdU! aU*Nq}!eHsXAsE<ڥcNo-f4,hQ"1e.R+BHbg5TK~P&_HȆA\9Q`UNI\!G\<|'(">eDTv0'h.ǙPhyzgIN[u$bd^ \!C]$uAhIY\qM}\#u>t( T 1]}QĤfe&ZFDC}yE ewc*A㝧HI&JVG_}>@FִDxpjfڥN aprb D5(.un-) lawJ^}p+hH8je]tJ*OP_e6]j^lP.tPi P2Mݠ}DaL!Q8GE(@Nes`fSzLqgtMAWc&pGmQ[̔%\VͥN,}|| wtTkꋄ2{"8'b{Uhb SdGPD;Ϥ(EԭPNDTeZEQ2`ֹ\[hhL! A)ĤlY,Ab)[\U^5p,"oU|"."΃)czֻ UvLbJr&jLNHޟeM#:BGL Pƨ,ܞ̞IE*/J NhS V(j&뾉ةMk0;@hwy`Ԗ ͞p*%v$pyʭخNˮZ΢\2{t0dt\FA{ݏ ݖFM^y{fRaѢ~kJ̙aHyi"VmLًy8ɞĊ f^*262".<2o"iT2NlUM1=n4G2@GQ,1DI8#fB2.i*qZRMH"j'ȢU=Jp6< r0qu5#$nԚl^H*>O D3 3UAYQzW e&1_D8r tN'DhMQ+#Qeig-w}R`.X$#fS@IO_ekrؾcuGOPqLh¢$6$+Q#i U0k&t N(}PI(Yۇ"ힴ0ijj?iE^ɊTTKuH]z&{0 ΀jn԰ l`MEo1$i.zc7GuB'b3iDm* jM tIA z J%c.۸u mWm"F߽xNjwys[)s:tنNκө]ils0ǖ+:?| l}Zˡښ؊4ϼ,¿ o'.̮ -lrX&b,XђPF\* ㏾Aɡ^A@H1k(/ +KQn٬/6"4LMڢ|.6%^kk5"0R8%ѿ ]S4)-K.s M3T&N'ӍUSMUDɌF иLJFGj*'}`Hbk3=/2;hyk>}H^Q(,? J>ԥ+\6WzZ4l<&ͶJ}b:D͜EyS̈^|񺗭] UW(J92SW_m"M3!F:^[js0k'M:MrKHZH33ņ3 "+V>ӊkOs_QY0Hw"a;:E‰˞2%,őjQ,f7ok_[Fb\8+Zr ؆tpt!~dr {<~i7'}~=XmbEX]YXp߬z䨏MIc‰'jI”.lX -Ujt&p-LknIF&@1:75$InCʱ19ZT@ pQ̈V7)d2QT$" Uߖacm񘷂t)+F%G:fS^GG嬃ZҒ{1b3Ow4;X:#(Rw*pڵ<И?)Q^p%j=wyb(Z; [}dzEMsDNVKȎ^Y,I2ŔMPqY5DsĔ=C}%k%$O(G椒ffAw*ò4 xEK'@eAbYe_l )NJH?N7*qh.)ZZYDgQ$A[H@"=8:c7n5 u4 LwݩPq;iPM>*uGN hØXp*KK)-^DzO)O/סMBh4p~L#m-qQR` ֘T7U)dCꐢ8wjoj;?5"i)#hx8F]^*$șO~B$p52'%F0$nRRWiBʢ*nd['tM-2;&/Iu3t^K Poy%{SH rȟ4VE*C fUdA1wmn^ԓi\E!3IbdY1~!crQnf(`E;YOA)MOHHOSJPHTS bVUߢU-c'G7(`:vޛl;Z$EE)oG2>d~g&}d)X0UjӁ""ۿ1ay0S>rzyDe:?PLm!wnA cK0t/,^vcd]YI= -GA֔ƴleU%BixSlΣPm@2fDD>yxթ~"3\jj"^tLJge1Bt>0g}=xԘ.Bp{A/w[N8Bl]d%fv:sCoRIN-FvbLߧs{Ny6}CzqSId,( `(fB*΃ j"ZnL OLp0")LM4MnJphf"ʴg os&BNtOonϑJ, *jC)dV :"o ρ |K!Lͬ4 T -edb:(Y>qgH0eDPCNP<.)N !l2^g"'KM, cph-7'p-x# gHo2mo2 E ! _Lf !ho:l: vǔo:"Őc-#fBQғf i}◄ )F0 j2(a.b OSNIqIfĪ1*J"(bH$jծ~f0_u0k2RN1ilJGM8)m*(BM|/ T(h&CjQX!~JfDsc1NnF%(0ߑ1G̣}JQv1 Vܰ2ò,3v"<=n.b3SQ5 B2+oΊG淌Ry8(CSé~n6qk0,΋Lۅ)V"Ȓ;Zɾr< #E!3=ǎ-LH0n*. ̲e:q]39U"lh7!F*l Ĕ%l#%dx_QBCxQ9-&EarV1/!G^ee)f".vigg#F/gia!xvv1@znLRl1yC& O0#tGu5n+VnpY&U9n[L6SRj,?U{BkXSM#p0yMYs4"ިm։vaQp6e\.Y 9E52²6ƊI"A9B-mwtk9$ J¥> >81(45K5loup&"er0fh)=Oh#Q"-ʎD.gxW=Om̃ieḛngٚ Qt\yl lK"{x"W0/x!V:x[!):%,ZY,!t"*%{ .mESj~D`y6= ":S8-9/Mr!#FjF`2oano˕:0r7jנ'RO6"A ij똉+ e-Ǻ-=FhH|xm~M dnubZ/E7<ܒXa),ݗ[:}g6iFG qA0o'=AgOgOW;}{3tjG{\-c:8J|[Y(Kٯ*6{^oo+&:"~.ݣq>d=)g Q4r2 %o!@kN'9C&|)*fiuق:t,s#3C&Vlkf?:C βV|[Twg+>r}=zdG9>}u$ ./x\d)I)&8'NͿt!nԶ3Hrl^لhb@~< SC%Kn 6R9_\o~KAetdOd[^僃ގbF,9v<.TDgyx\;C]^ů)^)iK;_i' 0$G+Nw㖬tX>7d靧j}fH \{[98b)14ۯ">,XpZie"&FXFo% >qI<)e9P[9e2J%yi0YHd3KsKG)&a[^m)z(؈b=lZdת-EDG'k.R|#B70 >l81bHET yqdF݊,M:w&).iXK ܷm[ynѦyK6n$m(8%S{mrcV&Nyc=ᠿ$Mt)[YBWc1Ѽg}iMSRr]2f ^j߄Vaj!R za] D]b*ZV-MKMUɰR%nڄuQ)@KASPIѠoVR4HdMjPDq]JW'40饑wF+ȖZA։'fbv7hR`Fb+Ym6RzMCz::vFiXpƪq3)isU= T^yםAykʪ8 Y!QL}M'GIt"6:궆.cdނ )Yx}nˡok2:yevW DۮU =MgZEKB+٤I$T2.d->Z"B9l4K\sJ5 EƮFGk) Wv0XRE5ZS[b)u衆-vdmv\*miᖬ DMӀvgzۺFn]Њ>͇rlɰmW{VxxuP4 kN]ξw_XLgv'WTbO/}yE\n}UmAr d-\,߱&-QA9Ͻ:ų/2d/!) LJA_)+HlK,JX.hkNl ՆB\,,T,}hhSllP Ҭqu -d +s۰G8i.tJMݾQ)z`7-SBJڍ[j#TȆkL"Ȑ$@Y^"`0k + 9e0O}C~I& +B XvF?/ #O ,d#X'˙JH8&4GEw`\4#eEKhđnZ3斶0k~E)6d1W2 { By 7m´ q KF Yfxa?OsljYӣʧF|z&'"az}I=1j{7*Mɱ8J-`yӭcqj_-UO_id5G:Tw4J4oi&׼W&)ĦOXNy#U 8e̞15iBXgnN%/'JQh#Q : uU7'XYgt"لFndylw2ۗ|\ޝQ7Az{dxODR*mN{S ,XZSFLgdD3˲$In[~dr]dB1KX[aֶNuRnbLUcő e u.6MhQE}>k`s%a=ÙaC_=+$h@OLhUjcvzsA*5fFHe+m\'\FnHWJa"YDK 1Co%jǡ (CLbpg$H_)!2>GC=vgϣ`/qQr$WgBg%1g"@3O+)1JdQ+"=77>G:RXjfj3j딆dqZ.G6ME6m &nmvQRAt P44zW5Հ(z!]!N5af9qI<-,Xo(#UUK#e/rg2%v}&kX{QM'K;W'G*\W4y}6+W,phC@A)p)q[X~4sC3NLqt}[ZǎK!QvpiEuXEB(JdJ!%RxmK^#HeOvƃjrީiOXlhggC7|+-aTc|nXa< 9 9[E2_T+6/WtxUimvI堶w&3SYU@bTaj*oQZ[|H@e>ON$Nh:EDx *Suh Z*^5Nv=野ȥ M陉aa.Ԏ;[J#m%4DN4S!l暭6}kZYvP ˩5Y(;Hi["ډǃ Ϻ5fpZS@G'Y!Lڈ .)U5TCytLE=S-2q-Vj4y:p *<.e.9\:ziRJ a*C& uQթ w)*! gK}-Kw}Kڱ^dI;iZ< rYLM")#5EeW#WRȃM{iY{jZ<3j|xndgʃ7՞ƴbVgGڶʏ'yWڷӹ.F˦[Bk6xKҩi#oGQfk[ GY՝٥z__LM㉭9Q;k1{8{[ 9ڰS˺]˘º[~kcȞ˩ny:;R(AZiO7Bmnǥb}xi%BKlvY$깭s+ˇiJԴ0Ғ;tV*LC}g#;VʺʰYv@tÂkK6NO[ 0UN: v۱Aj۬ۼ{q[#@[Ƨ;Z7qe> `՝ě ``L{,ͫ"xÙY|/P;50f۷(+ IK{wuߣ7Y+ ,{lCV ijxv{X}VC{T{1鴀$o;_řܸ̄)͒qEh|HV ŘL˳,("+a컏VƕIּhFH,C|(9r*ͼ#ŢK[8\g,5\yyћ Pbrlw mK#*Hg"u]ê|sбhBx<G<[_,-Ɯk5ui^͂wϛE\x Mf`h:+պR_u9{,E;+BCKڨl+ww;Wx9 Є+wP \GվּJa=,!== lvhylo<h#qƒn= 6ތʻ^G\xЉme<ʿmƊL xONݒۛ]WلoGn >y.{{J[U!=MĶm5y\gEgL\JT," =n(:)A,g-ІkDq=G` J/-MD=U $}r7ߩjLMNg hk ylN{ 8ǣm\ gGkiX,TNZ +^MR>9nu# @\^\F^Em[//^av5]x\`Rc nX2赮ծ텛K_aɌXNkۛ: jT*ًzMWN1Q\դ];)~\z ow[=opWZ.Z$O˛N6zFx ! wD ƌ]矩l~9;d h]<ۇ ?1I.ش˭/ǽPTOG-}=h0G;X_{߷L-{+܈]oZ^zEgj_l,m$B"ĉl$xbC!1 QIUdV LpM9o@6Z-C9"UPS+iN-Y5Ո'4)HaGJϤRu4r(O4D] r:'O ]paZ! p`s˫s囁D阖rkԱaϖ]m۹i³-oL7ـ #gom?~{z1W7uƒZݸs=:>t#Y/'4{9<ϨJjAys4i? 綾 m$ 9*qkS ,6+å21ˑĜDDʰ+Šl"̠ȔPB#rK-i6jdnRd(1< E'$/J"ʻ~%WppM<+4( RQCO% "|̌#KJ B݊,7IVmtQ*VZu[+ %nO],1R+"+>?ՐFQK3@i1IU%l)sMO5uAHN>KZ pE0RdjRo}QK/<٩w܇}zl6%hH&d;}. %Wwyh03 / PZvpmdZYq$MEo/׷.%5ˁ I&X>pYq"aDxP\2W2Qn/JWz%eʄB4QeI@᜙=: S2 ;MKщW jײTokxG (maN4%peH⑌7˄Z2qBv[a6!Gʱ5Zp''$Ս`c+lYX$5'j?D ވFs6JsѭB|cL-ZHC%'t2*O,DK1cjN}K$Q<.Xd$^;E1: dgjΆIn*dBO˟ɐA1d#^)޸?A3keMDƌ|`*7+ynHWU)LE\|_ћ>TnIE- Z(%K)UfTŤFa H&1E-hAE1s'YŹ'NROdvofU;Wܡ#**Oh@i_OA8,C.ʋFˊ!\3KֱeRi\P>E Q;T?;Nҵfn)t6YSvZTb)c>o&؟zmdvP5_q vb8T% ~ֻ<ƅ&smj' Kf(1cju% Ju_yCPdJbN|)MA xY 2ꎀ ; UrQpWRadv2#( kr b[Ըl4FL:qV]=E^y-|i+妙edȑsm'ϫ`@qrqiPLN $+4j-> 饃Ras+[~R_qU /xOUlRT-5bXBV1\XP"Hbg@>C 4 *j8{Nٿ^bSkz6kTxgthy?SH5=_Xgm|d< 1ij;R,6ӹpj``/p5wrkÈYQv nt>_6 Ew%Yr_| cGg40ӟ8>^An(1Q C51n?8 8 b@$|Y!dJ*K[ P_Я8 aP/Z':J[:1Ó%b:!ƣ 9 Ӥ (j`0›뜡`,Ja7*~cH+r <*$7)9${%M>1tCH@)$s͐ !q`*:qBIkJ|%HjHl]COø6M[ J WʔԒTT5㌌{TL뎘Fx,L =IaئUUEC2XL;c+ QM W&JYMc=V7q"pMV=Z{;;QFsP˥M\7\uG|V$SCA6@}r ԤѝK[& -YXwB]RN،/-5 3-ؐXjPư7h4`sӤhL@C-ׅE*ܼ;)e_Ý__~ѭ[˜ 1 751ֆFVuLjXt'>q:]+uJe\1`p`&T­ ؼUP{m5\߁_`ͺLISUDw]SzE$~W&D-]%X2?p&^Mxy2E[/rRUb]_mcB~}c.clH89ʚJ=$mQPQG M 66فp`c]Jdey 'Z<cZ}O&nʋRҽ2ㆅZUcXշ\ɹaOq!7<FM#PMaKP&_@Yb^ T;N̋P]hNd(gʎlr(f9cWEX"2hE1.a}<96^^^)~ދ7vYe&#fT ;͈dY@TEڝuKLi'S_ҵ}nܦ*]m3X.+.rҍtU0K#Eޭ j\bSj%Q>vi5bNDԊrKU0 jYY\q̭W>k&guNfNgx<|Y:&>6j҉m`TDc(%jEefhJLs&aVl~liؖ~1 \ilgG~v XiMniKgamT< 6Z>~X%fP{n`j 9:jfo~.&nt`RB<VWx>pBk+\¦odMl{zVmV퐕 n^ܵN6(Gnl?m6n^g|mm ߿oښ۵6Mu\/)I*ߊnmWdž س29Un{7dnonn+&;vnyun-^!ƺ9~ۨp9;Kp4$Ng/6\,OgpA'f w슖qU=ۓ5?e#p^&_O _uԦq ?O rD-D(b8؈':gqqvrW^^wNH_+"gsb!ҏ]/9Á`uBUߏ6oi?_v?j-N+_W6pe!A.OOՂt%~D'ĊVyYSbTQeW$s w\܉Ȏ6ml-2]:`2%mnybcqOxgm Z@/v>E5M}v/wrAgvebNifSNgΨzIv}F(~a"(Eu/Z͟V{._o1}b{ #G%r_CTH1d% 4HР@ٲ`Š ->p#F?j(ǐ$GLYr%J'_x ;w,9&OK=o y0!PXB ŠzѨRzu(Ӥ^~ ۴جe *DDdEuiܹv徥{.׺o*xp_CU*UFKJ8VN'?9Uq~*Ζ/DhpR@6TF̭7+Ԩ(۶T7#?nsɡ7ARiݴڥ.~oߞSzumhXY X% Vbn ^nQHwUh^1a]Ac B~$8wg/ ~3GٸQM9VA|EPם=]LMVDąRp'\S,Pm iXeIi emy5V@dh&YeA~:S=%")]>Ԇ{u`}~a ؇^8[}}b^5Yu!*ayff*d?q@A~H%\k wv LMƚna\JdۊP]-Q%fd-)nEU.' [oHrtg6cn졞5|0WR8qG(_pu\q bDz#8RumZ>=9 MPl f R^Ap&SA}pg:F@Of'_ w"AJEimrzh>e-Zҗc7өH؎CEtث4C#>1zD>|!{2$i{Px;Qu{1x,Sfǹd A$(9?rtR"0apaz]g0cꙊѹr69!W5Ox##[WytZgK $n_ZJ/0-Ml+w8tLNg|f̘h-gb Mv貸@"fLQ ŚKLST話%&Ú3[hƳ~D*PE)",}&j4Q:~)IKjғ4*])K[җ42)Mkjӛ4:)O{ӟ5B*Qjԣ"5J]*SԧB5R*Ujիb5Z*Wկ5b+Yjֳ5j]+[ַ5r+]j׻z5^I~_K*ؑ} b+idR)leYǂ+i*"v}iOYԺ}li[ խm{mLaKWUp=\BWea+v.quk\Ɩl/yՆ6.ckWu]ϋ׿5/w;XMeËZ.y!{_.׷epinl~ _6ƯpkYw v);V].[}";>q]{cx ָ]|\;ٶVV1kwb6mSp3/|YZ>l.]lav{phAfh_=9u k1%>Ө4[=g&ղ5km[:׺5{_[!!,@   !$*.;@FGGGHHHHQH[HXHMLMa Yan%v+z0@MTTTTTTTTTUUUUmUlUlUlUlVqY}~[qZmXlXmuZllUllUklUklUklUkkUkkUjjVjjWiiWjTWkHUkHUkHUmHUnHUmHUkHUkGUkGUL(UH$UH$UH$TH$TH$UG$UG$UG$UE$T4$T&$T$$T$$T$$T$$T''L+,F24A9?G6BL5EP9EN>CHACGCCHFFQGGTGGTGGTGGTGGTGHTHITITTH\TGdTGiTGjTGkTGlTGmTGsTG{TGTETDTEXH]IkKx}LoMhLcP`Y_d`jak`kdkjkkkkkklklklk|klllllllllmpyͷԵ״״ششܸʪ֪תתتتت٪تتتتتتܪتتتتٮۻ׺׵״մH*TȦÇQC 1bÉ9$)qbɐ$SɱdJ/)^lr"9\̩'K1td&ʓ%3LPjD#JZU^ѳJ2şlĝiцE-e/QFuoaxobƏ/<)S3k̹ϠA\Z^K`ȺѰIb۲sǮOQ'٬#tDz[,W1u]WXE9R6<DI7=/~><\ھ ~'_h 70C 2qԑRA1хRdbLFo=Q4QU"Y 0U!L=AX:ZeGrVUk(Ґ#Pe_%DZFVYY*(fdr9 +#¸Y]xj95gm8zhDO,֜~čYֹRp|nGݨavQ]zFyޢ 'J>k~[f8dQ!70Ц.#مNmȭ&tӹhD"nM#QH5J8~RZt4VFJ$lUdID<9ܕ,fea| k!i +4Ѐ gG!džw ~E!j 4"4PhX͍xz{"ZӦf]w^VkD뵇ܼZqM&,^ K& 2N;d|&$շfƚs(`n'n#mNEVD.idʼnIBzJ5RIlfoWhbWҼϳvG)Sgg # i+5|_}H6.b9U :֚4*-lRLU,bS^D88z[bbƦ? 0 gU([80P7P&]P 1[H0ǭ0pĊ€@BKu; -d)ۻ\S7&QXA,@ {u$% X GRl\H-wEL؟1Qu4~x rC;cfDlpRL l <Ւ/aȁj@^ꡗt@)L 4-_ɫl@ُ1$Wk7?mX*B3^iP!%v⑐W4JH,m)JBC)'@;N0q70ԁTVAYr&a|a0{m;zzs +7ZYV׎r@[)-ba! Az@0܏bkj붺 MB=&RiO#b= d9{ʘFa!|wFh-mjb(y=|^dm" #mbKfKwEviSգ1^’+2%nuYN fe%WN8{ZҝMBr֜; U61Ԥ;dgbSZЩ⧒& f fם\R D3 MDˁ!%Y-j0]Bt\7Moq$5PBo sO'M'@t%mP"y]z|Ǘbpag_ñ2KT`Mk$&4^1CheٵV M,V'l𫲯XƺXOX:N:Wր"ƭA}Lh(>o}Ksj69` G|3rS/+B6Kw`Z"p -;s)<SCki,{,D_c$tYsZF06ѱN(VT$ZC#ÆG&I V(f\}*J mA2ܴf!bV!5p [0XEYjezt)>MFdpSS;ɱX;Nma!?V{Q7%f),5\zNF06hu]h>Vic}GK@W58TozNNxO!qxQQ, "'38r8y rIb!!rI[,kgc5]7{`Wve\ȥm$Rs5(4[0G/(ne;vdma[+!pƗXQI`+'aw!G^d]R cN>S!vRio>9=ijH DЀ r|<<'7 MbDX7)ycA7umwz5{+1Fcd! VkIO'@űym4R6Jmq0hBBvwIv>v!gnGz,T-S)NqOw&7 [HyY ,Hȅ\Kr$D"Gi99]"Rsf 1I#AvER& Swk |))e.Uuz6@)TubNiju'Kw5TUxcie?uue XXy[9'9 6}f4߁6Qy ! b 4GqcFW{?dCWIW^dz.7~X)WSb>g#g8IpwotH9W$vBH(1}zV%4"J x鈜ـG3A$e[1^q" {܉Tg!AJR~:;ڙZmJfJf=q0rL E2?L/-ךJCy<=<`giڪS'S! 3=pYaq~3jdO#@iTO7/u*+A :fE/H76thmmfѓ*fCqSpBEFO})q7p1[h)+0h%`F'wBVAYK"hefR3d;w Óev{w#S"I+JM7_ Gv *Ho14I:x'U"JIk0( {v. nF(0~toÈ{}ЫT9 p fAl#&"BwX+=v V(+O4|Rn8BCIQ-j-K#ukbGcuS4EqRm<|j;:Rs~4117bw6%7.lj6J6Nk#p lAkIA 0ݮM32, 400UBb^(()|ZH|b߮U5!4 -A˘BJ.Q7׽+s9 4{tՎeT}YL),7$Oe8ef ,BX!9-6r:L##a.7u\qJٜlusD]Vm(w@N*XWʷRQ#)za;FRG!9rԌFLnsьOdNER>^D,^.Mz|Z׸VX]wV!?V7yz1ŽBXa'9Q@H׽ē0Ʉ#pD6SS*]82,:T6-;f {n.sg# fHѯ.$ 5:@_ښEnvnD)6ɊMlS' 甫I:e˪-$IWp/0q4?Wz]A62G{:`)te?Z0x5ǀ5x-!׬G/SHNZS@Bڑ#@7YitvTQ69``s8c#-2L $;vL&J$#C$+[j$1GFGr!  ,:)[K*%i"*URE%j,hƘ̞EVe@Fk=} 6dBTU&xpMNQ?`Q1₎H.DfA: 6wpM/ٮb[beCT͙5w6xHȶ9xcI\!(쾛 r#_4$5űQW tƳitq'oM?X*ZRp 2 7A ,\J'.8Bն5`*Eě#_Z1҆R#zNjX20qR r~ ° ,cL9-\FrR$92C%@Zȑ$c/m* Fc# s d:$+-}4&:Ciz 8 A2fxT28PǍOIS(ݍ3c-ҁ1ʎgId3IX쥁JHA[/ؾMm3 -ۄl[7P23̿5d<7$Xهc X*KJVD̾1 7`K6,?kQ51uWiNjvQ ]yUuA uQvt9bcN˱[GGG+0h2\j]4QFm[G^TF%RA%ҪThXWo.ۑ ku"r%9B#DKbƪRJ[jIJ[sK[sQtyBD@ HGPA@ugfLS(:NyqT "3h+Ocط`&Njٓif!'pH@Ӳ٦ 9Jr8"}1 M ;̝,,yb8!uСV8gҞ:4-d)3g/NS:LFm.C\ 6|H8I0<:F9Қ_Fx$& )7(e͎Y *[8Mv!DS/%T! xW͉eIb"I.^֐5jn:fk2ԅ d4^ HXHce#F,fY5q  y$#=]@ .;o2&ii(c9E9$@ϔG3W\A%Bߐn8\>}FA#ZK!PD'#4 )xϪWeRҶօ/caO&k,ԊD(8ebNLv Hm Q3'8Q)S!?F "bfNg«DbijVQ歏TH]nWBHk)IIRμY `ʶ1INRtEV_U|-vyՅv5)_ /ʿ`g#Q2<ٕ^2 qLHM 1*>pv"l$H1%t_(ƍyTwZRѩM`ؔ;5O(ز /EPFțf f9 r 3P'N/,qi=UXf κ4qqYvU) V;l섘./8}FwV"HX]Vq̭󟔂 f $6})ꊩMkp8Qft0+!x+T#RY@RfKt-ň0: ,B VCPڀFNCK:ec:msH7PGґ6cm e =oBSFv#Y^%0)hqK分,Ow Fbu R iĊT%,>VK$OV~Ir*klb 2s{\9XL)Z;bW-h(3899m,Ax{;I4u}uW8kK?t-SWܠ5D^-jIue._uq>$_Fm/szIR"t\J)OThui.F\ێV1 `.3h&`L8Z{icᅬeKIUsWA m=S=myj;@t'ktؐ32q7!]H9 跇8y,7S=P 8S_J$0@ ~۪{( 7B  B.)ߘ IB<ő1ꐖ *T9O@H[!T%JB h P/,),Ɉ){C &2jP20r2,r u*'qz'JD#SNC8أ<ؓ/n 4?ӭ _íN:gAS<,*3B Fȃ =pu+g**ۗŠڏF3(&);ʁZ ) 2GP4)(׀ښoAINbn׳!ydHAH08n@@C(%db3lar\ y 7nC 쪟5(KB+ 뀪+2 ' @ BJq |h8Ȅx9hy CłE#D.D"yKBˁL,)FVܪ˛*:z+sLܝ$͔: iD[bTL&GáX9Գ0II3̩$ à}`)D3֫6hK_jaf .9\׋iʠǴۭT\l= Ba̳ђ@cECSF {7# \gr  ;)!iS ;YճRT.sߵ,ػN[[sEFܻ]pҋ+Ȥ t(KyO5yʌ@ %`)C׸з-AHrh N PT(Pp :iͨ"N( zrP.:/CPƘ˥ɢŮZDwI {=9+PSD7 yD| ;=zH),SJ'c>{7K.ȼ]%-X?cKdŶ5I]2)9\K0Jƭ(CH4`n(HCB .X|Ke\A<[daV2!=X*2V2ӝ5{ݬ-PeZ៮Kǚ{3K PcT!:kHΆS蚒fs)uVI)~X}RU):X+Q&ݿ+o{MOk aՌ 4FՅ"DPt^@$c1yүė8R}'*9W`e2 H TƏbR666jc%ՙh`I=W"U*AA+K) GI,=2{}Q* 5  cF7L<I&P `;1<帋8"mJ 5fd=鉉h!4Ztա*ա8 8X*)<~;JD/d! 1!]J{Ef80}ɈĨ}2$™Z5#b[8Cp j"^Ql\bb:bV cL>+\W¾Zzca5ގz 쌅t ~ R;0#@6`,? 5B,H+ű#l̽jkDw8aܰѬp[Rv iZ@>CZ%VdffiHiԉlf#AhZo5}P UU7YR8 G?%/:Hzd(/ُ? ڠWnj p)Nb졸T=Z?ADER IɅ{CUNX= z'+1qL'DxVJ5d/m빍[Q&3KCp#j-Bq}|J.~!X))'&DOS:,&qm|g:k Zˣh6`A KYR߲fu\caY\ff~-S&mWبu:lZ]&m'H6IIx$H ʼn+y@G ,CBbDɄx&8/yTPgzC!&z!O}:(Uj'uf0qGdžuprۿ )$Шa|w`$hUtM+BXhN)OH} j0pB-p_jż<c_,`-Ec9SIiԚ^&RHSrbkwQDXf%i)e0ifRhF7\V]O%w)D%Si]($o !W.HQcrrj xx&P_#C]xX}R\J4qD$d 7}a lj"OũIPR^+ * ݅-՛'>WsIs@;P2y~+L]{b\^M6Ci_%{T%IIEIU7~F᠊*bʴWn0"+VIa[-Uh@ Xi}s]6:zi^X(jvm;x)՚)'TWw6Du H̓䑿Ze@d,`qzbifc7~[h;oDVW#ڂ(.>RGU2Uf\&%|nvel`{bɉfAkm1,Zq"Ԉ †(8}ch+\H@OtIa9Ur>>HrJoI$15㡢 IR_KAl:{LaH"@Ć+2Nfx'IکOjU"d.#AgV1zu.)O}3I f4I|)N,d%⠠j"ɝLa){ \l|j1 0CXQN&™:0br %!\ \I|]δ6޶"1J b&l{BSeo *Bƒ/ׁ'Jၮu\w1RHc020d7y'E-uKlQdWYr톙زd5>Gha:=$X'nᙖ@QOJV{bthod}mG$8HDZ:I@+Pg$nȑ޹ m/T ccEҒ57)V#3=Ksz_w_P5 1;oBPעHM6'?jVTe3(ZՕ#RҘ4V -¤[`qqptI RzTa:,Y/m*S (YYUvQ3t%ԧq} 1ԉRFdu 3iL,V X'm!}7)lC 6lZk=4*hԪ-m8P<!hF,qF<-lSDtvxɧ1v)iC[ƩRi-^OXA%vtZ%~i9CM\DRd'HKuY,-q-K$I7ײȻi+/N9cUV-[@ЉDq5w̞sAb>9Ʉ@Z7_T`SDHͬG,X!MدĔ<aY㕇xa֯AQQEG ᡔ dt ISdKSq[DJt޷ 6ZPKSA&UMr̛X[Q04mxLWKأh``-AyƏԡ> 芣,qԀqT(-]FN=A@,FaTnd~ !MmG[nVP^:jyx`x ̀|boC<`{7L 4䠮44CLO8WZ b$DI QqX_ 4@ v%d~ W5`OD!%a,\T\jTh"}J VhHY5čR#~7mB}d6#5LṌKdbHPc' aW]cn$R)MQC\_8ݒEGN,IUM4ND`=>` Ze>$5L`'1vOQF|Iqb7 0L}ɬ'n!ϭizң@NQ( ,mAA]@ pGapjGz؂cR-N<`#ufݩʶ]dNRI(vGLfގ,$ {MGɃmTn,JYUC)˲炛6ҤH p*X@8F}t)DBY^.M< oGj(cD,XYIHh >f-R ,JNzױ"lcʭ%-8L9BK'!|I^r B - @Ir(9u%/[_ ǩo^gBNlPĄhN M^R֔rfwV8"X^fVh s?)ꂉzL&kAœAV֊Pab'c@BDpڎ0 ض>lh#(pE|IzJLYP@Qo&1T]nYJXtO\aZ3-,#rTN0PnFڋ4)QI: 2XY~-md4k^G$5I*.;‚#q;%ofi,Kd 4ZQVr{n[*6#h<oqc@/fX'dž X3蠟1q!sVj޾xPb3_0hDhc:{g sƄKΙbk튀ђTsGHpVCSAqk/y ^>zׅ5_4+BI@ "uVq/H4ne-0̞]uR_4dj ŬQ5"G1fFgJ_YٟD $ DUʪ͕L³gsϐU(`36c3f_tџFC9Ao)x:#%h[@팋1a.3N #fBe-lp wiz`܃$-+07L\F-ƍ½zs+{ӷش]b~)! ?S2c+B?{i0f("Xc?;iCVZi^fH\UL^lS&ƐMHI>O8%ȭ/dLfsf{h;i;ڻKIC <*?6Fv1ιHFQHgqۗt_1DeO*) j٢1EoBfD1`bz1}{?#0񘜝wBrKյ|teO#^()*{}ߴWOp/Wư=}ZzCdǏ&_幃o*(V*Z! d kKAR**q"jo?X\a ݠ<83Lzm4 H&bY ǃ*%_o-S3 mzА2FW)'{(j5UƠM݀s!3"PVTX֐U﮿9Sc +<CL/jФ[ʊ и|MFDX$x6YjdWg8D1Sm6v$Cw.澑sY>Gcl ,9<s@_K*+J$\PPQ8&`:I?=RzT֞Y2e%+Y9"HH7ʅLKLKN<)' TuCVD̟d[yF݂z؅PQ[ ؆5*l}BiS 2%h[ VGF eYDw1QR1II1c0%ɬxi49I{  !Ll:InJ'zbRx^8a,6$"]2`a|"+( d< 3BɎ +}P1kÍx@#|;ʕnFآkնUڀ Ostʨf"r/MEUj8hrM-h\%*d݄]##J:)T#Ǫ+#Y,FB'QHʍ+=E̔TuiPr JȀIhr +)GД&th鑴6.Ǟ%.Ns~4j~I %(f(q9c[wAYP~_NzkaJʼ{R詙zǕH4A7kEǡ܂))A_eN c۔sS&f.l8-|R#UqZT1K=H(HI%mX]֪4y*XQi|Yic7*XAD>#VӶ~+"FMyf^yBBH@ rqc/5/8{fӦ!is0xp ?¶]å#0mtMۢJeٹȝ27"~/覑}V8 -\ '1DH Ɓp*,F8^.j֒!\PF}wr9y02/\baxF^TOE3&4kYuVui785]|zK)83wZ*T"`ksr OtR,jRΥQ¨_fbbvAhh*-j^lGPOǢζMvx$ Ld0BP40ܮ~>Ы IMAn 1/ODEdB۲BݲI=&&FE kl,Nڨ&Qn&jP)Jm-"PNd $ᾈ珶n#M*RK:m7G,@&*ZJfvnXQlG+hG{.,d2Lg^Q\qc :JGnn#*ȍ.0Lǎ2GhB0" VPZZI0\  cJbd2v'Ҩ{B" /nJˆ&B&jl" qݢ?PIM"'$Y)-?l"nC1&_d.RQjE$Te4訣IP\f2>K&2iƒ*|'7ӱiSPt"v()2/(BD/(ֲⓚL0T#ڞ2mO>H$SʎRst"Kr S %R6}dbb*L$otEH_LL-g`R(%6 Vd (;&~N?H8IJ<'#"q[6qq>q/@Z NO?QQ 0(5*#Prx "2)9/0UB@=%CčX$M4'.4QAb֠APpfBkSLh\i [#)l\p&,),86T#2AG>N$'Bn;l2iSM #$.2k*_2jSsQP34Y3!%\72Vp@_m/H&Qw٥~11U1+ e*0a֞-'m(//M?9 G%cC'6K$iuHOr3+)V**aZr_saOBuhh" CiB^5ⱦ\%UHh+ l>d埊IGB ELPvHH#e $Tr/t *ot(jAL!$R6zp>F>s1a9׳|hEtbbk=倒 of*u~;z /*L6'mS;+6/p2mLhk,Wn9/zԨQ "t:5`iA'o-k-z>Z R('VR P -+$܈'7'ZA~]t#- d7vJL[p*%GF0D&XLqd$|'MyRu&w?SNG#(^S&dXRcbMV8j06:o\@;lMh&w81+vDpMJTMx>Vk{ц0,.D.E5X&o2s1NEiXyQSbDMVRX$S=y'lB`x^J^PԀ{+PYWؠR}"sO5b^8 R/E⡎!#9ROC2*IVV\03" JըبLUjeӹ.2ZzhtRTBx(%d-&487|}u .%xǦ2 B' WAPeJK?ҊEbc7!C6M a3X*q:ssx*c8pBDB_5 !wzdFx d*#a&o{XzJT(FnD'3Tg~ئw#S3#&#pͤa"W>Avt=޳ A-7ee}W,e|~*tmh"An+CS"(A8NF2{S~yYF5ep`Bl.L!ĆsL1Lj+z&H6IHB1J,O|R%I0_J,Y3E:{(A3r<2K.*=$ͳVu +Q&hYiuk+]cngo?/<֯ˍ[ri}__~.wDVM^~=_Mv}J(4] 4GQ&@H@#Hs9G#o5XfA=őAMvMFL;Sd-4Md8)%$k^ZOUņzUL,#tȖGk8]\}cQ#hU=xcCifJi ̜hYC&ƙfkuYBb%t*D9gZ)r"#q "hr.5WQzũw5UbX.|fr}m4Wm~XUK;*@Ig^Uv[|%_]l_] ' w]i24ҧ)VU@qC ,"6k$RQ7195OR$iJ2ZMy"e{n0+TuW HHge+9 0Z=Yfjt`}XJ2VJ)dI-@)$iԥOΪI`m]d2ȖWޫP"gc3z~ BBynzZޅ1#/ԗ妞qhG46JvCl`A>_8= O14$5f[ց i7C_ÏHq*Jq? 0IsiBIVJ\ %Y4D4lT;DkN/I6Mkz4bSeק4 )@Bl#VK !( f2a~["0q!A֤E-jZy^#)HT$cov`W-F<`R|ItA r[X땭H)ggT18ihVTV-xM1g .)& 5id9"B HS2  $ie4Q4=0ϴ𳦮DQ-ke<ب8cK*RD1("81{aho^Aԋ;(܇,TN"KDGZؚHFue,D#R!něqdG+YHl+8ie0Ƣ|$\ ?b_*̰del-V2Iei*o-?*4)$L 0m*'$mpBK OdVT,Cs R4Qeg=N#Z^P}kVS.7_N%G6hNͲKϸՉalwjdYsBvYG]DV]gu`SA":"VNQX#[(ng@sW738%tsTwжcw]'xbq% =| رFГ.&ep{ 5p=UuT4-cw:JΔRqиp1*)9`x(I|P8|fVKc(|tVIͷ|l 9|XWAG37/MDp)Sd2cJ6 7\4l8#WVBkP{aǎG'<{Wo(Uo]xH]gIؒa" TQuRF{3Rd9XHBN;n&,80،%F;Ţwn2 g1w*vS7Vj[xu0Av#KaxsUC be6v(I~ m]LSas9>گ~:Dqv&Zj'dHcԆ~ujz EJjdgs Ӆc媕1SwGq!>G%ĈO#RkJVrZoZkj?{Ye+5s\dƀ꙰;|m;jQ+:bфIה!Gy[Fn3UOx":mOQ{ $kĨhj8N#:xn魂{^ZG8U`eѻ < a1L\V2hiW+nsbDk;2n[4TWzȲQkW)%GB{3fniw鉔`,8^~|"e *Ÿ`ÙyZEaൔ-[V,&ޥa!r-Tno$ND܃]milKνf{9;JP[ oMhn2E ^ʱ\L>j!dVޚd-kmnT$KnӥN ঞ *k%;Hy%޼ 37.pqw!u jv67uo|>+<jsԤNmg>߲#ր۱ XHB.>K%yc]ې>d!*J.MB Q̄n>"F;.%/ʬ|,[ ϋE,\lՕڴ=3/o%<<ynC9"ںmZ*~w.>,E{\1MǝG @/A1pȭQlrdTXA#:\hCIrGEb$ɓ Ud(A @&]3F΢Izu׵g]{֕+.'ܼ#w{׊wXIrJ<6BJ)A j #L* '6H;⌘hh դ%oMd|2%%9-lO#ҤR?np#؈hJ&R`؏ Yhº5Pr"=f$NIu;Ʋ<@rKH{ҥ)K^29$7HC8&&$P_8q} š|R8v}}Kv)p,[b HX3= ycc{z!$iIh8{}vXVuUe]ǍXo!4YcQMr؛Q;K_)}$C rx;nJrpK i.K8_4a0<{ G#ּ_ĪQ` G T*ʍ}~) ˥"|bU*:xa*:B.6jܪD)NF-+ֹXi;YR(iEsDkr!1BXLrphFz?A$H3 jh+ Ӱ T;%9ea`Z,tv<7$!A ?%9+Y"!>YMJ2kfa3\ۺZx>i"ljZZ=-, J}0z3+?5Qe(k k%fօwud iRnu~i[F5'䳍K?‘TcN\IO^U[U7̅HvceQJn>$2&'ߛ܏ͯ5ӔOj46\H4Į3wh2h̊ucEHXIA B=:cﮟ}4=i"qߌR;k?HT%IRe $ ܗ31) 6uY+eCՅFrُ5ٽq=5P1u]G0k~}oG\x_7# 3m~7W`ׄY>k^0+> ޛޅaCq9m9O綴mӍ*U=q/HAr* %ݵUSAƄquM#H.,ƥqcŐ[NnZs뇹bhSEFCO6'2*Ç=w/嫈=SSc>C]_{mǾU6d5zͱz+h/0HR3/sŔ!NfMn6-i~0P }x!^H ?I K -ܱH32p/ڱ5#pVr*!*A\+=N;|q=I:(FI*%,q$3U:7'L7I\] 8ʈI8S}ӝ7msF6UtKF԰89dQ:n\8u$tduSs@y-Jȏpy)F=ҦU8s>d=KFL.:X=/s).:z6He#/3!\;kR"6 0:\/~"+ "o<ôM;<"84COSc`;;T09XI, {9ʧ[2.EDQH5DtiȋN̪J3[{Ho*ldL⍓Ej3; [KPPF1)!0F Jz+Ŀβ UtU׸ ͋˻<, 'ԧa҅b-UD"$L=/!ҌI38SԪ V5S0I. N,G+fI(|#V 4?$XSLYQM? sWSR]l[U[BXmz[kא3qObl%8e\ӓ+5D,Z؁Z=Wt5i# p&J@S1?6\y; |emGl |ڇT[XmSX"mBYuhH8yYDS?__Tٞ}=;ZVR Q^ ]Ǭ^3 UaUU F*_0} `>e^[V[a36-Q ,-R\K ChĔ~s*ؗ)<ีp=]'u]t=JZa ɷ cF# 4P$b<,N34,m^u>rEGإa5[E੩Ga$R ."IzYPdV˽_-DߛV;6`S>>E.ZNSBe_]*Yc՞O 0j9&f8eԶ8J*ZhR^.fQf^8%ff.՛0D pITYW(&e:FbDɽK_/k"nM-U"O fPec%ne P~*bg­/UO{фlޘɍ`'C؁ d6}!j)Ms YOjH|'H05=dLmWc/{k0q٫`^#14&9˅/U^>ޕvN\0XRK\M>.N]9Qžd eX>Q-&N6X~k k&o { Jԯ&m+Ե- Pi?llǎqqzR3d&)fzYh'O%[oLܪվQ#P|΢V>;r _>,eviJ1^@r-h&i6pgQ izczoq̆wsftr_ %'$NV`C7nf(,hg{Xwykgw,vX7s|Zzw}seĢal|!g<'C,|13|AeϷ>tFwF7ǯ g%( b*ͷ7wuWjwyVoydwͼ]!fz*~KʼnOz~_nmg\BvT}ֵ+=yomgUޥ7i`#p("L`FĂ/Z!ŋ?z i l$L)ʁ(_LRʚ3a$I6 IfˢA>JtOLyiê >jS]:I(TP&iZmDкJikwݾv,)$ɋiPb4~afuu`d7c괧hҘMcJy4ҭ5~mګo)pٯAG¯fN [9Ό=rΥO\cޟH߻6V/[tF_~=c6d}sJXdZT 'WQ8UՕ!b ~IQ"yԢw5[hV#f]5;#U棐kɚ񖛓[g=\YuVT"dl\HDЖci^P-!Qz%Yg'KEOXYNtDyyw/٘zWk!Oajڀ|0rWjW|sL#ⅱ""jd=ٲx(x`W. C?duSDEILL)MXI׎3BUnSi~/ (2POx.h'Υt?JWx' 9mwd?;.uң~;y~&~uE;sˇ<5#ͫny{l7SG?Jv~ў}5.*G{%~_?}`"`*2`:B`J!!,@kkUkkUllUllUmoZmUmLoBs9y@RTTTTTTTTTTtTlTlTkTjT}YTlHTlHTnHToHTnHTlHTlHTjFSNBFD>@>:;1/0(&&   ,26<FGGEGGHHHHHHHK`NfMgRf\f`db_d XhSoMr1HrEHyOH{RHtTGlTGjTGbTGFTG%TG$TG$TG$TJ$TG$TG$TF$T6$T%$T$$T$$T$$T$$T$'T&+T25TGGTGGTGGTGGTHHTIITHHTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTLL_SUp\`bhanZmViVd_fgiknkrktkpklkkkkkkkil^l[m\ubgkllllllrĠ԰׳׳׳״״״״׵׻ŪЪתתתتتتتتتتتتتتتڪتת׫ղ̻Ӵ״׵׻oH*TC5AFTshE1N0LJ-hH&SF˒+a|GD洸8 (2hCjTyàBM:4cC"dЅ$i䅬hJ;Bŷn/:Ybѧ KX*ȍ VD(!XMa҆}r(obR'25[c17 <^ p!qXO" we!otiRW%BعU/<`VUJh$3a '@.G(%a2- #o(}ǁXcHsm565R+hupOի^s彤{њ6%'[%8 *C9uKP oVUF'KӦ;%(!̕8\ӓu'U$ I}IW_|nn.H'c o}sϲ1 dft}6d(~ZoZoϧovP\ZJ26"BF͇TTor&=YO醫B*z+hFfC'@V6gY郅>hYK t$x *//yt:i057Җ0P)s< 'Pޡ$-mBǐ%DbEijP}*#Ͼl^ 0 Xz%4TTY)PDc{3)VeՠNsC5 +])K6 '"Dl؜ne,q2k& iz>Y Ll i6R\vz lJ\ -Hn:rkUK6Ž$/2RQ%}u]zLjߍkK^%x6'S* Oխֆ,_!+R, XlBǜWxdմVҬej{N 9ŷAݒt0Ro~6",Dx WG0l!2/yD%I/u}r`6dqF"JkHRa!U㚔KWW#<. _;T u_ P.&(1,|3= jRƓDy ͖7Da|x !93Bϊэt}ؕY7if/(iI*" ,Vэ ;NGCRsCEtLR|KD)F2*Qar}o$צJyEo%@3_6}Z}m8W#N^.dl?aWp\-4ؔSYᨍhʽcj\xP~|<'3P5m z917Yb'$uC8cus!W[@W5ect9qߖ9p{5:p>l!O\yP$x2:fuhG!2$6if^Vr>:_`aOBvA|2=$"bJ~wHes>e3!10WUj`HGr#yPz@y_ IFl_HOSkEQz&E6m>ݶ Ȃg,x5,؂C?D#Og64|G)zS}i4bpwO,L97愳6<H#q8[B[e75g2r+sf@42FqWO#Y 1P7 FtOҎf=W-A 'q@9&"9py%؉84ƒ0 I1U~Y1VEgAJadD;?4N#fV.RB/+A4!F<ae%^D1 Chreڥ}Tx=M7IgO$ݨkIRS<"mz#HzAzx2bYhU JdbQ{5K;pv{>}laQ7i%XqG~FAZSruoG}ɋ}O8pi4)xwS4/ja)enak=s5'f ҕ(fP@'Y=&O!l  o{Y+g5PK~4(P$Ej 5]P98yah!_PpLק}%i,u"62 H)*Y|v^w/!E…J6wA26TTVEڑvry`fBHiyk*Oh; Rʼn '{Yie7Y Dbr_nxdø晐"jvotAi)š&)A _p6 2^/8~W}BXs55THZsC "Y:7r,lh OGBlPxB tJ'}y'x{^IS"{#u%]]^tSQa'#PLAʧ1J0P%&i;kiIx6r)n6zNkةWUxm `uEA!'3& yXiƪ r|Q\)fZ(yU,uLJZ_@W$-qᱧ79E{*n@6hbuBtc/uArEeI["pnzBS2RYracCصo : D8ZiP6ǚb}CQwTcaw!"rE)rOxj\%I/im!Wthu3 '6 E"b#ayPAi:ʣU~yU{Qּ [E8!{ZiJJ},+v-e*Y jA&}יA|h6N4Vb!P$eYMPMXk8Clss|@7a62hq=hfHV\"ú 9QJQk}ېi\{/s!_YwI#Oi!F_{؄$sA2?ƨHUV:6$A8pQA$,ғSQWWf"H5EIULk`ټK{3JymPK7K'#7&[R/DW Q}cE7(g/A'_b r᲎ dm'ȑ~n1 5VXA,dSƌYdpg{׵n&DFD[!۞CMY:v'e*ˑVvK\pTu:N wͥbS I E CCNfg)O9;SU~K A(mp!ǗDFuA'D$@9'<+)|@rE'{YWVCK]?T i5˒Ac,*$$/A[AQ KޛJ>|J{tXMq&9ZeX?O37"ߕ+d8^u)&y! $MTzP#djv'sfNddcd=Sٲ*$GlՏ84-t!\uuTT\;qĄOƫǓFyh(/"!A@b_̓vfA8%cTa#I1Ly4=_.φ="F6C F bݠ9&DV-Xl682E?\g1dU֙C@2A{څOTOKTGNKE8CǎVK5Rld,CWIi'e?~B_Ħ* #|?npY &Co'WtԵަ\Yqg"q$J#<,ؔ2cl8Ml1/f1a*2`E=5ŧ,wvIml2%c;zk0=],W-zHc2Wi7Uc|aM 2vQ&*4D?_ IX#[@ o`]agvɍ<:+9 t/@ b&3Y7.1lj?MxU#dT"5EV]Ŝ51VjݞLkIX¸Uƕ2YLK $$-pmz%8,B=t5WWPWu,-$m.mo9Wn¾rhλβh2%σ(ga.`ވtτԦNtϼ *}J~*RoX%8Y|`9%l ?ŜPG}a"`:0h29`I=1Ю@*iă 8*˻ e40WwL&7%.z2C@T]cE3TAL%H]g"M# 7>@oF!™KR!3.#t2+9:$0I\-FAF}̡Uk?>ć65d."Y$7=HxQ憑dɓF!C0h{^*7ͬA/ ]<$#{4K&+qICpɑTrJQy8)%.lR1UF*W\=zs\RT`IMɋZr0OL-!L@͐$'e4st~R'm- d|ƁQho*7t(pPEƈkE9ֽ Y1Ԓ6"r 10@VH8LC>O@3%R>ZA8ˤ%Y"UT;+şhnaϭo\7W)!HVLIF)nA*f% eEg{Pf_8/c*&]4UQ~׽*;5N 9^Ϊ-@T14I\S){d@%[ Au8UncSYMJy[sə5*N [ (lzeVY'@Ő$f([p8Iϡoۖyq ͨD8Pa)cچA_ϑ%_%&ͼ@7-ى ؝QO:+[XYmo$q)dƆPR: eX\bV kZ4E]c+Q 3 E_b S^MsF*"ѐE g𔍵r+׸ZCXB*Pѵ#|Rff;/)QH BsQPo_x,<]h/)QoP4z\4t7W}2ut 1 NB 2 l91'09MMd˾Ѫ `7bDЮlf] ʄ$xEb90!Jj"-(IHE4nRĂ Bi8q.Y&89qnA'O |cc 1M<ɽ# z@kcЬoTQK-TOBjHBB}4))1 P?~)-ȧ(]( ik c1u"D%SO=%Q.*T\;soUK"ax1w껈1vzPys78Tzyk @Қ8Ç|U |?X<cёUa B8x+ +9s JުQbB+9 NK+9ZᩣcY -ɬU2I#2ȍhՐ qŠ!Z")!)ЗJ, /*8:ݪҽsK B]h 3[ 1{Ei)3~'Ͱ \'9'^iEƐN{?[04hgKF꒥tYhx4㴹ډ‹%sD+kB% 5,zQ`Z.ө,B:)? 2Њx P+6Ǻ"xĘpXq6 6CGHS=Pၫt>k™8B) L壇 xAɉ[1JY:A>Q Dq0\(GdhTSCm,)v Z2œK+ ZjrK刎ClBO˒-u ̏jQxt+?4CMmԌ/m8>#DH:'2ٛ;,VBpTpڂF@=d{&>$ 7" ] B l<nj؜HP`;9w#Izξ˨8z,Q̼gTYXYH Z> H,YY"E$/ JŸ h13DіI߀SK5K9JB ?L\{ ]0/B;F4R*0%O4 PBL; IP#tBGDYr)År48 x,$0B{OB(x?"TH >ʢL F POitH ͑H:sڤ U+?ǝ sk, K0yF!| 086tO V6)yV QQY:5>rׅbR5,P(edltՃJ 4kI*ǸH1QȸPUZ+1"J- 1-Ɩ +Bþf# +Iҙ$J (p9  Iɘ%1D} AD1(П"?-KT򔾜ԲH>u)ʨ*r`QJx,(:Iߨʪ,I닜W2:%ˡ PrCns%)B]=AP!4ڬq*[\Ss4(4BԆa͒ *12PZ`:*yX=ӽ x&zṷQ( u!S,C,ѭG5_k9i r>?յ?3ƒ13J`1x-P @Ѕ8̍-8 m)?p缒y(3͞0[OW@κR, ;SKQB0}O.lh>XNȹd3ݺOZH qn2|;L"LQuDEXmda8)ɟۓIqҜ$ +ҽ!*'$+*mJT;Na)SŲE;*eQqb#5Hh=^LOxBDZLZZޡSI@hb9]inXcG]h܄^OP;k:(:Y3cg܉'1σqR~.Vfp,$ؒ߁Rc 5%(;WeWؗs{Um}tku )- &_(fD]`9S= )%㪨fc& s!εI) *KY'(K0i1#R  &e"T8 f՘@P1ЮQ/Uӏ*oY i!JZe2ԤѸdm׸VIQփfMq`smFW՞6q!GHsB9DL+)8V_H2y@&2NB."nIY;t7WO;N4V)'ymb OVQ'&ݦɤB4&+gۛ?ui؍pˋXU9s6L 'pr]J7Bx䀅X^K>Z}ZHGB̴L0K-d.(Zp m}a+~9ƺX+w:-TV8De@pّcyWhMptKO'c3 2?g)1!6.Z)גΧKt$ KGSi\l,o5t||UmM$i6t׆4B:`N&Hq]x W̉rvoɎА`a` znr/LlY/*yH J%T wy!rw- --e D :!\,l9oUJyz,-VШYby8?DP?fm5 K>?xw~77T:AY%~|xȈNٶ"N.XT !c3>a҈Q^d'Q)CSmo,cf ԦM@f5jԀbŌ7jTá#ǐZ-]#T3ᡐՐt8E:;~'П?g RCyhSNEr1ʕb1d̈JG0=miתUkYA>8rʴ7^+cԯxLĊ_ +Ҋ,6 du0_ @,L\"Yj _ _3hH>ļ8x{xm5v\, 4_rПgz[^jDmQ*%F]~Z}'8mDa_]S~`K ,jBA$\Y4axI:TNVQvXy1z5d<$myf pGsag}S_.C6R4pfeqpi)QMd}?uIXwz IM7Hy6`by}5[hFWq"I)uC] h^ B=TXAe `%iD)=xgtEA'J]w\] 'UT,;Q);EfY&LvHKiƐQIyՆGflڞnaf8 d {[~*Y EW_MWջbħ`qmWE,y%~dJ!-ywrp[@EQ n`If[feB}rGy4rQFٟE3Q*(JGѣ<,}%uC>*M%7n-jx.c t%oq+%s_[VBhp61ԥ!M4R_޹HDiA0H*;z7~[U+$Ż6elZ iwZ:챊'٣-EmBuS_~$r>^C}nuRӛTb-G+U':&@ [p'z湐1DHz25=>g,[L *_̞"3 ŲLReV('XZZCߩ'ڀӴQ.ɒj-FIK&72l)9\HY@J#[QlT0G2Y@2ZPZ&Md$xHۖwEqY ҁqy!!Ϩp\JF'FѰ:ӏXp4a(gZJs4ff^a Q4ԒRHpu@7Y4B0 3$PUPcŹ:@ԕDY.h7Ԣ%*"AKA0-1q?8mFJLMZR*CzmG[کL^.(Oa\""@,Q\fqXBN0 k~n *}Q*?JHc"cTe(j!|:Cr&x7R/ r &S2r_`f i\@!! VRD!g ;XEM˸(c8IsD34LtY Qkئ/vDZ.xk {5uhQkY)%lA" #BQXA$Rwj]nՒ0$qUxJ%ɝ2SNw,^s)|G65<&~bUmlVJ*[Xˢ^;Ha.faׁCBF5s\J N+',%ڪg;^8;-mhAN| =`_5GVUbw\ߜӗ2A"F0l7uvnvri3ud8c?-MNQ?DRl>%RIS r)!Me\e5m#sf0dvif,c%ak4c4Ds}嫻٣}c^HǞTy؋z}nʥ:6}L^eŜKp)dO5ߧMuz|,CJJ:i &q䐋z%}?dà>EU٬aKW(`=NG#<EPѥ_e( AyMK܈WH-Rؕyĕ 6Lp̈6ddͻLQm9ĚLQMF8vDz̕(=CuLPIGWu}jXݭx] VtH0P!GAԎV4htп] LADbS19 .e-yFA'vq\ =CqI(MHZ*\@Qf[N,ZT/nPV1ִ e=htI:XOGF]P !L ҠHPј=H ]#ǡ͠@,!ZA \|aC@ Đk ӔD@cֱM1y$4{BtfK5MKƱƼ NC8Yت *҆($BL"Cn+d5!Ih! RLRք DMDX#Zijh$}BUeQNV^#0@VЗȮl᜜F-H\\6فfڶFĩ(:ΞUNLQu)Jo[pclrPa,fL aFd,dk4I7Ez *F{YЎ%Hi3XEcV?#\Dt!EŒJ#E}dmYA `ݪ>[ B7y.yDH!..]k p kHfHFrafqM-UAЦq11Zp+B %jɸnPK$,UZ b*+$[LP=[s=QDm=ǰ\OQ*jG6m8F$AAQP1ʜj>K,BfIpٝ4DSo^>fԶ&Lj  E! ⤜hO AaUPe6 CH R(}׏@UFLC!tm wKyL)nsQ9C0ɆH@/1.*G䶠ILz!뺮4*4MWU N`TNF]I ֵڃX "4\ÑsD&o2ٽ jQMʒQ6$|Z*I|EF$aEPrQo^)X2'63O$~"R( O\Ybh qHi 7Ri77Ȋf'.Q;Չd}WKlbn8g@ҘWJ~)IPi0r=eyaBRxYSױ0ӉuI\֮!^K Sö`$E%h gUҔ28b: D /itKx=IF{S©JPb\pA&<SA>T(guӟ| FYH?FxZ]+͈f:UM`Ħt0 F"Ce%X YlCdY,:h6[5b)8AҪʌ.HԹlc]ةEw)b :!"·"-C1 9y@öCYβWTJA$|u JJV&v$hGn%ߝdy 8pɸ$$MZ/)N"*,NQFȃ caX/dfZY#9j T*3f^%CCHYy+f*UhG"hqD?eCȩU01RףfG,g:}TG hxzԺԝKuI0C"/b+U}U!9D!9DC ja 7VFz{gPJO*kZWm Mނ*/+M8aGh !F=eBalpڭi]3Di$r&p6Nʉj+N|-n۬{Px&%R9.$\.z *d2.z݆kִ"揥jĎ6Nb^E(`"d DR0iSVaV IRH{ܞ qMg_s…g˺, *qH+Vnx#ɶ481%SG#*clg+ HmͭR-!i01$08'TFR0 #h 4tLtQȘ!1ر%h]jř砐sɰM8<NzxkVR&5hR"ȥi@2cvQL41' }`^8Q> i| pBV&]5\62,h"jp~mm!tnTm6uPzBHB"&8]]?4Ԍ r(Ų{,IjhadpP~mI98%Bx[6xG^G3J@R~]@KI/o:n9>x2;)~|F#0=f?Θ3<-ZHqD+!s[r5JJ#bR# hB.uwmWDv&k%Ifc>ШC"ĥ%wsm.v ֒"Pc{;JJ,T?םUSYpj1^p`TұjWZOy]Y+ťyUef?Ь I+Uw̼'H1Y9'G)o陻uYE&OHvdvgyO>%뮪*#b柼* 0֭T\nM0++I4-(vz?>Jj0ZEt6zJnet"8ޥvh0 ̲MVJj3J~pȨmے=iKb5ZjkP-TpڭԊ'ƬbB *kh {kT-DLឮ*R$G)FߪkJD2Ƃ oЏ iM$,Yڤ)HJPdN[k%h'Ey$ʶRh됑c$™Q "#&1>jA-S>ENe.;0.k<8Gow͏dŤ!1%&E ttM'&'\ (Mdbo-&]2| #_TjU)QSFĐvm; vfAf48HB$eEHVt#IVb!c"i'ftFS4A=5T"=[&[MA~4 3$!)z2ǺqS 9$br>L;]z&ll6ȂkpZP_"F*>KK0'R,ҳ?MK"Q!,b&M-EU*4DNs.qg^LO1JjPck;ºրUL.&L6h7/*]Hʌ = g5tP360up*,!u%lU˔SC/ S:F ^M)DP;_0B"8h$`|Kd!(UR*ua',Rh/ $ `s*O"M# 2 #t240.Vוo 4;& N/ QE=bJ?{h',G˥j4DxD 4FoIslGSV&V!_cKvј8TjI#VШaj&M TTO^2qheqfa@bOC,$A$bd+h"J0)t>atIVc? ;( p0qy2pS'duh/20h C;V䘈JbC9v||bE53~Xز GL;1~Ƿ37=WyPn;-q_yf'A8yJ/-BX)j^yڊN:Ǭ/ߥ尓pcUDX/,uG(‚ׂtBQIR}$$6q8u@/T&nDUE-\"XߒAavNrBtpW#?<y77HdK5`:0nmˣ@5~;*]iHmV@Ŝ*n_->nvZ1cq("9c*]5kqNoq#72MF}u[7ys0 'CQAF# uNR0#WokWv//Lý?Hуp{kM!DEw~KzU%FXXC;<*4~fkƽuZz~W0/L;#X\]P9-Bz!~טѸ3mCJ˜4ɘJD̸:.6vM懀 8erMDCD{;#rA{a-$+γ߼TCT/xӂEć5;\I3!L~T8ÉrFY{1yP&@b @Ѓ#6:7+2s(!yWŎؘ?@LaՕoӵj`.%kO{4r$^\]#ۯG7u.2]%c$I#Nh*5&*o\!͝P,±Yl{j8< *Y$AxfPG@6"HYԋ[䇎~ďn494%VSqԥZ1fZʁS ?]9caZħ̧-CH\żz8yZa0^|DG^et7C :IyE. sֽD&z4+֭Z&mtA5d:m;EL;kTH+b̽z-)ǃ~ <\b]2^ Ȕ'[9 /3FHx1ϒGpVͅ;ulcjn/-N8€ gw^)ژ[?Kox^QiMguO/=#v)۸%@h՟[EfZB26@yFA,DXe p"2h\ \vM5"*JA*X(:x8$^^$v,11\q;ƀD|#WP^u%Rq5S:Ƭ$OafmyZ`ٙ.͒΁jVH  _3iQo0ƔR6^⥉hX}a. J6r`k%Fkچ[\2_֗ʭ ϽF]Ƕ7 D8Z[@JexnzE[lEk e\p[&ZP]1ƠZbl醏"o5q4 <@yqiY敥6W]֘IwY1,D=oҹ, =@I*3*Tx؉:ךTu'gq,} sHؿGM!D]ppGӄٝjǫ,ҁK8}yWWx-:$ܖ&{k]2'[cmv{÷^zt+a JhouF?3pn܌i%;&b4=.',}5H/a?=AWІg&ImI#6Lb#5]spYF*A)s ɩ>]bҞYi4 lBzJ-i $ R$TT~BE1&8A^M}hnƣ k*q6ܭ@K,S1dhR,l!Vs6ֺPgy}fj.9d Xj"›V߀47r;nO%$JL #{!s`Q(S 클'7dYrRJ~Ბ$0C&)Ab^H QLa7=Cf~ ɢ6ƙ[aĻun,v*k@Slsx::9| 4 ?M` b 詘wzc5 I\l?zD+)-SZ ȘF z%)nڽ6H,#+ðT T$KX*ᖔ ),D6ʃ\#-!GgD?r捳#1 < O< lQZ[T61zHOF05 1"ysߤe+1fꙕll5:3q'$LY`68(( }6T(sll4lYp7B5pJn+y4q!Oǚ\22%$5'Ӗɚ 8\4k͔4u 16BD@[rSWf n6!K/zkh̔,05W=_"H \]JŌ}=6 eO\R(M͂s3,zG=MOmEw7lb+L+8qN&bp(6i/O*JΔzt̎fB(xD*f$62}ZnHQA3]H?]ThW ace3d AmJEcd'+%_X23W.[04-brY%qlډN\UA; m >mz1Η9.& d`)Z-dӫRC8֕ ]jl0a?"fBWj$M+.Tb:;׹tܕ jZSaa:9B 8U<`J T7D_Nq,۪A"7܌ޑU~Ⱥ8p]uqF/8ֶhѿ!wXI^h'ոMtC3lb4;͚J$C0aS[\?li{FT3fY_-وz28\m": {e̼Sх5T5/^;s *0'Vt}UdVg$]r'5R}'*[$ڪ@E_]aIn=tnkeo3EqQg1!mKgvo0qrcz(IH'k@I(JUPFcxJzV/¤&ii)z&OU&C3,h6#n%1cmgnHsdHg|--f"}csEQDIՁLQiOqPiAGBQuN}NuOmR eG1y>VC,o4F%@QtцqY8F3v@Sr &u55eev'UewTɀӕQhw&Rxf3te\_"8|Ԩ^>LY_&M?u2p<yTycI4173xj7xY0Aѩ χ~B+7l(*gMTl. X PIw+tjyS!9q]YYj4 M08n}D$. nAC bXI8!VCbK62{YK&TC{o#.3_IؒCR2՜}z#)<8g)qT";!&^F!Naa.`aE#zYl9:7 (Xik, Iyeq7ww✒ jJv5jx%| Soi()ũ ƅ?zqV)񓹹HǢLUaX' u4jZ8yfz@ZBFzbMyAKْ%(`W 5l@ᝡg"ňFI;zy1*m{jz3A*Prt&'= ~4%#χi}L熸I~,K[4i@h Hq3r 6. xΪ{: j|MC; !Sw=Oc@c~9~jW) :*;0yJʉ7")5*9iXa<8ORԩ}jY֘fq2y6gKEWVWUWtjRö**J)ٙ+Q8oa˳` 0얟 [TDD[44u N:vz<|J_[nۯ3۰ pˉ©:aK ~{e[0]p?5aJn#'}rD{jAm렄+*gIE]ۼ,vcw z]s CTG*,glf[ڹfbKKn"lÌyAwPlB`cm;Â+ wEXrgϤmWT؎ȹ}om x=ƍˠkMn \!W-ǽ%]C- E,|=k!dݴ-}"3K;$z Niǒ;#jN߭vPӿCUK{`}] L.8&,]%|q~R؇ ~ݴGJl*|1֋ᾒ-IgJ;|d={xZbQk&]V ޡ]Z <Tm쐼fw-[+LR! F90 Ӗu+~"5‡-42&4_=n= ŕdދ!7nIwJHWUF\Ѫ ڍ=s[n\T^$ϡ z|ۏoќ.] :LYF1~^ n<͂ A^/ kJ0HCn\Rxe3k>yiu߯^G/ak=v窾=\ ~7RZHN=<'Z9~)熨hn݀9Dj?1eIx/l^rNB,㚭dU]#Q[Rt6,w_~ν_7W'|_dp[j\?$8`A&daC%䠦EbhcGEIQdH'=n4qbK,#|I$F%-.u*LYQ+0 I$NUCj-S<8TTO5Y-l*0'T߾ũ\Bc>@@FSaxEcO-V,ds&v,xsȻqAx™5fZ3c_.Snm_2`ԃjp q&e`kӚmJ>=K&;#KxEVS4<O"J>I\JNSPGS*̾QXr0̵̺!KNH+В~I|d\s94V.)4 bYr-W5¸"h۴27DA9H7_~PWOA<D'xFSfm7n6`f43F:&e,ljs$^UGHF\Ƥ±);KQ[S*U8/#p.oRxV7-Mdఴ'AN8g1,p[*78$m1P) 0.<5;Ja157g4a࢖0ȊcT$Cjc3UO|L8/bA)X83@2 [ӝa(nnp!-2NPRr:2TVk90&I9O*̌+J b9-U)u c 9fq/!iɅ Ɏ2s'ox&HdȪTժU`7dB3cZ: t'>y"9&bPPsAr!<*-ytYѼph즷b]-3$%Y6^(E{6VVgYiK+6䥁[Y:7%mgqC dːg f/>}cc=QҜĦ"n~w7#rDb(V5n+O]x!I{ ccԔ'Y*)C{#f5=6 z|7֨Q$J s/FHSB6jxNm{b֔-1qBt {f4=vU'X?Eǩ6 1')fn_y;ĻL ї:3]LefP5Q RΡ4䱜5!i8[V&Y38KvED8Z҈4-]14RT/,b p]"7,S=K5oz<`M};%mوSIJqfV8;D60A^Ĭ̼=~ߘwd ĥVq]i[0oJmBt<;nȹ~G{=2{|aᲫ72e|!#qgvm+mٵCNN F LU4c\K+h|{yoD[Zh=πٿv[h }i;̾KKߪR+rSdVl#0c;&3fv{;[%88EOUPD|mmcضٶKK̂>W3Yop;Pל\ؿ0}]ߏTzﺰ 8#\-_F[{ObvSGx3ۺ؂q8,2:;/ˡ94y (k'h3r+3Y = J1;C3ǹњپQ#4:Kz-K p$$0R;$tû>'BK%M'[rBK< p42,)T+9D9Ӫ_ 2Ì2`06s5=k640عד'1+R"9R P>D: K6>,/-PȹH; ;($zY0a=C4һʼn̎K q0al @gCgP"T/*H$F[KLƋ$I@\.H|GMwװ %:)l IJKa$aEB+. *)tH؍ Dsۅ2Z ` %D`8!^-0;I*i^*.mE!j HMJ.d$so_96Ixc ^e "niDbSV_̬X2``Veae# ݐ5ۼmOJ#aaf•utʙo&=Ta{{ $L\M$]"\*1O, a/rEZDc yNchXcwQh=۰["5Y#?~dk<ڴ5eݼwd9N~MmQ_KgfY_KOE$fVB3Kh䎖{>-oPÍӈQ2qgbnJJJvd^gxvE®bD֍Qхluel~NQu3Aj[>>ssKEVm4 ݣnX+nm|>&k[i@L?Jwm^6uFSRdF㦩ej ij&څ`gnD,N`ξ <]HfonŊ c`ڶ!vhјCSmi ^iMjmV|n WVŊ׮l|O6f[+ݰq.C#QLo4ʦmcpv&ogܳ8 痦MSLPiyn*Pn-h pX}vo3qC"$tUr12l4o<&s8I`do&tC!pkFW(nY.Lp F}lն.(]o;=8YDGgt]uC7cVRW֞gSgh.e6Vt6&&ސICUr7g+o0u)4q_Hș*Ʒ~.>ydmefqg)\YdMm*n&ow _swiv=lhiQr _1xYw)'G|cƻCrQMo&F~J%"J(;˔/tװGM_w_콇ϯy}2'0m[?m ˟fٰW+3&XV%}h4~N*]ȶ:wgAƨ@are~r+UP LP͖ q`‰2XqƎ=Z(#I&GPr`Ɇ_NfD)3&M/N of P@j" _t Ԙ)գ]*֮@pHZ p`ر'edمF=VU(־X9{vp\ bĎCf,y1[gƗ(7i3L-:5М _Î4Ӷe$b&{8E⻅#[|ƻxmֿJܙ Ήu淋^}߳hŘ e{_`_[X rݗ[[Ukwɦց5X ؘ`$:"Sg%¸5w ԏj3 ٙz4]Ob]mS`a``*rȁɛAy\n%Rq$:\Y&pdjt‰'O<zv)hdAd3Rj"vYzulEzؚtYZ`V# r*"eVd쁷eT<]kKҤMiXNƉf ݗc^>-lFti0(GئgE^2( ꩆ&_牕9Rg8E4쒝px QAWeF_ۢ=!1\G8 nfv]νփ o[Y7w{cZLc˾l!Ԅw@ֽ (01 vyp(;c b-c[(Q͸zžDIu&P!Ԅ.K!ZSҴ6oM[L{ `vNLΆ]$%ۢF7qQ}^ގmS)OEAIq~|FHn  B͡t bୢxC1-gV8u y C=MX[-kzϛjݫ<3-P 쥽dwgDH#4$AfsN4'vljEZq Ð@" `F88XwRК'ŔŹ !(i3$inzfݒ$')\$G$sߔZ;j&*DbK 6q~f1h2L8SIߤIm}qky 5J]*SԧB5R*Ujիb5Z*Wկ5b+Yjֳ5j]+[ַ5r+]j׻5z+_׿6,a k"6],cB6,e+kb6,g.I?ZђvJ=-RSZњ}iYfնl[Vl+[؆6=p[ZҖL5nsZUvOZ~w s[]^תM/p{U>Ýox{[FwvQ8/w _vp|qֻp]Ηv/[gWòy *^1fnp{!WbX@y}2cǔ4dkY/o=^$S5MfC;Lzmkc;6o;7!!,@HHTIITHHTGGTGGTGGTGGTG1TG'TG$TG$TG$TG$TG$TG$UG$U:$U)$U$$U$$U$$U&%U(*U-;Q.EN5CG9>@8;<356)++    '3;9@DEGGHGHEHGHGHGHGHHTHfHcL^SYXS^ NfQx[ f&o+s,v-{3@STTTTTTTTTTTTTT~TnTlUlUlUmWo^xpcopbno^mqWlwUlUlUkUkqUklUklUklUklUklUavUIUIyUIpUGlUMkUZjWeaZg\YiOWjKVkIVkHUkHUkHUkHUmHUnHUmHUkHUkHUkHUkHUkHUkHUkHUkHUkHZkHdkJzhLgKbO\VX]UcRgdkkkkkkkkmkqkskrmnllllnuҶִ״״شش׸Ȱճְ׫תתתتتتتتتتتتÿﵵ´Դ״׻GH*TCAFЉE1N0LJ-X$%OLY#MT)ƈIgN:8jx%H*SЛ;Ft+/R'W+YZ)9Fl_Y;R`SSPy0_,0C5aR## y2F3k̹ϠA}4EuYCҰY=&흲sǞ7nծm}(._p/}W/Ŋtd>K^ݾ啭WhB^ X|wޯ7؁"]5ڃygvJAч l#JIѤmFjRhF1Zb`8G YVjYڭW'ŕUWmu$j j\s q)d `ffϛog ZMHp|gCP_(.&R;SLW'h)(t=7jv6aVZV㵷XhO\V`k.h옇4Zj=Th᜞(YM #" vJ蚄L)&dx#-G!8VM"h x$O:i0YKdZV\Gd]/ !g7bu,2hrO.ipυ2x2ik-r+eҨGeJh;өitNz[QFpW++2aeQqwӧvguRvq)\!t5])' 7 ckx+r)ȍ- &/4iK(uRkz騛^Eb6"(uZeuɿXK#4[t@< G`JwaTrLtrvB1oPJ~^hikXߢm%)PԄ ~A _ih yC^􂄽  v~PaiڦXk*V+WM]Bf& P$5tKl7ZӇ̄6] ͡|+[!jjI\1RE0=RmEF 6#MipQa3IqB)lu ^#0$$XD\Z4dX;ut=J> @gКՊkcYd !%YR/i׽zBI=N%kYzJMbǧp~Zv&h(ۙTAK kW^:1Nj5׸F Y,'Ln[ ,9`4tRrJ7E^Vv$ 6IxCZd79z>Kt<ԴM'E I8Hc :h60y]aƪUKZR0'BQvko!@LI^(]k꺛iUmBҿAY.% %iuPlo%3.3TP-SHfl --fc،gJ x4{a=tM0NLg'u4Q-šxW&")HE*Ҕᗠ 8%"OC>;V%,+#Jm၀#*o'D2Qn'MQ.2PL 6'^8 gh`Zr-FmWip$OZ>nƂJr2fS\|W:3y8rlҐ.qM۰xڧ]%QMC*]785g9k&+y X7-8t,],>ٰ៍aO-]9| <[}?b uF9Г֥ .%\*7e%%#ձx^j:1O[]ɸ.'W v:h(!5 7>H u& -1uBA"*$CT(Bq.ot0R<X{%MM ;Ko}BM1HqyD"d]&[MrTTjB'qoc@Z)rx|dp &g9#5#6MЉ/fQ$1{Yx\6ŃU'qh$Xu*4Rvpy$WRȇ)SXw#'8G:48qlQ^rAW.Vr^<#`L%%Wx=vT7U[j0Ekg1'!zy]8T%`wyĈTzQD"I22Np5K$HȂx+xdS'rX/V)bL'YL\˸V=9+jg@vs@5_5APT ·D~@7ε~1p`GnctDO0#WCrYnמ=c%4' h d!89$y*E/x$w(AiG.a,T=EXh'1LT)]瓯"@B)1Q :2\eb2 XQ8c"A!SFa6B1a1H p7K1Hv1TSyKIUq[:zKEs|ɈfHt H遷x{S~o?7 7\{Ʃ1gXw[6 ȸKKirW[3/1ֆ4^/ ot4MfLrWb)`3^gYYʫtZ5p ߩNprZtZɆ!zHK2 xqv<$S%4;!B Qޡ Yc|o8ˇ31e& '!;V/.lwҲN2E4-|x#IB_w4 4`gw%OVrSNt*SL8R ;u4qڜ)*1(#{-Vl̗=>e7\Y_n3Ge~3 MͮjՊ-|&olx䇑V3b6Eh )qSXQ8L_!/!8Op3N4dx$xON o'R$LQl\eSDydžH~S6ݲ.o"%"~y`$3cer?@$EC4bᢓUnmoU} %+%&YT@$@ᩁhvnڡ3"7bbďNdU;@hd8PR: $o.AL[O/qhC@%g:;tb(dxq :m\c>-thGC y6'E7T"Ub/:wiTSQ2dh|Nқa[V^ rp_B \ cF=~RH%Kb%: (LV:mLQ%ʉ83B/jtqҝnj4'Ty6Zz1,oRX@}qصǔ8eNru=6!zF-VܻfDƥl 2o:Y0ӮR`O+"̡5kXK mצm@ï}ӫ2bA>dRG8x ӽxxAmM9p-8f'6QjMtOH r NH 򊱛\t+,Ԣ3 w*,mk6uVUb5WSJ1`,DMI0Ye.4U,,dJZ3L2c#ev^Mm$۱,, JsM >ML/=k"EApؙ8|8क़egXdE{,MѨ7n3}◾# /jl_Ռu߶i^ݕ%]K311&S)?m9RDУR#2đƠyÍm a/[ҌT6uςb頲slmUAXj0$, ?p{ 3 "8Arr* hL2bs$Q.\zY(OD22!>irv1f/N Žօ)H%&EƐ&2[K4ŷ`Mqܜ!He-i]\qB%1iFܓ&fh*5ꐸv/P2$-@Bl0%4Pȇa8#X |v%SPZZbJq{sҒ}9GA(W, I= ӍyIcE8!|Ns'~! gݫ{ 4bC5bTg^~A[*Er2"}``F!Yٳȫ7ӶWq,!~ÛDfs|AG%RSƴKDmpʫBȜv𐔢2+n#/tیyH2(;}z5p+-bZBāh}Sn\ص.y<:*b%KTg=do9f]w"2ocDnFܛ8zY/9tOP%i$A .$VȗLtL6 tDhNTR9pd Ga.;R3kYgq^Q =f8U<]kYJ)+>(E!L.c(iG7(X1|i2#ķ,:^&0r/z75HSW8`pd(%w|.egoX\Q T=vc28C>d*h={p,C1K[s4WLIZdjag^2QmvLJOR8aKF?.Gw+*cϜ qd@z[x|02b>rt(t$K.Nq~Y'"rot $yէ3f*(3ΠL 4G u@@G BofA?u6/b- )x(?r @, y"'0y3aٛ aH᧖p 2W<{'&jQK o!$03!\P:HRABZ){H*C{(e2 ؾ:^+r ׅN)3["lZ2]•#U$ DvEDB{#[6m6\fl5AN$Ln xdN:[,wx#d-y)* d*+2XkА:<6> Ad}Dث'M=\ NZD5>2xOW$= vYCthma)ioHeUN޳|_& q5kHs ` ȡn|#I̭-z} J3 2Bl]$*)DPaIW0JGPi_!Hp)>#DN"UӷlDXl8-I;q38Cz)Xޛlr.mV<}"J$XmnC<t,r9 NZMyxz ycQYI ‰ ^CQY`x b P)  bm3r2 =:` zYȬ%f 1j | ,n0RV8قŋ6E1TO? PPgG +!,;,Lԛ%~EP 4Q#ɉ=쾋S LH2$ʒ(Ob(9ZӊĜ*[Z r#F:cr|֫e~uzUWWHmA#9sO̪WqkN9恬1l6 pj+B#t"~P&҃:zqґMzk6ْh6 bc2ot"s5WtTTY 5_-A*o-^Dt`%Gba&xi jy[UTVIp9l=vȚwefM2dFSpn_4b}g5^2g Tadff&HTxy%+b}Nf~-biEߠVL66[. 4('IUk[aZ&_qE)7%擰:V}xj7ŐM5D)`ۦH9@ⲣ6A7-flؖTcu+%DaX;PM=Adom!TC]ttt}t{ƯO8XEA AMaK;*-le_eqyjnWC=b8E0Nœ)S,mʷ6#Iq$C6D`!сU=k1oR\^!rM$aZv5ʚmCvF$hX 'l,5e9a}8FxhwV$"TTt0$Ty瑼jT}J ie"V*o\8ڥ~eKMj-;=͞}=xU=OCyknӘFK _7(^X0eOi'RSk<ϚrD; |,aM#h ѷBަX"W7#WD*̅btAc24l0W򝗰z>IZ-13yҋo |"_␱ԭJǒY+VȚɛJ-H&™SoXhiƨR:*Te%qͪ:j: +F)YP"D&,-^J򨆕`䶲Gi$]2*,qORRR\(aNÐ0̇N\9p Յ}sQ ~63"MyP21/܎Np88#gP҇~푠%RmFN8ByM:kB!U9-~:Df%!kE,kalk)Sډ[-!7ſ}aԯg 2"MCi"PD\e IĐLʹDUI`/&ket+YͪV&uIW1yH$K)X5VI6qYK+rlAL ] A^EU61TuPVƄmiA_Ӱ9` R"->t:)Tq@_%P$~H80e\ /E!B CQdפ]V5.vj "#,PSWL:Й."zz& D'9M2d}Ԑ Eh3Z IXJ-Y zB$5^d CRD ?yDΊxy7=--voۛ!DUb"[8KN%9rf )42yӼA2;W;LcdwK꧵QFt?R+@EVܡu^+hђKF H#e%d WL4TEBT/$›+*"R$ݘX$ Z RFc_UqהI7պhXcrXJEHɰ,h߆deoHLJfF2A=%oླan,vx,O;e5;ջ=ub07iS䦈)\ 栌%ݧ% .xq`NkMJ$4Kw,@.˖ktĄD|?`$*)st{mP5N&~4m58^Unh1qO[4%NCvÏHbr?#޸ mjyK6;v?a&dFkWۭ„P" 2/,])_S[UF| $!ز_$S${(ġhtG㘷t2sKp G)tF@ $`ηx ɱp_BMR|$Ufܠ]W4%Aȑ KZ{ ܅̐_،ʁ A@TC ۅj5E\ZlHuNlɁSZ˭6pEϩ^%W5IQL^f Q4өM)(҃QÌI[Ҹ_jLN׬SO }b}܌M %|APAóTPV%rMnW<\yVsHsE &K-Ep!qiDmL#@2OeIPi}lc uN!|RFyQ^B\ۡX ˩M)}`Tc@pj}W[`CDL^M X|đ/`p@dBbe㮈@BD&y al!]@~8_RGmA{LED)D,|!S"b7ݨuPQ?d+BbA>@@ܥQ_2*ɇDŦ DĝPN # mA%UMO2RC)FEL*`mPqNFj~ x1Gx)eW-,]nL rEZƲDI$J(0\ ޠ9%TʽFe .Qm.%$A$H[< ZҁEALOqZhyH-N|(D}GAc^$5ȤLF(P^e'zUcL] {Xof}9_ ,VvD8WBbL=t_xa'h5ZDA;D܅сdIBg{I~$XQ>5$Tm7 i0@BTCEGW8@pṯ!XJ&N6VlS* LC=B6Ed=ʠ v}RC݇q" O@a@Y$ Fj@`p&Qa.̃8A )p+勦Y`0M}hwvCzHRcVf ^7,Չהfj "-` s}hn]m9؇a&jlLN@\͂PuNsڕ@~r,5 )5tɭQC0 MZ}QIxWŪV+ܵE&fJkh$Z[UR]N2"Rh$ ENn( OX*@lEșZZ\Ia;+A^,)~ fI\yXݎlcS`^4iF-&bC/fM4*q]#ЭUZ`Hh%͞xȌwP+pKހeޠeXeށ-F=רj 2} +SUH_ ip_2SXpcL:kN1Fmdv Bq.@)!prⶫ_l-GFpA­V)H,/&p-=2D s*]cplR`%ȷU Ut“+0;|OLMPP֬He/2C X~&K1&TP&[)JHVFeEoo3KA{ueTZm'6nܤ㞘TIh ^ hlk^c} 0 mf/q%N`?HQZ }-P2y<\%\\Pk&}bfLw D<]LŔNco T3~m ;l(;:zS[K !{A=jx.#᪯ U4LN5_Xa HE_E܈*S:S[GW/'*wƊ#uP0ziR ؔW ȅYy+G-}v˟2L3$ 2AkbD@A HlXе- Fyɶ,G}HO'=Xf\*! _<<G­-?dSⰔ}\Uڄ)6Xn RDԆ׆ _XREk.b播9bȾrnr1lDl}`ym\7;lhG!nN_'Igװi\pDTL Wܜ55lZ"Y .s4vb\;h[/ȏPͼrPU7GjRNh:_v{ vA?p`-/١i#ᠧZ8+lnos%D_BDD0y:SZsW4[+t[7GDYa7Ġ#t.^ L {󘍾.i`HF6k<TCF!;$.@HÕrX"vWXw΍tL]tG;3}h08X֟ G2};vKBɚāxao7y'w"~)r#ȏdJu{LŽkNQ1k#IS?\eߑ-WMIX~7s[nY)@1LWh#΢UV(J>6>^r-Ѱ `cX]m-)S=SPAz#UuTkMOK45fލˣW:eV8˝kV\6&<,EW[;vw;#gd~!B1ѡ 1lV!g;tpNo)I UUd/(U0_իٻڭ[uޱI!s0cؚ'P8+ ZL^)C7cKkfFB)Iv,B[W¥iNM{>d <=:)L"\ o;EI3zфzrv1c׭66Uwa :ww*F쵌 kݽ K|yްW{m'=X 簬B"D˗ю'0\kN;oޏ2*SԙoKJ$? Gx)eMNJj#T6 V^ +H,4f' N籿`Zћ/AvO;2}Io{Uaf0hgoH!x٬>P- <P[2;mH^5`lk$M)K$kRNa/B,W@AnQ np,:TBtM\P^O$`*(_^WBOi-)JNF& )lr VhݾL:/>bM>& h,$BFfGF4(J.n,d.pZOevl"RJpd(K_؂ id27 9dMdTLu"Qu@^#!I M=:`?L,zJ!БNn;6}hFPof&#|hQ&l|LOH&b#-=q@DVkST EN ʰ~,ûLO0 Ôd?%Ѝnfx%Qg%3oC,Gr%YE F~TH !s#tyfs{5tH="XS!%c>F`/dIbd9kļx;14j; 2mepڋ+U0;#EP`P$R5%ؐR0)+WE9,34;"[;7"q"8y3mU1#Њ2E%F7iz "F:Pʢݔb$d>@Pt[Iwdy$$88(qIK۵9 ?r͸e(F@T7MH#--db ^HѦ+c!bs= bP=?V(r*(4+zbdqp$Tq̌Tˌ_O^cxăCCgJ!WD&VF `4!Nio_^6 2.d#XgVnul$1\Us2RI֙VKg^o"BX18^";gٴ_LM"b3r0 *P~ Jar˂S Q+"L8&DkJcB!tGW@YV05AsRIJP#ttm CGuy7"RM:WeBDG|U]E/TUtoy @ #7*pVsG&)5GnvF}$E~$IbmcGV6Dշ;%zh79H{eI2KHL' vn0)` }V'6$4$#k./dIeuLe}E46kB.Q)RA-NVPe/V2 'Q>sU4l0ai< Ђ #6qE}UnuFU;ix qHWg/7HdEgd K;@M>"*.&2|iG`Pljx2Bj Mw'qbMDyʸs3rPcO0j*"5WЊRQɃh/ C,a V+R}ׇ@ 2ؼ–>Q/Fw9ubehc3Øe`({+]o J#7 'F"n ld8xi#^j!`6TDgJ7!9&d3ւ#9׵5jgs=hq _ėqTsKᑸ|ўJR8gMWιnYHiL%9a%=dѾ+t؆[Ć]GGNzxPFxRznq97p 2"K'I#w֕[bWZ]2F-VF>鹎sf}>lKI['.zNLN_\zuS yp!#:LۻLiAgKӥ5DhL| B#fqE>;%Cfuiqt)q:׃$Nrh,r@;)ÝY5T0MBDyr{'nYi":[,'"Z€2Sj%Z] #G_ۣ"N"瓃80Ri @ #$5v]vM&jCzp8|)h5!m]4bF;yY|'>?M6<Pغ2|@u7d= ҄SZ^*6BCb:X[w[*?'6ĕ<;qN*m&$qضܶ6#E];śL#I"a`Bi%t![CBB_ 7aZ˼,l,N`@eo]{R ڍhꅜrbX3aG(g pPWZJ3N@LYßRV:2bBS6saI^7۹wCkM1T|!wCEhƹ-L IhwveV7"ǽ1U{ȧ꬞\X3`$~{ T܉dZy'#t'0xsbW^Px:!$~U>Ǻ9OPvNNK6PRYpE2,.WJwGa}]o4R^z'8u٫E-_<ة6]+)2߼h>DW _g3[y`\$^ZR)Z\.jY3D4HΫ_ -E ";j6|u++tDŽ$C8ʑi`F4UΜI0- TРD-Ҥ/hGSkugB^ڷy捥Fve:hrN[KZypmٱ|;XjpbÆ9)uN{vi sZeI'.=:5jlٞ nЃz[ #:h%&իć:N,}N'HN2[{uHNnΤ1ީOi#ͻ]쉋>'^'t^ "9bI•ji&$YՉyZ28 BH| VX -oҟ~I8NFL1 }H]QIfH)WPrEljq6DDԔvZŖn 2!wmaKoy V Rb}H4)lS %VZ6V=ʪgEfNېnP0G4-fVe5O!t+}޶'nՅTztQ6K/^4X㇭VPTRה- o g-Ibo4^p΃:A&ߐ&f8Q',Μ-|!\}5c5Tj: BCWi:,rJQp>/rgL3M^پaV*Zif^ZTJOCBQNiȚRTjupٺ5q^B.s1sϵj.p][K)3裑"4;1R$uy(:(DgzoF %)b vWkHk"C%\9q N3]p( ܻ v|dc*6K5BkG_D>e_v;RލjD|Nz *ErmdꞃJ91ljSk8RwstNHt+X_}v_bKCW?^1}ńKz;gm%Mi?6)`<7̸WKyWuVP\7o)zxoy~wv&!3FQoRɈwQmygx"h! 3=qXԡIE(S3bwW2ZyV1V^T`P#j8=Qfb{C~(r5'"Us 9**b*R5ވB` !Ya/Iiܖf]B-Z5)n7FD'YF՞](o.Uy ҁ!c`N<I|[w(Fݹ;M6[$X2Ym@s`cbV8(99`RuXbCGf!P8 $I#'Pz*1w[ca7wZ"F #*D&J:ob&lc艦ke%ڴXD:{=F$Tz&[VVٚԶhG{ˮ7Gn߾!.mۿ^wVߴ]嵺Vpb,;,x#Zf<:G~e>A~ݚVr*6(2hEb\oOVG:C_m[ݐM8!~jltYhO޽ヽo1};ܹ9z]!:Ȯ_m9Pu=[g _M4OZ:tǧ?_Z4O=lhk  }Kk% -ԭrA$`L'+C %28"C:22B'F7ZYRI'?deK/eƤ9&J0SVygO>YÈ=hӚ8+BhS^JteʯL*,OA"T[oøy߮Dt: ͨC/^ZqND5QР'[<9ϥ}E& `| fkkF:<^\tն[k#x%(+/uƐ8rS;qjgO}ߋ:bOrKkO(b+$[/@Ol>"'􊋭"j ;\½0 ¯[1c3e,Բw|ĿL/ߎ;ʣ>|HsqJ1r|H0B 1E*%brL(SR6"E[NZLizӡs,7: 3ԩS4QFq(?cc(]Q ,JR4P&M6Uk- r.k56!Ү,*VGb +[tDtv0H%2.g'bKz"Dj27[oZvۍ͈ȣn+5Ej_W)s;JH$ 4XMUTR0:e+Ƹ_6˃|/, =c6,U%USZŽґT3u2Cyzǒ4LꭁYgJZZ .qLGBҭ!cZGgqn5>\n~_|fy;@/B߃J SY c [OuF0zKWD-w&V1yuUg/, qP@oVx)%]Ո;IWJ.l :يCƘv^qDs񪛟~l0KoPvKI4 i b+ku]@/[.!5az>ρ5^ll;PJL#"bHU_Tʸ3[gdV3,'|_x^]jCbi֭{&GuAr0R g2ެHZ钸,ƛ!Ic\/5umkXT=o]|'617' A0~ad%Oy[ -F7WR'RsnǾY.r˰pr {2_"P"QL YiDsjaS3d ;Ed.uAh)˟>#L-V8/A|iѡdDG}p^c( !#$2F\tMJzBxSӜD`SlL\%NZ^aGfeglaC}tj W*EzY?Sy*#LXT.t+p_ }qk"չ'@QFVB3#we[ͬEٗjԅ$n:юle&,QcRkIL\+Vx0ΈF >Kae15R^)] gA}X&uºm&WYRh^pE#6uՌtOk8 SZwUvZVպꭥfZ"nsc\lO1ҍ.rs U˄T-4md(&0]F"6eeGiz'uݡ}Ng4T g09xuǝ`ӠagB@75 sxA7#f mׁKvS) zǶLrmX8'䒷ӌXbzo|+ڑ}/\[`Bo9`2#db~\܎h{n3[d}֡2BdG BGj ((ԁQ;57:aS\GשnҐ=!m.S{wyo9Wś]˚ͮU{Z!)KL[ARJUwW"U]|yB[HƬfl9R!:e\=[TK%gp,ZǻN_0S>;ӱ?DY37˹Bz2ECDNef=K"49,c嫫7 R8+%h:³Ģ+DKT(A /ͪ![C!+[KA{+=j/T:x"7B6 yCV&77E˦'j[# !+) AF[p?{>)d 0>ěB@TbG dl9#;j(Kz< y!-!/.BAŠPu0333 'Z;0\ËTA64P;43PBz(8(%D@<.90ђYRP+DHZ[l[3K==DlYC<@,KCʰ$Njʦјg zQ3;>V$08eA*6T`[˄逰-Ȩ0Þ@htZl"JCռԼLG\1n1tlMr|;,($EK(ȓ E(/.CzEޓUTT,d;=lOu3tKI_IO[P: }2tƣB$D.鄃DDz: 81]cTJD D\KdQ]KNx#Ԍ\ѱW  GDU',ցO\L}Gƌ>;!\ęNP\hM;JjqS8 0 wRZQm<2NCQP̳G5K]W\leuW IWJ!9i7.*7#+2)RT.cH+ UeAd1V+>QUH3Ҡζ`c}Sm8ʊ84 $1%H3 Tԉ%ShL9v$F-9|ױ|z}WPFKz8TK%ž{6HDOV5LW3t+mU,ʫ:KZOoVk=S[x-D DuDRE]S?e=dHJM=HQ6OU[#OV[na,ߙS.)j:^]>< +̵ϷMb؝7\sQ}QbԥbX$<-;TVs)A& 9Kݦ4Y҉TX݄eXpTZSv[ENYe%IJ-dVT\^d=ŵd]:0$]s^MЩKZ!u\UMe|NޞWQexQИN*'xd]v`OU8>ۉR ^9f5b Xta^J-`[3f.au]mн9eb4h^+N]#gS:H$Lbʧ=fm\]*/tױa](gbbb )W@7rb\l 6&ˢ:F#s:⭱^КX>LM2U_H^j߂@aHd\njJ C$=ނK!ZL@`sj`kEZ}heb^@@^qA"U-vH#[f|BۭLfTVtri~lfaEbP߉NΎU9V$Fhml~m{np&f51=ذhܬ++<`tґ@nm5&Vg=d&jFgv>f^ZX\e%oNFtړX3ȃvLɜQ]W(Z4k[t56ppOqpl OaP=1džl ^τd #/q"pŎ%QvqPvN~%MgGT;Z6ʁ^V Y/pecor%'_~)s9ٔchqaF+E1RiĵjS= syhOG{/?x|P7aܛc@CL` 2t( Ň/^4F;* #F;,r%F\|)˖2cּ9SgN}'QPDzPѤ%V4BVN(HViYfD%B۔O2weʍ$uV&)rZnkoRQzQޑ*@2ygtMNDA*d+[ x@eQQ( e3cZw!ڌh7_bR 1F+Kڱų芅̻ړV \J i-Kb6}@sb6(OVXՁR)/~% XʤBy~T5,ʨbx .;g0yl0d7+42ú%=Kyi $+.rZwR!q=]%&t%xK:einii_h7 c@n 5ͥ#ˆ8F43.,o[7YwT9H dHE}[Y>*Nr'3bڄ"4pKhs,ey?z0%iTTfuj8sf'?;ѩnmDxvs}`gü#=skZٽw |n7-}kUsа~3\m00n_3}p+z6>6 dc:[lm?lU |1Cnjw:ͧym->w*wY:ыn#=J_:ӛC=N!!,@l|UlvUllUllUllUlkUlkUlkUlHUlEUlBUlEUnHUnHUnHUlHUlHUlHUlHUkHUkIUjLWiNXcTXZ]XRhWNpWKxVI~UHUH}UHrUHmUEkUGhUH_TIJTHHTGHTGHTGHTGHTGGTDDKACHACG>CH=@K?3PC(TF%TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TF$SB%Q7%O,%P&$S$$T$$T$$T$$T##T""R@     #%(+-/2!279@@EAGEGHGHGHGHGHHHHRIcKjJjIiLfL_SWZRd OrP{Xai%p+t,x/:yMlTlTlTlTmTsTTTTUUUUUUUUUUUUUUUZ`}{pojfj]jXhUfZigck`kclllllllllmr˸Ӷ״״״״׶תתتتتܪڪتتتتتتت⸷ɴԴֺH*TXvF,J@E #jqÆBVi$I!K,!eʔQ cK>/St3$ƉNP'%ЈE96|#^xurԉNZÂӑذ̴hd۷Ֆlğ,%`po ;XCS%4qaĆ LLe1_襳ϠCMt閨6aQUv˞_ݓo۹y wY,.M-!.N=p:M*S&>i-x㕖YއWܸ Ͽ?P_F c .`&iiPʅL(arUȡlJ9"LbO%&bH@Z 3YuuX\\cieb]K%WnRYdf_5[G=%WhyTlz6>3mlBtbC;D'Zڔww/v= SNwgQlË4E[`].uwmy\qu^|߁w|qUoUEc~ x%c,%a&2̅dXhiV+EAfF*]I,δxy/A׊"gJ@/q"sHP Q"YS꨷uHb%(͎ۼ8Y9Xuj9)[SLe1^dqVb?f_`{lLhe8g)k} JQ~V(]R#,0$@k~ՇDҝ5^5ѦS(4VP~ "8)e/;Kn(boqP$B.lP݂Jd]ɡ*dWCs tN8Di*u'0B-ڞi]cJq3Kk]4Nu{fAnhJ7|[٩_?ײr T5]GhО ajB׮ilU`\yK^BćAD&uʥ+^iLߘnYuN-C anLϥ=7(y$kt?8d2XIz;Y{7݀正z":Kjj>vOSa286zq4Gs`@gO{s+* Q4D3hafB%#g# G$c%9h@p˄Pn`5xP ;oVvgb>UiQN)R*s`9)DiGEZ RiFj(D ^B;1e./!.Q[hU4+{ oV͆\{8Jtsˣ<0dJyj'a>vCPlR1e{fl3oh53e@5(^?Xc*:2lFxPWx}}\u,AOMGOqiw[(}?_}v8@RgO_b׳P 0ss;WKt}A SW 3G@4f8YgRsT'hBR'9(4xe 4T?X? IBSidWn{%)zRBz3aQH(A Lew__8eFqw<)kFѓ$2Tdqg$PA} kr!u50cy;bC$Jz,I(A0'>ysIWCV#V`^!!_c)bXe :ka*.$Eg$Y%dL4+G[Gv7~H_@ )E-7 SE`0Blog8dO˦PXg'( gY\hth峟6D@XÐXa|58|^9T0"sXQ{s$y2&pWWhN 4q7TVTYj(4F 8Avd`)^=59>A$O aICN:Jʦk"od J"{nBoeЋ5hcPT#9ij#+tPI %F I,^l{gmbP<ŴW8 lX%Os!E:&qPE2ϊN fɟ FeY?^:Fja@vF{;(4U^Kh4db=mi/3Z /!m=w}!zٓŦzԃ=LK5*?\#XbSA2+7#6A)nZ.ͻ>Kl_l0۫8{0hdz>|^5A6$)Y1AOj$ԺSQ{s}re~4%q̨!iyqK jJ4;RtWi7[VzvK]fttFln$3,7\ (Y:)E\Ĉ1-C?{n AE[Egq1 ܺs`8nd|%ySZK3˷AaOQrwOY :.!.4Y˲˲!E75 Kd2E:G&Ŕ^ ezb['#j!6i[SA-IlJcIld4 *L@#CT#z;2 ݖ%58p'"q4%HKbWTlĸ*v&1qY% EM&ա&F[䠠[H;uRpFQZ+igA6+Wa1,riYkCl3Ȇpv\ ;P C-Lttg)=IMkfʓnu2 a๟ס[?/ ̌01!IUfLy ܓlݨ~̷ 'ȵAq2~@ÊD5@?gJ:t5WCձen@91%qD\ER*4Q'eR\Mc.#vz"K/b2-bǻ+w*rOE#.%QYt1 12Eg)*"sԋWsQ7m`MceQ}2nlrI;+m%,o$΀BTz]" }s9"o^I >[LyT /:JMTym'tDUC C}Jtk=^~o˕<"NHo֎kj_Tw螑vl. r)[uؚ})4)7=7e$Db81(.C<7f\&7Mh^sܮL۝]d[޸DVWҡRMcp'uW):$Ǻ"=aJ2Ri\ƙ;Ce}ևOQ7Ce511 5=)$^ 0,B1İۘl%bd+wcf \n]6FX-y*ͥX̑Ze&5` #gAN]uxʙ ,"B*hZUZP,:PFd1+MdMMLMfal9CSECۉd].^ \!`XC]c*rQ;dj91<gֹ~F*S'1uz-LxHQ 4(P  CDXbC:bH%TJ-y ̏'' UD 5TPEE4τ?~|I@ !Tϩ]P$m2uFz Ckbu(.\tAw/۩^HWVdqb; e0].v֣hHD#^)<^01Q-. zl6RE p-:1<P>Wȋ7#ѡ{h:D)3zK"|I훪>T@l[>2l%$eD3 ll /(4 I#@Z aH }0S) 7Ƥ*-Kk,< Lz̠kL!$DT5k7NQm75_.:yKTGz#5ËM({'J|2ܶd23^n&({iaW+A㨢\y1. MH!=;n5kF8$C 94Z(eRZHtRa F[؇F(!)[G=>q,:rW(27LQ媵( ӟ$\;$0!NM?xM 4d3<˙/zFðom"j,iTлԖX V2Sg{-ԂΊjeV_kF8A !buagag(ad!aux)"M!/ # *B, H`œwڢw ;KXWFfNsLLB>1[Ǐ{i#wJ,Qf \x '̘u|K^[x- 3a90/SUf1 6(}8K /^eмb2(-2"S<! 31A f#iR_"-J"HɪZԳ䨌hɰj7 Z33E?H tGbNv|SWDc8{,ר5DBg \@%,,6M)ׄœ,,45bg1 !̠Ev`N,X&ėw&]X1h$E~#`HgNgęx"IHERQ*_LBI}XЀ2ħ 8\Ђ-zⓆ2(2I9KBJ(9i?&&4gQ|bNkQigGNM*Ġ;OAˌz a'l\ЀϜI`$UE%FFadDIGuwZMr*mw}B戨D Xle(y͹ w>wm)ax $rJv(j-(A߲%$9 E/SgT㍖x)I0V$w,M1CE+j' $m@Skr3"Ryt4jDs =@fK4Q9 '&ūFj 7њ'wrrO?N3HǮQNF4!q"El i U)oAبա#H3Qb5Q1o>R'  ;>tW^'^.lor9np#0, Ijo[ T /i19$pɊ` H?dˏSъ)"GGpay-wrxb%ʟaÀ/19)D=0&y5}h2xRD)i @}hs#å눹{;aK:sR4J; 3< bXwP?4E|":+W/ <3Q6jš7CO##P 3<[gi:W9A; E99- O3(B v 5X>AFL*"@*BX+*4"G5nӶ?# $;i jm(ihGKʿ69 -8L 7g ^7*p z!=吟q⏐t %Ғ6H}Iks Ri?㱮;.bJ]>ʪCXsCEǫS+փD)LJ)RʳSK69sC@D;;7˸  a-;8+^:و]~JH8A̱w(N骹 9ӄ!c(8/$QG<Łhщx+x/܈mRuXʲp0Һ@ ԝ' Y92 gtƳ8$428i+9!ȈN0D<`$ۡ(Mh cƦk"&"\CC&"լQˍD-a2 Ÿ CN9"Bjj,Ti˲AOm8Pm8OH{ dP䠔m 5њP"~t(KrP\ ClXJ/(>urcaU*Qr}iX;ęHղ;S=0X;:-CJ6$+ҺauPW {̊4LEa=N`{K|FOS EnEX`N: 9/Ë0)$LD煣'$;nfFu 08Ez@1TEg$c#\L%JX!ͻ1:Ů%!dKz'U`~^YquIHΗ içʣeF߰] ĵNΊ}3?\s '-'sE) 0L`.l#j# , onUĄAJdy ڲUϘ2އ c)&\55)2$f|29ȇ 6M`ș WGN1f 3^$(PC%x1cÌQаDF"Ci)S xUJUifɜ"=z $;h3;uibŃfZ3fH\JYeזp#ydke'fxMRȐgZ689eˆ!&tҊX%WnV(W V,mtŦ*mU;gϲ z֬C  Ȼӄz"VfM~:Op!2{w:׫ඉџMa+?8UyM#Z{:-}Z|]xDVU]TCܧK RDHEвLIQa'G 4}V$|WQ0 Ћ%EXD FGSQCb9K锑(R3zy !d]=RieO@CyɥG.ƚQ)=tSPopN ܥKJ Td]x1C#c]PbÙK) G<>f/*tbz惉䡧)uɖzE+U mF 4Wb~f$i$agq h`VK3vheW +>yR.Eunj7%4X0c eWpB&H/y1UfGf^Yq-D[fT\ًH۞]JYpYu*3Btz!ݧO)Y?&FNkchoI'SǙ U vSZW/* d~˓U.AL.}h.V+i֔csX=Lm;/Eu{bb׬EITo|lmJ ;un5t}`n|f^y6&m_}!\7_)?U%0f:gya^I|HBZeWX:,DCHQLz s#%hڧQkbN ErL-k_c. /`W9^3IgpKt"s-j8,a7{d9Vtv0m\㸯erwb% T3tI{]>T9;Sr鰗[u(.kQpǓnvn,:7ܠNIbˣ*-;&F!aveIW iDze*#K)Hs\ IJt1!Gb4 E0>NJ̑1 nJ5 ] kGB>-GӂASwrF#U3Ʉ֐=Qt(Cy,EI= _:h&l'RĢI(0c>.eEZ"w„PSۀ@wˡ.悱I3I`/ S-hR &\җ//ҤUanU_B?9|]6=›j@]IJr ;I՞'aTJuFhb̨JhrN* q ل_QqdwXODT\Zx3!#I,?S-,  >O*4"RĶ@.0n bFXDW؃8̌_IP1ע5u`N2)0OqL Ji |WL|P Hʁ ޿x`DK=\}]; ^DUUOe_ÌIlp8AQUEʈNuMlRa [(DD4aP]X@J"K Rq_P{OABKl h'M;="-n4R⫼_AL=AChkEb2Jl} Gd`3 kFlS8FA8$R";йIM*̚١X^TF\dGof)~@x,L& Dp\zu^u«Q߽G +~$ Fn >#}&j|^] M$L.Z5ڼMʄ4MB/ўh ;_^ U "TsK0PqyYIu,GuQ|<)]aPC+z4J|bl4zeɆXㅌ]\LP}4z[Ҋ8˽D0 M~OB`-E.&E9F& n5r`!P`hأPI]H`PTJč x&ףatQT}N8YEATOa%]bV}Uq!TE\%@lh Hl3KK$J~ڃ ܦV򕔤ŜQ^yʩЦQ@!ZuنuGĥ&'^ i`Ѕf8dnjC?$f}ebF)^J\ǂDbq ΀{"3l]RH E[ cJ҇ԯ#RD o@Y D"֒ @"PPUN3CuFfGB[XDp]yȫA8j,1lb$ޕ@81JXTS| )֖,~XnRCHR)Qf*!J =clZHFƽ⮮<ƶi*J*/Bo-AZ(cY题-<G<C g|i܌8l0/Ϫ0.rOf,Ax*2xJQY]lה"hAOum5DŠ]pmYș+ >/äNZuD=-btPC"*?; ؆5~N+|t~J(2?t@_٨Bl1FOG.4|D7u!2Є8M:MoR Bʩtr-?qNi̅R5|'-i2Y8ܯR)95Kzc pOA?BŏUq^u#E` 0KyzvJ5(nIWB4l \κXgxG8 MT1j8+]03\h^Ą;65^2BlV}AFVj4G&QУt3NG-\#NYOS2eQ/ jq=u55@'qX*jGL/($"´7.÷BxR@2Jtq)rqFUԊRJ5O6*j}0sF9uՐ[42C:o?h 1X>@4"6ۆ}i4.c,[ZEпu9!R Z투H3ب2m9Y\4Z"w"; 0F?DuXϯ{Ӫ@ftlR_t2 sxeo6*y6|** D b wb'u4DY=i>{{1ЅcB7mNcdo"#}hE"Ց+[̠f~u_qEۍbJ#$#l|2{'lT-_~JjNnUZU>;&Y?Ax粢GR,axsPEU)3FXp!ª"̊aW]",XdǞ% /))dӥΚ(;S0M(`ÅVX0VƋ!?.8re l˹贠 =m-Oή9g횝*fQn;Y8Ex9*!rƉ<qʖ.F{afm^=m ]:(3!e:ma@# 6%#*!BK70LC0\h2 A02kij;+0Ȳbf)^d**/%L<$´I+Z>I:/2rI%tr&i hR/-jJӫ5㎶PŠ,5,ϕ ,ɠ :C)b溊 esZճȫ1(qZŖm5?0t#2s+ !k$."qG0Ǽ_~u1J^(C)[TXOІ>ރwkK/IN$W;w]J/f0Yw`0Y bYNIQxr;rڲ'.̣9+E,+;+:8~j$b3RB#Q<7ҭ[һR/Ta4OEԞ~5Pc#J<[UAnknaJ\Gww~@hH3γZfOvNa$5(^]NW`/k&B:㫱A0A߽Q:DX|.V̕rZT)yAzh ]2$2 $E™4w@_ dOv/~3egQĦfkp$elH +I@9H!ln[DD0tmCyEX#Ǖ5TD&N @Na-;JXF1ځ׾E w1$RqHW^1m)9uՒnmj%`JDiR5IcSW DdVPPB%| `>t/:j|XDF!X2,١V(H/? $Y] ]8i)eT8WI_wjH"23I̙nr ED#Z lO̙1*XĐaa y0O󚈒<*@v=jg+$G(fTRTtG%8p2\|8# |(M̜)i@?1u8uS['vL[3 pF"`HT$%ʡ(8#!>,!4{RMkDJY`>##@13bZxQTIq  w`"M\Ri,MPhq(A^2j}gLŢN]ZpYW8HpX 9Mx6VT2%<F SSb9w4L<3@T.z$O 9H$3(?*$nԄ^(ŭ<Lk,`J}!Hb]y36 F/P(%QJh*!Yq @2!'_e+TFg+JGZ>T$S&LnMe*P-`TM0db0\pM2$pԇ+fvL% FCVJ͉Ϥ Ϧ(6LU|<9&5J`` ܍*M-ގc^#jU*./P1zgDI,( A,G㠏LZ+oA(F6ܯ'K.LG` }%QI)("q)ZG.*:P)&MQ밼&\mF0]0 uPR" QVlTڶh3c ;<.NTO/n 7oeBH 3Kg2=m2/iNdk lGL+,`mL̾(jI(lfM"47:Rx4FJQ.cU<F'k)l/%*KfD6"V"B%md;D.(ShPE΁:%%«,`Q|HQIj+sq@+c/>q44R7؇Ρx;Ȉb~R4THe\#LZRC838#:A{@((tA}"BlQTͼD1/c>e?Q0:|2O@%EZp~ލ* 0Q=Pb` lMr o>jnN{sOs8x+TAWf(LoN"`Oƴ޴_)HWT%"X%X%9C'>4BT[:EWt&hILLZNMAUO`pY/!F 0+nIrDGF2I);ʚ*6Q6#vbS'4*֩KlcPµRb"07U_w@ (:(g7 IIttIm,v+bD6?cqw0(CEa^3F )%Ԧf0Bል\b$IV[0`.4 1WTNo>ټTا @ʹpGIvGd ר1TS0* =F8=k\^s.+#2(<^G#F6('׃D@rbpDNͫ\GKϵs\u4{Rjż7Ya~%%8Uk wi,T /&C FDcv`h{5nE\@c8ܨ}؋|3i13NRs6pCOȉoo &"B˞ l(u9 +"$~P ;L/&`Fs"&LщA"&]e f 'fE .BDq( "ZJ/aWuO9,|u1p $wsטN0H??c /'8O85./2Locz r4"WwmƗyad=Q#JrV#7uЬ^09eΚRȌNFbi:=6m6ո—-Ӛ/|zgj.`_Fp75b( @jXG\+K9N%_s-5%mM uS2٤oq K ;ߡ1'ta lKlhN=E&JoHP₉ 4oW k GyXX; p*UQgD7k9okB/n X=JNu*IyMLy!V9u,29S+'?\,!|#&'FǹhAƨx0$@/(h ğhw5z   K%T^yxM^U^WvG@ޅY ?^ڭ'4+ cYl &Y~5\kdlڸ8t\:![Xo7cR^(״r {p-z]+!g}˹kE㇧5ĐӕkU("Ϙ 1B]gV9Chr\60#ž=ihV|k+ڎϘ#gZ8OE 7v&Sw[Wb'$\*"o B{02DǺ#mÞR {3vgmcsnh`ntcvU?۠4 9̫֜oNzs>SuqQd)ڱNۯ}yrZI@_i:- i`& }j`UvHP"rga/Ӊd$QBbMXb9J%/=Gc1VF84RRFN ST#THTcZ(i HRcmiXYR x-.\88-n{U|PX[5U$q{8 ^,}+ i7^"H?fd)K:&jp'>鑍m⿸MP-Đ0EK_R-G{TڍAllG@iJ R$4fL$S8G+siR`8fsk<2cLCTRI&\f+̘u%óTM,ҜXHbNpq4[DXN2f8c}St3PbE@/ Q`0=-(G6e€ĄI"@7nىs:GIw8S9HܑT Ԑë0HücOT)Q2[ﺷ6N.G5Gˁo trAVYK\ҥH%(H\C$[IN"Cj:MXY/(L4ada .OUi}gU=m)1.2x*y3m^ <(oZM#]/5L#hR YiEfPS,.ߥkn_H?<|jƚ|g5PgLx|`WBN^p(c#T f+] >:tDHBYܜ+L 6NK pDT|ZӄCǬ'<[ccZ+F⼇:/nm<~땁;| wr\0[S|f47,fpfflS'Ffl+M6~n]eEфRAFzz:(%Ĝ!-xҍ Ee Z],!O^3TlIƭJ}R6^7 *SUP5F0уH7P%0mxd@|Eܖ'ZTf.Ȩ$W N̒AOJ6JODֿslV}~[~pgN5KU,@8hb18`*5%EXSQ14gmZNZ].x޼ϝe4]+Q<5<.nw'% "Pou322go>xVChko*3thipGS 4'U/p &5TU#nބ{7ChF}0lbscc8֡j!|:Rb!y!}au/wV`Xud_1~GYds|G)-`jSRja"gJFhwgNvA?%?IST'"wM0sV U2(,8%qx=LBvz4 weX2 ax!wrKXU6C#}X6gvN1:jD.Ba@B|aI+cݨj<=`hEQ$[cLji|14^wDGv򷃏pvGo]2dRQTi40X\%G%As4D#9x#5" iH\(V!!Ge{&R.Ui1EcTRL:9B܁%6Ym#439wrYi?Dvcc}3FE:YG"5Gd=;vy{F ^MhCC''wIy3p$ @#\(Io/rX9?(6$ el'RMsI(XQU(F:!891{rjdž~7#L Ƃ)"ҩB]YϘ,fq/YLAE%tG*Y{fVنGrM(R;e;xnY0 3@h61rqF鞂yy(#ke(3QqU,$# GCzw G9T*YR:gדDBAy[eRaWNxE\D~I@|P Oyl˷Dg|ZLit#Ɠ9ʖV8Zj|Fj} tU3W*x'ij7mry\AsCBB4DV44ƐMl$Y/e0n7i) )ɋX6($EZk2s;rjy.mZӫJr ڭp٣ܺGٓt: *r3!G\dP̖}F6koɦJ;Y.nsvri15E_mWkʶe"?8(Ц (w6Z+RSZY(kiJWùڸPKy:'nJyԙ}7 =3%ȭ|ң<2<$^Q Kr4^ӌ&KrL3)H)Ecj$JN1@1 % 0 48ܸv+R"HqX\tHe$3W#؈+7 o ϹxŤ,{mbw8rG{Ƥùg38W 2pLL R ZMilg=+΋k{ںёݹ6TKMلzD=Ϝ`v\x}<X nU(̢\-ᙍ[2YmսW,~ ,{ޟwbPyq-K l=1k5^[*1 R (c +7w%mҶzkͻEâ-h["@ѱg-q~[>"W~v=c׋-6 H>I~8ˮt>-*]f$/PKjdqz} 6ĕQΖS~m4srll/j^EKⲽv&L0.N~ZG- H 3 †hO62"%0NXPC #.(0M(6Tc; @!v< \ʂ1B͌3%t2Y2͜85eHThТH*eiSOFE L2&݊fR 4 !dzd=z-U`{hW%;E\-5Ẃdlc%\Rǘ#;q4VvDˑϳ2SOܺZH[m7sݛnݷN04d/7@bA(T9uE/9ڼX?],F;zՉYs:RbK;K^*%s@ZJ.v: BB /0C n3+p:ʵ6j2=|û~Q0 QH"g¬#332s2I(KQ?;Q 2K.M6j#s7f ?+jp/8ssEJ)s|-ҋ2S$nQ!rT@6+Cs,9`PiNRz)Xe|V\at1V-kO"J b+)-YpƉy_[uWY[T-L&=S1Cy'd&&@aSWJﶃxoĂoM:ԲLsط!~/2e6 O}*-ь v')@9UD_RdnoSC~mϏJ&1ZǝXbNL`cͨ'sV/Yz `)>*O_ÐB/`A)r4n:g_yt34^ ';^yפwM}#4# `}v/%>sd1qvAU/OLnmgKfrI]A$48 |OlvNR fv:%!d+KR%; faf^BeX U=!7MfӛE 1UF8Z0i)jT9)%xEx8pDk" ayZh.YQ^`xs 6uYh3Z%ix/'hFd8ѥ6 gS@:K Hqi} Dت괾KZS)ꍥTJ( ֏cc$b๶Bkc2^!ҳv:6up$:38>kΈzK >*,cE3a{Äg9c jhB;&{J)K+)RN ۔rE`lCLgSz1v:es]z텳~WtAxf gEIM3Vs6_( Q9#u'ωGf6ddg3"d[ÓrD[8ЕQjz%}9bć.\f(E a $tyw (>sz.cʲ^2!U |{<>Aؐ%aky{J֑`MӟaR< .t`Np[9ڱы$A H (rY0(k3?zzADX!9Ӧۦ['3l%A:P>+`ǚfw3=3A7rD;;4SS4|CËÿ9á9)@=? Cn98>ac˽( a:}:@[ \[{.8_;As=91d7yK0SBc0#Űj:Q>:&-C",(18#*{F=>rҿ« KCl[mq<ʤ j Mъʷ$ BA3=Z*=9Uqe욡1d CDQ!CE :&m::"6"Tc)+`4MI9Ɗ~Y۝4 ŋ̻F3ɬԲۻ:l#;CJC DkJ1 0sXK#W`c=+B\Dt. 26AEgiFeKEYKҧ&pr-{ ƱF̆R)"} Gy3y'5,dL, 8?}qlL;?4jsK89ȔȴTTz jh3V2 4;C)+6 %#$=9 ryȋ<̣.δt A4BU_HF)i (M0,T-@3;S$,Je ʜJnJ6TJJѪarM 鑐PT5\K\;Y/ C{._[wcD+ 6=Dĉ0|MUS4 vAMτS9'!FMDx3r'~FCQ SSs\oSGN? TOONDlq%e%#N-'媜:O]y,d |lHBH3 ,"0H(IPP}4 DJ䙣" ٖ7I Od>񙜌׵l#AFWQYTߌt"/\-$=𼎉DcĽX/W\L4V3d׎(?Yc(LHLS( iExmcPĿWBԔTSҐL }͂uZ{hʜ57SrُXҔeP`V8"&]!AeGDi[7c; Z9&߭c~%[u_(_ &xZN54F3G^LZ} -I% *CVDL5Ji\_6E-5専_UT_m$Vԟ4+9Mؑ^NZUԇeZ՜ZeZl Z.ZkZe-=\gqKYdLc>5EiAL42[g1*b\%vW#gao).haʫ29$;c0fЎWݖ ]U4;zh;~i!EnN㤁RFY܈`NEQRгDH6䤘|g!&%B=ܶ<ߟ sY>hUnV`b[fk^fV.C3dacv?}Mf[gbW>î.>|X(hVU1\aigI~*z*2Ehφu6h&ھ텖8Lʢ\eniSݰq WVc>S|;q3nvJfh o X~e[VeZ-*#Q)޾ljVl`\ F\fp[>إkd&sS Ghp'nvpi6j~줉lm&deV5!3Lm/r~n!MVDm%NpخrvCn;'Z5֟N^rFMF-s8fo:F_ag^kLo"Eƾ\`(gsk?G^Smo. o.rLbM4th(Xɨ:T;ktuq\OlrA+rێm4أB#o.r@F}4nʝa=*mv*$(e.̕:4* TGvn5WͷD"lur\)u8wGegpqY tMkN7tvGcRp~kݯq(<vVwj[qghfNy?p^yW&n fqqq&qcOsILXI._=rhzionV%O)wAP%⩇rp'̮wv=܃Bq0szw2 ~{_wW:_]Et>TEZ}`/mQKS v/tY/q G(6Go׌B|df8uluN/uq؇{N㷛]nq'GV5BG.x9׿z+_ǭ#Vh(!p@ o}";@=%'(2 f[SeGdTHY KB# 5sZU%g9iJ5F9L moC涳\KlH:!&nvR"|qCcT+(-+ 85񌏚#*z8P)! "g+'td#-9oXâ+78fIx^HN2|StdIH:Rnt$0jhQE'^ѿUd?\Vȩlc|#׼hDf ũ|;|idJ0$9馅8E&oО\} >*f'imF;YpF6`U+b%*-Eog@jҕݒu$HϵeQ._i8q-w8~KNfQwTL.CdSSt~z*`P<\t$/g&! h6ՠw R> JUszXe2URu9;?eSZ3rLD)[MgFxliqq|; fG:ts:&G<Ԑ&&,Kp&"fHT+}zh5H(Z˫x^͈D0ZTQ-k$- JnHv9-C80+l c80;8"1Kl8*^1[821kl8:1{9B2l##9J^2'C9R2l+c9Z2/9%!\fV3ӌn\9?!q~=5_g1#ϊsh33rns/ZҘ~iO?lI Szҩ9aMбp)jDԺ- ?m5jC;EiX#3kM3Wћ3mspw{G8}F]jNQmJ2g6Ľ\ry:o8ux7mzDx~o>xY~/X>9ԋ^qe7^7˽^p y/}wv3[^mn3<.kz~7]wz߇Gu3Mm=FO+o֗<;σ>=Koӣ!!,@$$T%$T+$TE$TG$TG$TG$TG$TG-TGGTGGTHHTIITHHTGGUCGT>GT:GT:FQ=ELACH>@C;=?78:,,. % -2??FGGGHGHHHHHMHPGRSPaKkIjJgObV\] TdMiKl(Km8KmCJmLIlQHkTHkTFkUIkUKjVNjWSiW]gYiiWjjWjjVkkUkkUkkUkkUkkTkkTkkTllUmmWmm\nobmw_j\iWiUhTbS\SYRXL\Bb;h7m2q/s,u+v+w+x-}5=GPTTTTTTTTTTTTTTTTTTTTTTTT|ToTlTlTlTlTkTkTkTkTkTiTeT\TnJTlHUlHUlHUlHUlHUlHUlHUnHUnHUmHUkHUkHUiHegVg]kjkklkkkkkckakilyllmo~̷Ե״״״׷Ъתתתتتتتتتتتتتت٪㸸Ѵִ9H*Tؠ2FlʊE1N0LJ-XȒVPҀȓ0M|!K/YHK?nd Rcˊ+3U 2hƎu3QT:j:#jMEҔfZՈ0Z7nC u.߿4rp~#^|ᦂ6@˘3k̙˖EC^l@@1Ш~^׮aͺkV :VM$EYsyYy~sUݗϳk=O߽G]tePA̲!ZE9%dP}j#Y$ۆ"KE=ZMF5ЕETqGd9aT\EwՌkIfKJlbZHuExu~EI )P.)bQR9b!B\V&:&3]nfr35iښp)gCkҙ\{Sq8HEn}v'GңɹŜsUjդ2rYix|Jy:桩k^q^^,Z뫸fka*q֐j\:h`5(LQA ⶃZgɔҸ+nԚK/g E35KSuPAR2NůWYoAnR[JcB:gl]d0U΁d(H%). &gM)Ci(l|Ti~ʣ2"w:̊W357RVAGkj6c:R:ZYt]wI>$,ȝi?lKİe EQG ~fĭMh.WyyZqb*߉d;R 4I?b%~'ksAxj$V٤;壻N iLޥX(܇'~z3mus zد .HcoiwסTtt8.`PÐ&og f7Ts.qoS00;˦! [š UPr݊ (DdC+ ]h'4,V`uZ8I .FPK0DXn]pCՑ/ڡ (xNJŎ9,LO+!(8$O$n6ߡɓ|",BjUjk"ڌ% T~F BQ/i)e7t'(bAhf),9_)7=f#DS(R '9qQC[tgJЁZHETlMt&emVSHЃgmQ,G׈ƒ6\ca,()x 3ضWzѵYAg:[lADבM\4YO/! EBVD#ͧv8q+&DSH[SKUR@grBu`MSS$aL6]ծI걿C kpvӎ<+$B HOV@Ѻ,Aj0%1N SDJ C+D|3)5b@u].\SD+x4@s3|ݰ~L/cwS/q1~Y.qm2D5ItљSL7yH`:bCCGNEx2yρI⽠t zAE\rP<vlc?ƃz &?M}G9xPrrLZ5PL-x"\t^f9CahH!mrK9$`*:D}m7f1JـOCHQb7DֱwФ&@ʻ/g0 #S3O5!RL@"87 #M)T .rcqz>q6#wZV0rAeha s#trOPZ]BA.2 LOLDnf'|>#DBR;F98H1E$%Diz3BFxcntm%c26<9R"rettE#kV`xRm(T0Qm;'ovbhb>c o Ik  tHb)X$V77nj c&8j*pkk @:]qg/Q\@S̖ en#5)uU][WuUAeD3O0}[1 rsVA^O?iq#WuqGzF$ t]SåSP9b#?2^XSmtT:8X/[I&@u>`k*jh}qtcA?a"s""TF`3GLv5(>UtUUňU]z ( 8reT0D:R?"ĘT~X@'{~b JqҌ7W(%'*Ț &7yY BuWkwh~B]v[5LfD-O5L1Vt;E XUEP_Oಝ9rI;J8yS35*x_#)\hg3n$yaH8i]vR\g!;h:m4Yvy֤b zjRQ6!qVqc}pQ9eIθ}}bF~(A|jS-w!*gwh;AA"/y8m\L[G}(Kkm:>eBS^qX'pfe*~qqTpEK슺,㴠ӐG=jj )Qa{q#&s¦4ȉ!e4ut0PA 6fdsX9DhHvBFD9t,"o:-%I+J,SGcTAȇL\i'-뻴pW+ck(e` QXC.q+͔(OXF3l~q:2]D!,=޷nԯd"$1 sv%B*TAhhgTyx,s)#'HSq4&%Ǡb fCŸ9P]s tI/;r%.2t6582Aq#JߤC:T͞ˠM4Dww1*OFR%B8Kcp̖2BT'Q?jfNVXջ{ 8C.Ce!O-]N.c0DAFҾ֚gcUI!V]1L&#HćQvs:$e$ƨ@cl8`[0e. B8I䙟OIZq2g:ɑvk*$$ d_z;)q#Qy0DxJREL<%NE4_bbj9鐊XdH\\e\.nZZ5]¶li)G#skKMe {yuGS+\PmR$N>ub^X\ wYiAj,g]Q9OrHaBm9U[w(aoiG؎Ԣ'!~' PJqGq:u?׊ׄb(+zC$baI LslұY@ MQY  DP e4lPb+RF qhEćIB 12ey4~dَ5D("DǓvCU\r("≇ UH?"_SƑUr R+,;٥G ]ǘbD֎E$,Kjb*qfYPxY6&6tr0bpFPE.2GE,R:5NHnTRb5KZCE8).XcxY3JZ"}*#dm "{ͭr)9z[ft+UiijI0M_b*')iTV8@AMEr2@ ڰ)82@u%RU( |Saf3##Z܄cpqc!RݼBRyIVT0HPAh.hN2vf|kìl+LHdq}c1b$9QkekiJy*dA!AN)84cL48+A RҒ4\luӥ=H$I#Unu\܎j(%H6T#؈M 斖!c*_e֧VNfB.Z-h6 P+TVYЍ#HnD^+ RMrЍ[HCAHA a9ſZ!t,q ȂԡC -Th&4ȱ۱d#fn/%jP2@c&0ylTC&2me/;5kLd۲e h˴:%d3X8+AgxGł W(J. LXԆ~n|pG/UDa%c >ZdfyE^JY & Ԛ׻P fc'qPm93d G+qpv9{vbHa7& ό GeJtw.ySTh2EfueH1c6F#DgЃE5Xq]fJ8lQ ӥRk3D 3әLs s_ V*M p_U9 nߗ-v'%_M ۖp-0pы9(OTYQ4 "P ?=\A/m<%IbaQe8GVH;1)y+Fcs e<C'3lPfcUr;B kE=!2dqJFt$sȊWBODbM.L- ]"%x "9+q$J?Fٚe [Lh1ު]Ƴ2=u뭅  ȻID/ 7=2Z[\سΩɬ3 "[Us8 Љ2DŽGgj7@,YMm|sAxXJ_ Xxp N] )O Jezh7B.+h(zS/"H~ߖGK]QMŭBֻLѵ<ԩC1) }4U⛺7_2J*XZ?RCJ{[Nꪭ=Z%;ٱsČ*_hT*PP*;Te C2 ;\7JS A%u5T`#Ba2s> k#vVklƠKd]ܹj ؐWst37F.Κ`&?A_hIٞ(8ex ύ`PH坑 ZټlDq=B!D͆jtws74*A( P ]Za~P4e&[.uΙcٽy11b+(Yp aC"7Y2K0! "D^l+}) i:#X82+Ԡ}jAtY:\0{AS9Z $r unIuS g礙N8IIVc[ PfA(@,N޲ALO FI%K~? zZc]8s Gxߓ?c䬿tYp^Dnl4 +Kti0dL9 Aw'%YI A 1e1#%j 68;殽!NDڤ9XAҼ̸ S8C'1*g%':oŞF \'a5=Q*ĨK99&qH֐QҌn~,j]mdOH|꧞dqdS<ˊ]IBX eӗ #$+GHGI=((GԶ$XZ Es&XY֮Wޛ\j Z{m̫ Fm$MJҵ5h{nߔͅڡʙy6 )K,̽ [yH!*A[RLbLǒD*ndR̗|VLd,/Ȕ1ލG; Si jw(l";Á"< `ך IحĶK'@9? H1'~Ugv?$kgL՛`fkה +O<4CP2\80b 6Ə!Gl$Ó$UjJ*\2nэ B|RT$7*B%BiW,e c%V+.rrB h1C|-J0E!mjă fjϕL(TkˡX}80) ixCe|$ fGҩ=v@[|̩Z ٸk /<{ʴxj :C>=4'7P] 5_|n#'UnV-2lC`Y euPePVmSo2H)C]Q .Ax})iem0ƉJ,ja1x2] Wi rH,ZXF9u"zRw]Gmh]r)bYT!9dљٵޗ%%#L מY[F˝g!VL #tcMgXVU $bD䅑6j}&U٪qʊAo]է)`l兯_>XOHR,l5eYb#)!uYc̚ K}w.Hh"Zy=G.Pat`Mu_o/Ȉ2'8kk ҜuObz)kz%T(y4H:?\GN)Y"°#j=4쩝VeQ!XC Fr4)"!6|nK[g/rR4 ͈zhrB.:™A5kFѝ(2 BRӍJvHB=Q|"\Y,VLюna2iB&y*P?f /yLye Ѩv>/bA@^AVpFb, n]CD)˸k*>$]R%-ѼkԳWCRW"ۼbJrK*NEAQ?rY{+H~Sy,s7,ًue렂r F,hIQsAF!N 8'8_S9ۦT)LN7VݥP_4Kjt/YV!&<-ZRƑ&G`rDdI ZpY 3&Hmie-r;gҥֿ8M 21-} hs۝28Xh5 +,9tf˥,$*RF2ჳAʬs}M:шELY6vmrndz&,uܭ~IxRd闅3DCmtk}WN^?_'ƺh܍ lT.ЄXD$y 1sn2_4c^^cb06J0/@iHQ+(2 /UE eKвVl}ꗂXIY= FڙY%BG/^iHڜǀ\f %yY4QblST]Z_ifqN:mef[:I<Ȟc9ZxȐ2F:# $sM@ņNQBQEvN"Ff5ABxƸpՍKTٝfY[f (]^ޤN"fv~!!r"[ QN5``Y A0rUⅨVK[,XDGgü+eļ''1V-][^J>=E]蛓MC̞\(ůaCuj=5%U^&4 DŇ"Ue$Y^iepu~u)tUᑕhlPN``cR!<\ HNI/lt(1čsfQ|k,_*kj k,[\Y.]&I`BZ+H cB޺`2(D$B9mx]yyhMMQ4EKRTd'B- |`.Fٸߒq|CAmCD.-n)OԅIETͱXE͐mQ`nxԶ錈V"Č=D\ ''+>zbJ͈lDbK[@e+ pҁ2hLH+5_zfi,,tncS,eCO`Dllmb!, ,grLdaČD05I$vjEDab \L$NkRQîǥТ^ٙU[A'DD 0t++ٙ/(:V4E,\\;W@ЪVU`PīYdv"nr*@%.NWG\ou"qIng,.pZdl,W9G'pynJӴU~}((5̠PCYzqh(PYt'P,瘭a6JLRIh>_9wwe̸ig薗P)4Ғ7@ue&xrsa]6(R .buqDrFK*rM+&Lآjf@g[,Ea_dw8$kcGvpd?vE̎[v`İ ;qIh':neq:]F(vFP`W3"["n߄u{ߝ׊EunԳ`vxӻ[GnEт5eb!&|v+U Gr򁵴{unRD?d ƍ͕u]xdx1dyJCwa;%8hx87{5_1qPEZD2-σ?.vU9CD]ΤkgFHGC48DVRYLߵ{A~H%Q22*lP TyRqӊl:•Cx!\N꒪K\=Tժ, eQmvXTZmI6l c`ƘX9iԛ^}s`4 kWS[! uTeby"֞yzZșC6Z5ƈY^{>^k\޺_RՂ4g&t4g!uQFv՜x:*U._<9rM-q p?O-γTI,1MBXS/X#O*Ȃ̲ 1!^KmABqD.tlר[ECł^9Ljc1h'*,q"+ӫb+#r&rz)Х>j@cȥh’+J ?X=Zm?M 0 ۑAL094,)OtɱOqJ"rD#hD-NnSrYb;U"#젥{|E]ԃ ?Qxv{ ϲ5m h4+мAs#wT$jk^p{}X<@R}6v {p/śV7+L3B8i΀:@ױAp0 _bk9^罟?h@Ф'M ip'D7&.rN QRԉNS-mD>(6h MH(-JmyC/1#zX_81CHL:h@Fx[؄"0 r Xn PV: X:1F׏@2f)S܊E888.;5#̒]EX:ɾ/&Y5~(C(<ʕ>?ZR,䵠lE8+9U&9:TfAȎ}Y5f@'Sj*N01$&D6'\ĊsEΩ̖CeJʖ几lS/ }DMF,n}iQMɈ7r1M7eDp\b:}8wM΄3`zp)j2[8nDrW+~jKPo> ;`'U$Zҟҫ [Kk7!Iӽߓ= \6b<fk:*խĔ‰RDo.L*.-ЁV1|ZiXr9(ƍgVHD:fעۅ,ID*y%lr}$ ,ABj_wO%8 R]L!l6uʉ͔1T,4cӄڪ&'*^UK, x$Y Y"/9y\GY5uTpn]M 㓸ʖU^읐,^>/)I,֟GV:vt^ͩ鄥\Ӣŭ'l%HA99lxg9DG6E'9i7Y\ EiSIf r~nk;G?zOEFb ORHI_̫hIi<2r5X ޭ,WXa.H'MlM5$ dkxBY3B8.뻳]@[k[rrסdy mA~6`EIJle'j1KS`~EIxz/s2̿$FV|nSwoB3!׽ + I:@?t!%搾<;sV.dۮIr J(O$fjK!b(p0-FH"zM%h%jKL@&HoMi8D&IaRV3L!B"9.`ݘPP"ҾkYtn9lȣg E̫l+{&K{.+D-&$)P8@.LMv"ۀP4^nsOևj(jNFRdN=o Od,H(p3%Ž S"(0QqׂJB"lnQXR*Rd.Bf2O4~+}'+qUqt@#ˀ/ݔ\ B sL8% lPX !ʒ)sZ/rq R( %07Z"ƈ ډ"Y&cobd$54PX.4P0PбӦ7ut$!j+'O%T"lώب. b.Ʒ.I[tɚP,pp-+۴*Axvr9 B6J/qCKdI~8|#M( Q7 1{c.2!E?ʐ 1- 9' F˒z2}8rUGD.XbKX&6g4+7Q3 ۤÒ"Ҏ#508F%!Z DC0 1b\Nk08~erB wl0 t!R_HʟrNӖmy #@M:ƸZ+yR<1&6s\&)0nBIDwpx"2?pB'@M(TdM<ǔ<!PH裐ܖ3O1GSZ+i%XfK)Q@r2@(+l+@H`v%S@kƊe0Ŭu3 )=adN,u'jX#n{P3EH_@S  T4Ck].[QaG. dbr"*2&,>#qYZ7;5B=!3Q,+hMKp(GEn#FL8"%P`4@3hH> AMj>ڡ\v/XpRDd` 6RZ5GQv"T^)D9b 7l>b<0S/˪ R_UTLbTQ'q2BWzRa jqIT +i[ `#%+,,JG3IyT"p 'nQ-.&I}3%m-oUGZ. TuvN/6&Ka Ijp< %aur$NhL!֢' Dsy=8vvn!"/fD'6mQ\!.72ko&pL|ne O5UAﺩA\#Vޮ#, Ί:7W3WWVoug)+9d"d +dY%[;-MHnO= C$i-\v\)Lv8?OYb"BEdJSKir`l<ˎEkbL-B$hswm(ւ,$2kKƆ;lcJ5VOloɃ\嵸QQix3Z}_g#ncJr($=l wg v~vj.8[E| }QjaǑ ~טjY3C1J_dG<4>&"IY5c&!ZY1 jCv #Y3ؖv6%/&Xؤ:yE«Ĕ<2\KP.b.A$|=w%N]; R,TOD MIcg1V6OB6Z8eWB1x_p#(uV(9iBBgvT~)|[9TT&ަWq} ~5.WM> 1jfmt"d4}]qp>Lo58\ub L$Rk(9Σ@ _)7 !^GM{1!yjnhQcn(wKZ"xZwpOԖ&֕yYJ,%%k$WqXkFFpmutzEtbc"B%[k9 vp,cZihCElg*oyx>*:]09Ig1nc=`VI}= VU[F7dzwVFknX6깐;LPVpŵv׹7Jc,M؈b>B!وML7 ]Zځ8't)#]׬b,El≥*[\ௗN\1Orm'[e)UMܘMf>B:w|o38šIuNW.%2_crn|?8jj N};׷]E˂L1Ζ:$4T%xe&O{&u ^P[Ge`SG[%bIz *}-;RE'-ԥDBГ2PBFT>HbCfn֛Ɲrdn]O(VܟƃX+&tswU[_ Ij9 Ӓ~C2t˙WX:Z>m|30yxk[9>=4d_Ł\[pFx{$m>[c(vzN tq_n:%Ժk&~H_##"ՉSj>P2BusmZjZR k,, *U `*MLi:qQ%J0 gR$%d|&$3P116L5)-w_pK11)́Kd&%OXS' isUQ@@;r[_iT _albSp.F(zvAc6u3e<)^SMhQq4G#x+iHBrI,nnyS("!&t<?82$G $&?IoPfDP̦ۉJ_6"T%˥@9GC8efgUav$#3ӜhVF2b^R¿X3Z:4v/%IZ2D*5z*ppIc+B.E\++m!@-vMFAm?-VeoKt&sTeT;SfA% VK7e|c\4W:Mrb׃wU,iGs ۾U6&y?jF [ رMt62fC< c:wWn C!\/4mVv#6;Pκ>U%RsT ݈HYͶGq1>$Gq&T_)1Qjn*90y &;YAtD-'tuU.ocf2(jǜ#`Xd,kRuL2Ӭ0BPIBUGFw8iN?D(Xn@RV9 1w`jǵ]N>BU/=p("p!2@e3Gq=XB]BJCKu"E9!9E%ԾqEB&~jg\uek# zDM4UvA5e!1||VZCQLk{53. $0+&.?>w|o+8rzb&H>2(hF]N@>g}USa6U2D|S(yTZ%v|4"/gY/'bP†lFlm4(r3IGZӸjRFSn8B\|hg#e6gh CnVV~sq@7'h GrlVW%I*U)aDuVr 3 V]Q_OԌf<ٸZEǏEw6w'#=o!Q ccB40UFہb!-~ 5V~PGP8& EqHlPi$uNȀ> AnG򖉗h` vuDbUhHe'UKۄdAq&BPqcN2^t ɄCҀ h7'w GiP0X Q {:h,=mu֎} P)~ԗp)cByyd96 OYY D+97TIـ‰I Aq^ *qhg4[WS^'bc`xY8h09IcODy:zPOCQΩQ _@5St%a&#!iwdhWfGd2vP!<^q=Ey x)VfxǦBjU\ň$HS禪$3Y?$v#j6n Mߣ4C`/V{)V"b#}$HBrUx)*S@eo]{Z>ȟS88<ʣbd,)Q( D_ꤎG!Gx v:PK^ʇTP="huO醟 nj4׵7]zWeus9'xYOzj3*; OhF8F5j˘s7ƢD4%I@k< {0 J%ʪ{+y<%k!jex哧ŧ~7ꆴ>k yDDT+IL[*` Tq1g{` >+yg?5i3Ǒ k4| Y|G鐣QIIxTn⚐-sZ]?=x?yڹ9R1抐Js빕X Ϩ=kIټ!a8Z:*!Ef7k6 3}k=H)KHE+9( lNs`"SLxZo Vx_pL`Fbk :90 uz' JBo˸=C ;aw#Dʾg/לeڢsɾFT$>4;rRJq>i6ĄFĮ; y|@]2H̕ Rh.w nR۪%x}I*UiȴjNq-PL餵!}K?[!G I̫1k8D5Cğ3{c^<+f1E< >[wڲ#\ ;9,>#9>¡̓6ÊȢ[ AϦuA|ʱ~Ȟ68 ~nŕjF,y\ ,Ø͹֌"\kM*̓ kXNF>!boܕH.ݨh{MӶ)ӿ9C=n<{<ϯ5JDwyѐU[Kw|Y\ܷN [~;˲\i*RK,wL I jzSwg|$kьI=o-d}68{s\հ$̽dѽd -E}\9"qF Pͤ: : zÂ: s<]Th_a^]AkϽR11*[{WuDw] ī2A"9^骥K5==yi9M2_l퟾.ڥ cy :HJSqརq9˳aDGlތ?N|dm֬%۾(]M$i&=DCQOۀ^KL?e:!_A͐ ͍G<%ټixӑkU)b(,1N}Ee sqMae-ou);γ=\׏nvcN.4Ԑ~4yn]vL`ҝ{୐`lE}B5@̮f .2LZ`P}5aj w1JEZ嫮¹f.U-U"% =KnJ6T׶H8{7wZt;%Nd|TλP>,%SG+hkem>Yj[.dlRɞa"n> @+ܵNប;BBkE:BϘ+vݑ)Z=$-.jC\c;⻣ aNi $Cms&l.MロSO܅;$3<`OW-Kidό{QZ_quAm̊[ڟܘ~u%h|Bٟ2mf9-T5*CR3*MUO?ÎuȉٌhpZۖ۵ق;lϯZ=oWS>h`/qNX%8˔tVeXA3xb R6Ⱥk$`eA a$0qyL8ב$G֬dMϥG>zu|Q,e-W:s" 2d$7ݾ|OTˮ>O 4D+"0;ά 5+ $A+JĠ*(Z+(+b+T(htƇb,zLǺTkH -BkdD190 e|o I qDjI'<3( 2G)Ȝj4,KĜlKJkQ%dM5 ;Cj(\2b n:RG5TTOUU9rb"|êAN9]{Z il?WCU|BI%165s1ڄ^z*GT1,l3O7מ3u+zZN!^ZI3\dRa\u̅lʅ+  \ o5FAe(cxMkJ+J\rT^8n{-YSzס>p;(^pha/fek\ mh7.6f6ʆZj C4+ C춹k%v &C<:q/wlwFt|FvH~*H%=G_tq@\Nj K%xKt݅J-0l|xދ?w=lvhdB,\! 7th9Ut疺ٓ\/h7S]ߋ؏/ܤ ʒmhs qp>P!Y rY\|׈ Bc(a:늤 Û+[(Ap`XBˬ`Aޱ72,fQV"_(/ެU녧J4[7XLskNb錎;VJ1m<_tCldzGVa},(g=ɫZbg} YA_ lGIhvRຝYtf7ۈ uOb'Rr0Ģ7r*w$"M4ϕ2bKl^7:x3u'9a!s;m3MC%JzP&##+=pՓccSWt;?iBNT|[[Q٘ub.1gTW Sv4+iҮ-"A_->E]ct2JRm/]65wdnRgMKG^dFĽz95_SCHgJlgݎ[[1udGVMֆw褘8wO/h)<3w}g:M{7m uWVuX7 '"JQSk𧣤-J4Q .&ݟG嬟 X$)|N8R*Yt83%qnP3l{CAZQi5V|y`kc%%\:^'cx[yze}qdZ'|iDŽjYnj$m(sza%lcLYS^@2H0\ZFOЏfߤ˖rQqTCWo,܊gI<z)\ W%JՍR%r[gM)2: ѝ&qg:WSn[WPw} Mnﲳ que}-aMpt1{ 2;1\;>@ 3I-;vÜJk?뽨 A2쪩#>88{ ؔӖn9A@ 13D|$E ƃ6ƫdz;=˳ÕA{KA V! xA+w!ЛC5dJz &l?m.kŭ'&>L:6D.sE/ɩq;@ʈO*_! E@ ;Zq7)tÒ0C[#$3@%R\K4\s I @(!#B Ȫ+ Gyّ"2ݛECG 2$//:,2:{::WҌhs-MԀFrԍBx;L<$90TܣvDX(_d;LlKE\L ,ɼ)6l{gd۷ؐ@Fz @5㖆 kM4Jq8l8`3"41䋫$DQNesp SXHl!I% pɊIJD+̲6¢sπ>X+<p4?y d']OǜƬŬ:y2ZA]F*=0`*/ Cl5,ëJn< SA(NMx\>#Ό4AeNwJT J*EiH J&::MDLь<Tɏ$ (5\,eO s)}O-$;7e(3{s)_P6>qN+Uqr S]:XSMOT IwXU[ [BY, Ϝ1V4k3K e0ХPPUmd-D˻YXpմn[r5QٍtK eELmX 5N\BSHMYW>(Z) Yݣ] BU? MukL>W+ YSSbлmV;UG, [ IlK3a B?.[ea YMPgjbCab@Lܯl\F߯22W$6\C_ ηEݬm/{e \ 0]u`--]:C]10`|?>-!eڕUM5~(>^YX=Z OE^8^^vLq^ e]>^19]]`բWL`%榆&htf ϶=be{ndh}[iȚau9%"Eܸymג.j'gDž~>h9ν!X R꿼ӝ8 ll͆X ]8_.2\v8!;{dkm(ebY6 f%j]gefjc)V&f2e`i-ғ2PksEev f&>\y>ln3tF:gUlPֿ T/ C4g&}ploa~nP{Ç9NNQng{ ofQm<6q^dܝ^<(+n]d3hBd%fglr_(V?iĮv ~lݹVkp@3P+H(#!xYw[Ko\MOpuS>qbOqG]cz]-nh$56Xmnmb$/xgerwޠqJ4S{trnY3{&x_r:Go2ܜ<]F?!{Y^7o&]H^Aj?ẋDypjj:LgWi&%~Dp\e-GFDk@/z֓Gt]`Qx7fѱ$-ad XͿd'oh P9,Hp`ANVd(1ą/Z̨pcE=j(Ȑ$OL reI(Whs̚lI@΂7c6@"Q=6igĦA"(T N-AѩQ~+W+>V-[nBZmķvBtwޯuV Lu)߽Q{:U)_H /F*y1䈓/GμqfŘ P4ѦK a=;!'SM %n65Qzn.U|^X5ǛOO~4/3>@sg``[!T^A)EZYnV 8V\dU8YC)ء\V-蠁bm"fX cIՠ,B e( $,r&+>v1dFJ4 I ZG*SuSfm[q0xC}SYIUhVrUdwpRtigw'T|͇XVSicbi`[UiUVN*cy*jY_#^a%_ʊci٭ba&irumi^iWlo, ܖN]_ݚFz4V wSJy,jYܸw7^+d)2dAƉ qũIzZ*! ^(j&6*&~ù:\=B׷Xd%Mhq{R=uKO'MWJ˭(jui } mGRw'4L*0=kz+aRrAV֒#i0cy眓@-HO2 υ^+-ɨ3ΫZf^p',AMn4`7_تiWp6wgp׋ y\xYr p7Fnr1%X1 t&2Et3|d`\,,f3ԏft3ᬄQ*d>!Yx7]b̄!Iz7& 5kRWK&*~n+aTQ Џ!Cl؟ֳ&)Mkjӛ4:)O{ӟ5B*Qjԣ"5J]*SԧB5R*Ujիb5Z*Wկ5b+Yjֳ5j]+[ַ5r+]j׻5z+_׿6,a k.bi}ck*ٙRf3k^%jh#S9liZ¶e,m+bvmo[p[JUq>nPK^Wt]]WeKNv]/uYEp^Wݮr_Wlrvwٛ״ &n;wح-jl[ K79|¦5n;`fq~X[6pWApۻ.־zdX/ [71a1/#c޲,1 nf,]-orw_.UzOGkμ6YȽ]3_S$SVT}{WX˝ XVXI&qKbM#wƿկlcצ5k6mc#;^6gC[!!,@   !%+0>CEGGGGHGHHHHHHGHGJG]GbGiGjGiGdF`CW;I&PG$TG$TG$TG$TG$TG$TG$TG$T?$T4$T($T$$T$$T$$T&&P)*I/1@57B:=CBBEBBGDDKGGTGGUGGUGGUGGUGGUGGUGGUGHUHITIOTIZUHhUHjUHkUHkUHlSIlLJmIOlNXlZakaolc|lal]lWlUkUkTkTkTkTjTeTZTTTMTKTITHTHTGTzGTlGTlHUlHUlGUlGUkCUk@UkAUkDUkFUkHUkHUkHUkHUkHUkkUkkUkkUkkUlkUlkUlkUlkUlkUlkUlkUlkUlkUlkUklTklThoKf|?d2g,n+r*s*w,z19DOTTTTTTTTTTTTUVaqlllllllklklklkkgk`geah\gZgmwѶִ״׼תתתתتߪتتت٪纵ƴдͽ!H*TxÇG64TebD3bPCC Hɑ"OhHʗQŖ#^̙EH6;^Ȧ%ġ.KtP8et'WNYrElXiYUBS`b;MN{߾6|0aZa˽l K˖3żYΝ2MӨS^kH ha7>.q߆*ٳ!綁mtCq ISK7`o7PBm^kSC-dJKc.pG! vaew^anm:sl8g N(jN\cvnrziޮW݇f \E$kFۘooh^wW'~k!l(UH'3C͉(ڝՒF"'cIEI:8S(0[3|p,l$c˱Kof2v$Ņed^eKuQ&Yd4Ӝaev6:(SjDOgHsgJc&j<"P ^MXd;emİ+{?ߩJZQ.]j%M~]2BIf۽:d9cnrY4)҄e͉-lyA(m+{:t.?/2zjJRG4ɸg4lHԉdJ SO0n-\};XRIH>W~FPQ>ţZO "&W&=s6CYrASH(` Ά8[o:P5EAw$-HYlB&X߼8&ذ U.v*eI=γJ[$.\J,AsF -bVS) g|]^QcرQDi$(~CӾ7<шyΛ"b)/`2T"lVp귣"L4S7(%*JJBQ%7' =9_$)L6(}" S,~*[d^7L/yèa6!JBRAvh }mH((MSp@OaNu7@%jT{)">^s  h[ "žxbZw%NĀj!wqv`ڛ ?ΉN>/bQHXCNgDe<E PEC8LӷȢd:Xv.E/rj3EWJj5m?*Gg$GIAI'YW@.D`SӞr eSQ^+"R\ΐcɂTPapm°Z֖Ta>d)\ IܢmE!ag[ Q LE-aGAA=_:mqhBe׫"&eIG8YdO#-xߐn aH ۺe \; ڶseDu{EoHnj2nBb3!WˋKWH\&τ-è|)G$>ucIP^ߤa0dQ kFSjǠ! M3kǀ[j5fuEqҝ6qk$+_̻D! ;6M{hJ9JiS&v0i.PWkr 'C+qoU +-).$ֆbbppB Iǔ,R461EYױAEAiXFwgjW XR?${##ЋdbdM`|IgJwm\K u4 bQtTcd# .D^\.T⒬X|ġ%] BBñrYFhX~t@:GtTiDs(V]J[9>/\Xoy[FaͿ;X`ѵ)pEuM#I56`ߥ7lQLq׵! ,r YQ,Y1IaHd;. %Zlwݯ>*oc-+1d_f_K5Yl,fT@ 344_[bI(B Ph FطsmpsV;ks<-|e*ǰ\^s3#f^{+r$DgFp5VirFdzd3!\tzDR@HtIr,8$7Lagg"V0u6[e8;A 'P@E tk7pKb8Cz}%zdh,=S\` [a0 a rvXS1cpaC64h#fI?d24$nyU300Vz ({O$Vc#%fPr{Cf!E?rVN1u_vAo>8NX'XEA T( xjM''4@aTZrC$?Mr9wZb@8nhI(\XgTRJI+3Z"Eo] 3@(W4;hGtX;Z( eC~gQ2hqV4XuuiIR@ @ @I &S8y?GS^ TB1w=Y R%rU` t kx3(l+Mf@e%va*G|Jjr]In,uU3/] X]Q*L|A X @2۴mXhYM!,4'!(eQ FJ h<$9ipFpA^v$HPˁq(UhY@[hf^!k9XKr 3WXT&WAn}WLVN'_5Q4?w]{CdT@Qi],;!RPY}FE}0 ;x p7I0cTZT1Il$TUSe`ceZh 9aK `/k+B{dx]eZB;y8LUDu $?Ly!UBBG@ud֖-2t,6 ̙e+4I)%+cA,ԨտApӇ9`ptr1%6-\n㡭uDquiťvdobU溍/+ƅSKTŎFE R*Dh-U3&v?lq`oL c-ljpl43+$>$ށ{"+#< I:z"'=E쒙sX".۠x%[!:t䌔,aP9ND[ZXN As* ;Aɵ[%OvX.tnq`P|qE^UH+ /:tjnœ|S!z@&v|>Δ ?Fkj gMYxPc@lڤ-n}7nC ^xUw˜9xUyw2|װ##+aU y5Hi{rDv{^^p6٫ʲ\7EUɴb(­>; @z+bJXo?;v$D ʫϺ60Âk)GS4ħ6ȭγ3 ĭ&x a4*IءBI/I˳ά c )xB"i2ZSL뫐FDP*u:͕h0 C4ޜb쌉,̋#+d̨͂SHqLDˬJ/T198Ӯ K)RcB5QH_ʏC͋䈯 G Harȡ $*A.y'lIu?AubrdXeN"F>k)ƣ[ !? @R%8(X[hmC@@!J; %C0CeD7.RCa΂ܣP<+;d0'C]n629 ~V$4uL&/͆(R.хR4ĈUԴصbDRn%#yB35B't)O`(,b[~PwK; -K GK`a[^ )^029N56JHUe {B A4&)ҌZ#)f:!q 4EIݫX1>YU2ڨK c&$%3^˘$CZhblk@ Rdel( Nqϩ\" r|藋p7] Q8|%r8g2ԱNu`@@0y !-JȜ8iA9xK™~9]N яU7VF36@*Z{3TՃۗSu2H?2c"Cb&T%_d̚&6WSa)0 LŒ5`. Kͺt/]H!m'TJǁ&jxH>B<A)Dv6%p )3ڑHT&PtU ;'BY ?5)1-ɐ-\'LtYUa]mj.q/:ԖՃ+#eTegG /#y-ch,Y̫J(>*X4k!~LThFeh XT66k=ʹn|,*R!8ȉMI0DY袱BR՝4yJIF|ugk8 *@U~}W64ѢHV,#I^Ͱic.gҾsuʆ=ufDfB^hT*Pe3-Z6 @ ~ g?P/v '7BXN5 UQiO1v:FlKz4zneiD8ҧuC^_!ӿ>vi-%2kdXeâa(\>, 2u?fkj&(U;z/5&Qf*]ن,f]n93iIjP0$Gq4Th?,7~~oxD/v5_RNrL q]78aLid["ʻnBh4SXt֬#e#B2;yRm#NiFqҊ;af66c/C/8 ,P2|ڿP! `8=j: ,9ظ$(v{,1 Qx+`sꍜ\75K볹ZbyiJ*(?\W;!;[+S)$2{:_91{7b;V;#;j1XCؠ01SӢ 1C"" Z/ԅ04=[0 4K(=(((c4`,FN3?S_l{T'`c@JM#5y4s#;?(k@8iK7 (;TCZz i y 7(JsyFȕ+5y2; k&ihIN3é*IBA)ˠ1"$0$Ṝ2%˵0iI\YΊ8"R{FCD\dyH!N#a:[:BB< E<929z,L\st,M^tx"u ]:5 6 `CMaIt"ÕZ;?ZrdKPD 8$dp ۼ kI@N4HQ.x¶ ` 0ˌ 6Zr*M|/0mCSs lG[# 3#,GD8-P<9RDy6-9+ S;QB!C+W+٪##2 d{ȸ),!X R<Y&H 3Ցc[9%{590tS[]0(,Qҕ :کD!YPq,*zmF 8'|H}ډ9H)&dLS᡹nHGhӡ$$-+M6dBH '(ˎpiی U "ì ?̌6Ba˕P>XBcK*,\䃵iOʥxnC φxDb |p hE{ʭBШQ14 ۘr% Gaʧɜ> ]1Iـ+٩Hs#n]L4L ,:J-<ʌ"7jYɔGh0|'Z2OжV P5U;U9*1L!sErâsQ2SrԿ=%]`MʁW8N␔cQ~ˆS!|UQ*HMё6+,Q۱dxe$a*E0`,6 fF%Tp,شhn cP{M}㵶irN.͸Za$\J%ה.8+Ѕd + #,Q$z«#YJ+{K\@Q P U3TRh(JKU 98PȎ2LCbQ[*+h}+e-7z|XAM"9°6 X83KA2y<`PiPeN%&/8 SFe10:2#.0632Uu婑_B S㡓$[Y25vC?!Ü̏RP9yJ*Q1 :"|n;gȃH؉*#JI}WʯE"ǤS*7qʊ TXv%2N0:Ÿ5ZFy͒l|>4j/VTk(MM,p6$v/d̨jV%k/Z4ɩМ*16[ ͰS&S)o7`6G|ѓ{/46ΰ.Q6:KSļQ`'~{9 D0%Z%r?)/Ζ`0g{ g#d Xs4BХL N݁ـ|~khn^&8Re'&s%_yБ.r.g؉وmNE %ŗ5p؟ST:}Sm\l82ZSć,oL8m )JCH9$ B²Ů`#j MsiPA7,UZmBu vp Z{p_dvF%^!rho3M]ޥʈIbjIק8u˝;&wbl1X%` t`#ECGxh;`W. \23B'8 05ZlmX cҝ\԰~c 7fAOkOL|hЩP@{LY+2;_4r~$[ !`%f4ל0whQ Դcw=}TqsT?ܯMGkttLG,U>5zOCOFL#RmU@38G5!:FyzWj:gˉ]{Li(ZB7')QZ6G ̢,81Б!:PBi#6qDžG61$'CTAA]+>lRUS&7<)Sf24Wjd(KiJ&[wMJU*լU]uP19RRhɒdVbC6'G64rT&L{J*}'-X1edn%Sq%#4"fLРG.MY2ucR+nݤ>pVe͗!?zDvɔ;2P׵Fn3KɲL.UR%v(q=kd ro]MS x̀.W?BZBdoÕmY<Z`*їjJs )_q)g\H+IGQgA9wY]{eCVIEm^RBe]їޅ)Hs)EBtYD=yF9igMtBxid^ESQ!uS*9#Pb')]F|2XvYGJY5_v4BGr9$VLU.tJ(LKqs Mb!\myyDYR[=[7QTgq{n?4Znhb~iY}u_z;XWOfFt'iNFB˥鄡B#o1^ oCv4Q4ȡVz؊(bZ40F+0+#>5LXM9UMEE5[URE?.d]QktTZa.jř謎"OƂ[ˉhC%'Quf4*19 *fN_rfdzWQ29INEu#lS1@؞$vVwM{tF3m.jlR-s}DQjRfh\ǹ;!4Wc;NÕ 弯Eɠdz2%\FD%{>>yFc-&"RXd,ɖgeW4}N)(EԨ>IR]~6204?:C!bE GjVE%C?^+!lcCڲ-IMSЅIZ $GA"r8J VTvu,B&â XDJE/;JRUܐ:0r }G0HP5ӓVbEWKS.5Ht R&=B!Ŝ\1isqȚ&Q$mUW/wz4DYN%3RGNB$AլV2*W9IQmRsR]Kț gɨ* H6ALd˵Q ̌6 aayn5O,AO7Xj5(v C{)l`B 7.H[¾i330Ȃo4!j~[8Cl!BJNB4Tk̳.jeʪE ɋEKqqxӍR杙:U?vϓ HO,夐uN]v$/x"!9BT ʖISksU7-*7& H' 6۴G$qJKU[*+TZ[b4&O>[I*=$ YoJC,a (zL*-[ˡ=ZZ]6BWEwx= ʙd-{zS[gh``~Rf;a,t\J釣P!B+Dy˱) 5!pcҸ]RW1H68SY EΧ[R㞞`ECd N8Ĕ=$[ ,Kk-YɹB _G帘v0T6G0'MYg5rN%b^q@,¬%M#z$ I t,ÿ^Y"69`2Lp"K"6$@0r0rД^>ks0}`0oVԂ_lSvxBea~TJkUocj@65`暋/gF_οlVϓY#'z!G5LSAkm1︆k3meRZI/J, c%dݛ>2 i4(I,"zRyJb{e7xg_;a:)fTMTؔ(,SYBM/Im3GvHSUN79OQd9p i]5a) ffLZӑt ~ƀL|EMu{H0)E ѕ~ؼL֭RѳE^8^UNh{ %ͭ\2^(UԄ\d>XtY;EHh/MERQðHА3L2D Sy\[iمLT0U,Te۠= ZUP9mDDH_RRFaTfPy'=K+"!iE9 ]ˊ$Fʢ!FI"rP !9`UD.VPBKg JDF΂C JNV^KND'Cv(X`$Q]R-!Z VE$"MAGUjqOR$>]=;Gko"ߛ`FѢ, kC7Ñ5f4 ȤŌ{4ԅ4Fv,\FPLOF$%od^C/ v_֥pM"r G\qE|Zi;v$e\mԅ-dn yCZj !t2eE:4J}2=gWDE)"&H[脺R\P܄Z,)JTRanzgo 㫙᷁%=[pX4C'm6Px"rD h8q~e6 X`n ^99S2Dv,TPL)9։hJz8EDTY!lI8n>b8V^ `'W&u\s|dKPLDY.8Yruǝx:hGXDJSfEߡYgW"{Q2xLLU0elWR\c[NJW0FkD4TxU RkŧZE /Aie(!*G& &^E"P]|m$$sr8&ex,$h澬GC2!b_29 JZn D=l%k79HS F7Yh!d_aܓBx藔R慜.m.,<*ljg]{lWbIm.DЬn*<<[(>mnѢ%kN`yII-]f-åHc{ def gIee6uV*2)/JcFUB4kctiŽ~πLd́PuW&3rd}dRd2PJ kP/R)-R˯q+jc,o^!MHp a^~mFFϴM-TfE*f$HZ5uͮ>=\T̳kx }a FXZ%yt4_oL'LF ieJmEW(JTQl)"**7}+NMsiP+-RztE| H1 YW`54>pU-zdrɩD-3IbJq6H)ŒEs0  G6Ne(fxg8DNk)ɄpI9ኰUZ*tpa=`&9SF+pXy_6w>GGgvtB|ӊ݌ iV,r:ms }2'/!TBdz-D7i)ϯ^an*!1?f]6-CHPWW;+/Y p[c']l8{ZEh~+'D!YVJ x NEF̧qv 8WHT;gka6"Wj#Y(k(|l=6Fan.}k.n>l2/cR&b-TKXAseX r Zu$_4$Q2s|w}G)7/bΟYRp7M/eE,X߲2q44sХgo.xg~ɟ5⭕ 'G{x09 dQF?LTiSOFTSVź*n+M`nV.m[ ;p-]p%Sɧp2ԗbD6YTIӥ&c]tEf.ʔg~r]3a&r^ {k\uòU+-mmÂ;@8iȉJ rUDA3L:P?OAjA*8R͛GN}M=jHT!i+,@ rȠ0!U걗*J! Ґ2fz &]6MEiT nޙ[k  @y1Zh= HLr#0 iI,$#0PL\-oʋD6$1K=[NDOM{38.ϳx=Պp+.XNS t2-̱ *2,]KfRډ<u}bM nUWΐJΔ󪋄U3>LULS (+O"~vkۖjsc܊3I]5 !G#]wS?N}}ܗ. R6}P8aE6ZI,&@2)ES$҅N.Mߕ{ruqqiH&qn(qnt$~>֐J]QKq>*.\j.I苓w3B+lm| ߸Xk43F:J_tOCmā1bvUVkMݵh \~!Oo:O7vhP ߩ虒(hIך8o ~sۣ\O^y#tS@fkUQ~c馅N 03_>t&feЉCF#R7 ڔXp=ِ"$uA0yϣ7X֕x1eYT'-5b;ֶ'E}STQ D#.EiB3YF7$CL6-3Eb`'<.5b ^3+QŦ' 0n!rB!B(\N ! w*^ylGra!d-^bsGRjaC>D@~' G^|i2JIPt4)oL屙hLKݻYaPhdD"4uzDOEEjO◌Q) 6hQ|]S$M0!Jj=nCq..~YUdRE6#iE[l5umʑ C-`p w5TRoPHзt_P硡)_´&Dh"Gy.!Bl?(>nxõ% qP[fT4q"ÚQ4B?it E~JCd'`BǪ2樰b*/\=8bO [`<];hfF]rf)T0Ij;'V6AAR[GONRĂ)ι&;=& Bd;K;[({?p$SEH#-*ɻ6SشI2#d2NV[m=*p@ dНe9]g:sSI>6n񋓓eO!3Hsޏw3D\.Aj\fנZP|D)Oz^MF2.{FG%J955@~M:BG~ɪGx]ؗƕNy[[]nIʒ<+'iڒ׉L POg&z5[_Ѝ~7KTndmΕ0)f7HbH ΨK]h_O:vyr%|cOJĽH{s䲚˦N5Y|/BԌ![٢/-^[?k7j.by]N b 7mFIݰ0y w|r /دiէVs#3ٌ dAH<>oX0DFH_`<%O_I ]2 \J 5ߣB۹kK]#nqel?roZF4"$o q?||g,k$eոnb=mX+:b)t!pMr- %lr$,B2Z>"\ 5$"gXpȩU&5 'pK "h:<HŴ*20)M>VBjT @P00& n"jʯK* y (/_,d>ED.`eXdrG@"1x@ Q,1BzCaGF6h-)."=bF@"-74c'KcGLJ\ q$eddK'U.X!0fOsżU M"8$+ON/"2 %  P>Z8DqJ3.JL|BsA5Lz?9O[3td0U4.4`dfC V Ƅ ;$aδEhH"* !/!6h1kI4j*6adX&[8iL$G,̵np1 S[ad(!djjS4L6E=^iԏr);u ra*<,SKi$MbO=7ⳇO1Zȫ`Nl:VȭwkrZwrltV(b1QC uU ;[Q P =$"1yW^-}/3Zwi"zo(r$&&!lG 'b"rD"Fŝz} 9[qN>ФzVNS2+8&0~1]wf6PV֖>5-"2.Eo cj6'(AWfgEdbs6G!$c3v6/mlY/h&bV"#$W #⎕pqWjWTqoL2ꭸYEHXZE%t|BAf]+VR}*K6^e5[R`(j@L0%' w9E^\5!vC'nЅ)0+"t(VY*#6D8N?NO$9>R낉"!rwƞGj4"V4PLPMD0I3 㕈2uDɒ^+w4wX9E^mK29Df!t& (&Hy@ƣT - !]`uZ'ף) >7` !yn`9 kCdEh)Ye( Cl*Aj#l$ʬ$1z͇IImA 5>$h$uR[giM.!{o̭ZvFq!0r pA0Y|YI5S,k[p9;9B[|]BWף˛a[ fT;{ҙZߖG2dJsB5Kjaf WD纳)\UK4u9ôNUHdJ"۾B~Xe9:Wsyp'{۳Iӹ.ֆָy,9m< G T.8x 6:WSWj:s#bNN<ݔyy=_ N?Ucȅ5t#jw[s4O,qw^M]:GkŇ\" kܟJڝ @CG64IW2]kx5i!tSTbc($H EvMFX(M cƐ4<3Q1ƒYBTcҥJ2}4*ԩN'J\Qj kSCta7ik[_nqvmm٨&Öl&ZKwt:[fjF]m'Ňn㹈>~ 6]شcnS"剐!Æ?O<^\͜&)*UUeU2 Kʭ^g=M>}KDc0=^2b`ZlfZd %rҨb7xWě.$cZ:8hZh4AqbnfG`p5:Zk j^iuMf5Z4~kC)PvΩ(TFQj6ePEzn%|reߢGו'H IQ Ӽl^dk]S;PxpT'W!Xa~4A:fXX<ӱ*i]%"q07"eQX/<3y2Tۛ.tL?k'xO7a` [׷q9 >e'bZi:f$MguG dnIV۫hoUi^X'JL[–eբɚԞ;Jo0Mz].$ꪧzK%%~e+\.sRXie5G?ݾl4%ɑ5Dzxݐ= D%$CM[D.Ҭ/JoIS^/;uCSr|)k`5emNeD2HX ]v8v07,p27t&aRpr",]GC x腆jn$gDVH+: ţuҎehkzyA*A݄HYnGto("WwyDllqˌ0Xźg" -Tۓd<;_!W6@zI_r3>0n$Crnҳy3^})s4)Ӂ\3u>-CFhS5,n&X#qBm{;Y-d| BB%i=Tq&7 )永fznH` +ǨSki4v$M ;UnHMA0Q(|gtFE|V4!^uc!H\*..@f H ;^ ը$pEni $ojV(ѢS &eI!c ɚJF2 ^Ė*c"]Z:餩J&~ 1 p(+&MCkFXڣD+z(ư\-c,-I˰W lەaa)$n[)o g`[aǙ)_#,m u>veZ8r)(6Pkg;QAkJG?"]%42{%2]d.L"J~ZI0PuUC0|IU.:â-M+[y<}[) WO4$x fG 9]HCӵd6r$DŽQHC쥦vxta6.hϟF8n0ĥ-l>DE/Bnh#wq'p|k # B7Ty9Fy\~A~`;؂c sp>t VegqGՁw8v{#gr;r!? fAbt,|?b VM(HUHB8$̄6mrVv/~Mg>wc1e{7u\6Q~FuǴu4vzube%!0+o82  X2J2Ft:a"e"Fwy@%8%FmgkU@`dD AkAg#6$+ru==*W1ArI(P$hVNXqF(eElTzP9+ׁFsJ|V_&nJd!#<8 : 1J9n4#YfSlEwgw6N,_}x7ljxt>s}/a!'D|i{UC=C RLHϨC(uE3ԨUx>uF_ s]|4P>$ Ӛl @^jVSg豑-bBç 8N9NB4>fADW1$+z:b)ifؖQ j{XWH%f:cwb{%LZqv~}jdl% E(:j=J_ັҺh;;2z0,r:;jl譕ڱFK~ :,8^[:#dRz-ڏIw4ɢRJK+%*z_~ۊ ֲ:9mZ燆d˕oĂ`Cui';;)L+Qh{۴L;V*ʷkzxz;uje)dw.C|z4ދd&n4Nۂiv6&\VqtDmiy hZT5ih@Lem}j`Yj)H{`x-_O@^!+F0YByZV[pm4[X,̷*&ܱr{ۛS[Æ;ƕ,麤.YɍBŞ'&S4/K ud=bñJjdȗk_+O7ƭ52#r\+1b *yYS '[|3= \3|K˥֦ݪLu,ʦjN&Q`UܭTXΐ 5j+E WLlfYr~w:li<۰x K{lmӜw32+0-o7Ί\Ď,/C :|¢~ 4yֹCKL[&DO}a |g튾@laٶLʧ*h+,ה|b^wKds)Zs$̊QUKw9 ~ ̆=#\EEZwy}I,N|؜ͺy-n}Z-?X]֭;̫HԹݲ:h۲M&RmЦHLV#= q*E=ύMR*Zm抎"H l5]lOŒٽ4wV6PaT]:Wϟ=5`,a'ٛ-LΘ+ܛ JK?[J'aSgJ]qvۡ^®`e?K٧ {F>1+f΍,aUE~&̴Z O}-8eaZYĴݍԁd ADU,ye(%a3|T%~pjl䗌=W_Y F8>:JϮZ""n` n/G_;d΍U:urS>Ǽ ~M;GUHLiׁ:$>LI=2 >g+Չ" >{mE߂Z( G1.]81$aÁF|XE3bQNj$9dIGTn`Ô%W49s ͚&oN9 ,IsQIU$HgDNZUX^u2+ׯa"]T9ETpmѷ.wY7gY]2ЩҞfę,Բi fQeSMKyoѼ5 J8i ,89VI]I vƆq;ۣnw '>xqǕ'g9<Sڟ[ge<W%˖k_qİr"VroauWʷn%4a[tc2DkFVLl5 1u=-fhtN5}g}s4fj/#{y^’o~/=SȳwL  %1TS]P2W47?)ާ7ӏ}/aWme3n#L5JW>."R^ 5X+ r0Ea[ n*_>AB(4ռ#FJ9Ѕ1D89]`wŌQvzO$UNctTuFb9>X f;H)_]ZC"8p)pܐ 6I@_Z\ p[pL\]'E&QZ5BHh3LIW##|*)V$'~ٱsz4rBNx=ĝ SFL}($# d T}Xdq*dEsW*ɽj5[ʛNoV =I'hÊ,<\On.Z|}2MmI!hA̧J# !aHC}us5!F#ڑQtUJJQݚFe ]DblNUmsy=sqqGX Ij-J5un}#oOb!ȳ0' ɗQ%_Q-kKY24PN.ڴy@LPk֍hKmeshT=ӘH2!%_^x-&Vj,EZJ#d/Oxu_JЙQ2tkb%N^JKnL)KifX2=\Dx2ŵ)^ *?m[w $S/k(ΊUu dd5µoM<9_sއa%vV<4k[s l=[5cz?U Yd*UA^EFrQJˠDI2VIﶗtM ̣HȽLKBt*n(ĹMEdF.̜/yȬ)znyv\F/FgFg}yƧ+rDљo"ͶfXPP6t8݅pB:TqtYZpCgA2i6%NiwP}C)W||jz  1~q(1q~j܈tJ.cuAUv1U7Im/%ZM켔^ݯ3&Oq{]~i[~m 8 # t Pv $1oYNhӒ>"2%Z,릔qq50mmM%9yܣU9j94NFcfHY{ο2=_6mآWOǯ'9c;/Q|=,14ac+P%DBJv hߣ60JF낾W'dV7N0#N#TCK9% C9A9芨΋9S 7Jh5&)n99Aec63*ۧ)Ah/3QӺK˚,3"|7>A5`z#e {Y^黳7ޚt $Z tCP@4I$ՄS `ēO9- H9\Cܔ-p=;t-Q/DQs,5mQP '-Yt,R L|U4!ܝhY 6hLD9/dRlv݌R:Ǭ9nl_L-Iyr; 5)Ξđ0vItYFxG jQA͒CECE8LJJq 88MGH%NKE9i0̐D&*QP7Ӎ@8-++\ONt6/3OI8|Q;@X44,P|}%3VChM\P$8 zNS:D<< =T%JW;zU5|dDF}ݏLW̳Q+"mq 1OS}";XsEgX?R3K׉o32mE/ N%ʬ& dShgJsڏRbiʻidd;$GAECMyݰFL5JԬ5έZXOʼn% mOkXUJ(}JS\R V9[%OF1 BPְYfuVhBяgyH WVT{€٪MЧ@mՍheTScѩ;~-Δ[ME֕ ;Z -FG9)UŊ4R3bқ"T 1MYeEK3_YY[7Yr ӚϜߢZ09 / vJ2\P-`6`1u'nDMw" :aS.OUk[ˈNeDmX;4|aUCE"^Ěl = 1ّ]Q%ܘZ:<EUKX*MU$E|1ج)/6}E_H~-[ :&Y'9<R X}ދd[Mz5TݸudޑL& ! Ռ_*Zc1ag8UWa21F&e\n`5Le\& +&}]@Յ<N#fknҋ\aA yL-ׯaNJV &6Ͳ_b],RB1 %V^DNk-M1W Eٕh›ujN=uS ߁JͧE[5dC5aINWK>C{]15K]e\501ߋM^eS_S4uagYj̋XT2en꯾egs58xw›Mh~`ܺB}4Y1\tfkP]볭OTI{%5^g|[-hѨC.4y0N7&fۍhvYnO=iFNi03!䗆LLjKxp ?> 4 kuSf@_rA({ :?jq1Zokk`mu6[N 4*6m b ϔ3pHOE+mYtb%&qTa}l"{u fj`/+?lf4w4jgImj̖q66 +7p.o πFQσ >Vҍ,oeYis'o=?'ݰmMady~e?mqgw$N&QorJJ+.j. _::+rQ0zr5]fu s%u.q`le&oy^bO Emh^b“]m׭'jh=^m7 MFAhsK/u: G Xfn`N/bqv;Hso@Sg1 tKd xE ʹxtx tGPqOv>VGO.tak /'uaf^O>`}y0^vzc'_Oȍm'fbzv[YaMbz퀴}蓟mSwn?5)wmhZw|;~tA'>.i>eeV=>T W/xyIr7uD},X^\Z/Xq KyyG`{M~u_}?98.zLk7jnZOυlAL`+ڼQv+&l/S{ugy؏Q>~7QmGq\43fZ8†! Lp!B6 &tÊ/ZDRUǍ,HJ [*ʙ e"yrK9{t'QE 5:;*=I#TU\ ֮\"5D$L(؎n#m8[e1B$7/޺,xo`EXƌ#y1o a~l9_9wv嶠OoN9ZU+k[-_im)<Ɠ쀷8rΏ3.ڃiB~ҰH̙nGZߟc.nCKo\~׮TMU!xBF` BFƑ9!v5!YxWF:Vh#NE-aM墋%&D*\amdIBI_Q4*HSPʷp>9A#}\4wy'#͈#f7YRH]_cbܟ5SVT1Uavdl6^gQꗆRĩ HxE6b0Y &y:)k[F5iklC뛳BovHpEruwmsf{3fõ-g}oO] XDmZ CuuUKB+jj.$1%A_"c!ء6RwFPr\3R:CF1ّ霸Oft$.f"]*uM3I04Q]m6lzBֈMp/zUV! ї k&_Jz䲆,zWjuסLݏ]>:|$*^1^-{7 I 'b7tz zYj6דpd|#gXanA;,j"ctiRH1M0\50!Ø`1f'W^Ad-wHT?]Pikx#ܸW-"һZں=yI D9+GQ۬<tvъ^FP!zف\ظ΄*48;>uifrA/Xb ZEY b]ljv #w;񓵛K%JYv^W=(,#}҉-9Q 3waYǬ'd &5ןTy zh=s Qpg9$C*p; wډ[Ek ?/rDbf9{ěΠ<SGlX:fQ12l w3V}GIG:R-*3:Y yKn*M"'W#>1: n`iM 4o>.H)1d\5GC'WyG;)@?4deJuQ4,k,[\NHtݼ xuݐ2HeRpZM϶:âf,g;ς6-iKkӢ6]-k[6-mkk6-o{7.qk"7].sB7ҝ.ukb7.w7/yk7]/{^#f޷/g0`_E0~I[`>e{+\ X|3LWg1V91n1g b)Fw,aơq<#'#/b*Rb+?/Vq/'8B1}ŜaqELa"XE6򔁬f'7X+f3+k~;y }Lf-sϓߛ΂fcH?h5%dvciFҤ5CgZ{`>֋tka;~"9zC^<*_9[<29kn6 !!,@G$TG$TG$TG$TG%TD>B77A00?((L$$S$$T##T!!?" GBGBDABBBGEGGGHGHGHHKHgJkJkMfQdU`Y[b ^f#cXCiKPkHTkHTqHTuHTmHTlHTlHTlHTlHTlHTlHTlHTlETlATl@TlAUlEUlHUlHUlHUkHUkIUjJVjLWiMWiNXhOXkhVkkUikU`kUUkUNkUKkUMkUQkVVjV_iWijVkkUkkUkkUkkTklUllUllUllUulUlUlUkUkUkUkUkUeUZUPUKUJTNTUR[NpD5x,u*v*v*w+z-5BOSTTTTTTUUUUUUUUUUUZauvmnlnklklikcjdan\|ajklr׭ױ׳׳׳׳ششյѸοϯԬتتتتتتܪݪܪتتت׫ճƿƷδֵ7H*TȠÇGȠF5*j0G 'HRdIQ4AK0Uʄ0Hor9Qg"l ?F͡OkvQhYdYciϮ2Xªd۷iцmK6S:w^ 7paS#p_R9JF<9ce5~̹ϠC=K-DZ!RAm۵o>M 3`Gc +M>LaƧ%Y%HZ](KG7KV1]O(YiW =yo'`]Dt5 b>(C2@څa'ɖe}dbf!K[N1vQ8NdTvwc f;ZG" ]VtZߙD[uY4AtS`Jf_; cg!rEY᜛Ւ?x) kRĚkڡ PkF`)5Tp Q [rjZ6ev}VqUz}.'R9Y_ZGe &):va>{-_^h0g/# x'hoDQ dQ;ZYqTuRv]ˍL4~O-=`.UHͩfՍhz ^iq +k.ؼ7J|h҆&ǝزGxOd5oq*GӴRiC΢zw>ˠ9aj?F ,Mgx1W ѫGZg8Uҿk[% p:s[!mLPj"W""Iݓp: }d1C-7 a(р4 4~J`CT7u-Q[S!C9QRlp5Nă 6\6Ha #!P "uNuN'RfN|#ƝpX@RrgeRL#06-e!Rҫ9R;3@?!nUyшv/Ĕ)3~w {zaq%%CDb5v3ZiDf(,Sӷ!+(F(1e)]R"HH%c"{g8AI"F_I)4&^^KONi?CinM'兖CE &j!<Rg8-.(=&4Shl\ɱ>I¶w'%<婾(ZZ.Ȫ)7Iyi1:Ho/ffs6!4g):2#8|8+0$:uDP+_y3%3C6ø)Iڄ &5N0s&2Aa)KMĬ*6~%&` '̔L ,z%nĄlG)A 6=%R:{$?vm<  QjٚK*QXܠHP> EmƈE+DŸ'L1.D.-ipM4vo d!!m%LcDe/*cT@qAi 6-G:~T?| Bɷprb/ ɬ35㏢!j'q@(sU4Q:UM,]ڝ% YUgST6L#+"b0 = Cu-CDRETe0b_] woK$VQ"BI1\ ]Ҏ0/te]gE4J"QH6f ]=ПiMA<\n+l$9pkC1on`d #POD툿^fUmNm8AO[9=n/Gocs͹!\ʟ9 v㭭-ʭK?"_ʙZ ,Bjl2yoZfMbuV".QN׷COn2FB7eB}Z(IKx^UqMjD-YVzLbbqhu4" ڥ)s3$9cQ,ҳힹL7k3 :|~X-/^_H!sCq[ Z{uZrD~0#Q9Q*AgI|)(BfUQl~cdhIġ{DQ,G9R t$-X|CFEpPI `@b~Vem*bfXWoc+R -8aJk{x{p `x(lCqkH=S'|4a&!'5Dnfh5%{Q,]DN56O'{WvrE{ "Xb P>"VgjP U-z!WhWdTtI!@GIXLLVȄ*j_$NG[,OXEQE p ngKNCs]0oAB9Rl!sqlenW]t,8OJJu5V(u5U,ѣ~# Rv)26riew ΂i!':PPxPT%ݳ 0ws^"TM!a Q -k$JQJQ=fZKr[('(j薫F&wmmYB*,C/L+D͖apH6U3VcdKn2ɄX=j2D)FU#Q3gWn鋧oyQT}Aje}`ЌQX**tt,A$%qDqAi%$TQEwf >)驗%)wsS%ꗁdS*v.QܕQ:P72&7(&6Asme?"U CYL}PXS%&tsShm&./1pijv D GU[Qj@*j@!$uQJ12l`c$i *V#YW fxW;%B6~ohc3Vvuu4%$:.ڛYLx~󜔥+.@~թ*S5up4v t EO)g_otO?CQpR 21gtm€r.᫯8ELɭ'QQ S?bh j!]9&1)v"MlgQ:MZ kB%)%$5BbS{$F'q8\هu9! qA"TUn>rx@BIcaS$I}uxBUW3&c8;@ՙbCF}@kcIO[YKTzև!.gA0L8naS$*+k;YɶeJzYVC& o9u2Bjq6~$ +cuZ8D :^'ty=&zzX,@ˡD%B!xF)$1X wG2rt_Q"z9zxIAGSZrk(6<ˤPW\TG=&-/"(sdbٚhrdE4xwJFd6ȧ p*{'kNPI2^)B)YuH)1YSTJi9;!]XA 2ci,9 b:ׅ3E &ܵƷK}nW@}RcnECK>b0=||+ `;Q*Iw/FEE,'q>Dnm˹e9PQI}L~;5qZӁzw}3;w1'pp ǙVH(0@|%83Qe-|N.(ӉR쳦X5bVuU%+ΰ AzjSRVeOBb3BhAd;V7Rsh-X*Y&>B'FfԢaQ蛘.<8/t|INeaP4rmR1"{Q -_@$\e/G2Đ n0@f88C>&O+Wl{v|whwыw3&|R lc L}=ΙB*QkK{Yq։AhN33raØm*2)- reD<+\ b, XϬk"+#(N/23s[qoJ\_5fc bX麩10>|3%ܻrV9 v˧xA{* ,_;A &Gb'ŲhhzuKM"s᫡l{hj&Ɋ$M6A%H^S}7Usⴇd0p>~= ~$h`0 tN[_&ylN$cc5[Ue9x@q}w6X!o3Qf$ áP,m!ݭ僊SGw}ܳڔ?55aQY;wyz"Hzc+b'˔[xmP)&yI!RGt,mXJL}=X}K$jT.fǒa'' C`ŠU2(q͹5.:l8qEij  ܑQ!$HYtMi`s*"ڃ(#i?ci4d0HMfp'xRpT&,`ȈTiN/&>-0ӆ2"30Td"z5Nljm# |]4dx/$6x%yW{1-Yf@./O.xJΜ f\9w-NC B65wuş22 _kXs[6f 8}G/dO˝OP0ϕ`"E]${esM0clۆգz&kiY]ϮJXÈ,  i>`@=*ifɡ@ #jh)jGPQ :ELj,-t,E Q Q*Q2r*cQB*M5Y JH lPy,| BLDZILMKK(!(S$ Jz#h9bdOV љP`23p  ^ʌZ|̨vˆHD 厳?CVjdkްlc603,*xJ{Q)u0`:l2VX|S=$!Ck*b!M׮&0z[lVoʹ؝$aVX8U aA )$>9?Jut$i PM dhUs *\#0s rٴ„JN/"L[Qwq`y~42]x г`d] Fz (V\64KGs7˽C$SՠB~GG^y{A}СrN5wZcLjubpIV+tA`ȿ>bkoz؟Z:%k7tu,>XtݥKA8LvBGY|39Y'-ج1ps)Ta-nZU %Tqj <3S'W 5#RP86a1g7`WK96!C/T1*Ȳ$h!Mfb7g Z6hoTJ/B ??H"bƬQPe8aZpd 27PdqYn,`rH@iɔZ+T(Y~}]СZPB>H\oVб#$t2|ۛ,8}p'iI8ȓb ,@gMIg)lI>|igtI=:yAQkdLE/U`!gp,ɸR&hox3h'U@>%bK@I=P0.1UJiXҙ'r$DTDfO>ӜdQqH0_kYX=eO cr8:C*C.$G 7y$`T:5Nr(IGS$ңBcҌmk)`"5Zaes4P^]Ynu e)a*WY g3PsWcHAb8㷱c9O3ҴM k53Yz[#;V\?j {qū:ogXiRj% vJi,dxv:nORpsYT`a6 HR8٠2f:-5he4D ʑ+퐔bd3P1ըx*%`T * DZ|jIm5`՚ U"s6/= vѣA8ꆏ Ibv;|ۗ:{D(IlV60_RF|VJN|G=DR"+TJtORZcX?Cpe\TYb/jAS#:Z^A" i0R G>O43|Qwֹmά>sH+LC*+VbqKlF i2\"uK|{Mj }9wR G%.[a(tIH^:hK!*/5:1seS:>qLȇbè Of?lnu }!GpI#:҉ލ4s6C Y r ˕4 ˍy2 8r؎kYLj) 9q!!0К RB1o/>3"Z;"!K59 ȇOR9&yӝ|X 84iClI*#;#;-(t:x15ڪ.P/ʻc] XcÀ5d#6 Ry*:*RwtGs\?<@ls40B6ѫĺ~܌rںvk?gX/Hy;0 9Plܗ@4ӌq !| SAxpO2) OR(#S)-`xNЕq۱tj@mحJeİLHDA3b @̟k*lpľhKACNt;[ S >QLz/̑M3jR@Y +>ANv2Zkɴ͵Z(ESkJW?T2;>DT2%)~ڠ-ĆN~~lܦ{/iq3qqD Ȁ6]p?Gf#tZ^@򚎇SO ^i!")l1A=n6버Q{C/Gd ^9IZ ɘ+- 4CTt :?.4) 4dRI <`ó,{q D”RP'HKtꌛ KIYzĩeR$2W<@,CY"~x)ʑP y=E`L.cx3Lj F\D<\ AQ:H4S0 UźĶ̇lթMՂ5[Is: u"43)N=t+[qRZil^Hcr2\'ͫetDo6OŒ\ѮU1A셌13 8_|H T4X`$ePHsmЅpP.1JK0ڢڝbUysbPI%몃jŬC[ Z_YK1 IDQ$CRAFK@[Rv !.pQi#S{zQ O(8J :2࣡h&ŵō0l! 7,Чp ;]`A0Q.ttd(Cy#FҐ7TYƻ⑙\k: 4`.n4OݸèOFcuJnϙ*R˜gɉ s ICId^=Џa<([rr 5G0~7-~=8%ZvNCE*ёXl0ߐ7 L8 ֊;ie9U*3*SŃ@Ln`;KnSRITKU? Ğ̖EW"2c iF)"'Ct:Xj 8%g~t>7Ж~~R趞tUmgU@1{پ/q^ Dr.;~@ 0S}h#G`8yUWV+0*G>-A,22<|Udh=OXt<.ABMkƴRkJb\2..ʢ"Q$c$ bxicԼQ`# 1NQ4b"S Ѕě'bQP+'g.䳖 |a쩤ٴ*qbA߀l'.LSĻ*@cPnb/Ȟ/xA``Ľ.  3s~{}aIcS-'A.cz`;LQ0 ρ߰1N &*ZЉhhW][Y#c1Ż>T0Do1 om*3p L?/RmS ֪,ZZS8_r>  q%%.Fl')0-ʟa RJ}Ѫhs?"dl"2?´P魖*/Bget+?;<(#j)uTހ\)Mg)+ B ,jr}'y3g P @t{hV~de#h8A(Y79 C}@k'^yI# aaiɻ ?y ^ tNT*!De'iKBvW ]0LdfFNaYb% >ZWzj7f p`k&K;2YD*x7bJ”ۧn] BJc|o)҉Gy Kؽ%9,-a, rMr Ag`#Ã)sHV#>jRX767{DTf`FT]fڅU^aq8Yf"#XEY-vN'U[yfX^\H&2eA?T $C1#j5*YЇU_XKFSB]DaCIPU MԐ@[VE_I!-xL+}tT$i* ŸVZ>rNJa9֛CvG DIKUjrX92FC e_ 5JbO1zf] Ijlxu6h!SWqFZ G `W6s Q}W: QBo(U Fna$p[WaU4H^IB.4JlY֪&\~'я!V̊ KoQl UzەV(^>ZUxH'uff0i bI`U@Q-h`%btҺjk8kR-m{"R(qrdBG*Fj*7 rw j( 9T*JƙbTf]1_ĜXJyEKa'+fي{bQ+r { -ܙBos7IoMFUqT0B"&dEADz i/TGp˭R g"X 82ু XҰ] 0sIns%.-KC|?#صR!Pv.ד aQìhNZkEx5S h/\J$UDZ213IW 2rtb,QP &xRk8XnB伸L59 9H:LVtݐƂ(HM{TJ:(.Y)w]$ZL+zgpեo-ã<9Fրܘ(*3Nϛщ$ƒs4_+r aCqhh6VBntbiE5h-*>GʼnZl\V#Z zҫ# *SDԝRTRWp (ɮu4˛D&@)=R4\h酓.@R-qJ-Hr1keWN 6%:+J6¾'FbWeqQq3$=k鲖B^v:m_)+,ey b= 肰̾*Yk8[T-n7'ew3}wkYGU cK&nhVzذ!F~CpK+_ޡHI Y3'bh5_hS\ϼe?kj*ٵU7%ox$XrIXX*]u%Zt )ňuנ7$ 2oxl7Z"J3tkO&|G_O[2|_,5[9BтrBm Xە|Bs[$( l lj.UE/0SKnoJd&*g)8npF ! lծf:L~~Y@¨H ,HdZZI|pvU6'ɕA/颫Y(n} c -jt >cŒFESgDPЎ16GgAL8Hn#*~Jr,5A XЧ,5[ؿE.9!vsg\Dފ1aGa0HL^Y+iLxIQި@lNU U]]tILėdSAdl  IFILKQ.L p\MJMHFyI]XƦzɁ,(PrH1HAF5GaGyINq_,y l([S-mDʄ3Tqs@d='pv\Dpr1`t4ૹ^]Iq^^^ `@#$Ns4̀*Ʉ13܄F, a$B)1ܾ쑢}#AȆљ%ȷYG@GI16i%,MVQc]tl6̀kB }*8%OqJ JLoFOc:Y `3%MIe\XD`:NPUJuP%}Ⰷ&R &[#Id!RԂ'`؃iAI}~谘^hΉe&kO9Ti4Ba|P)L9 :(F_bTR s_#d}Q#Hg!^,Y ] ALBMEO" 6Ԝ#Z"ɢl\i̖)FpJIšjHE~rQP,A4U))};eH`ԍ$@m ,HTDipX !1:B|#W!UcmxVD ބъaҊdVʍ`&*Hg"ִ+.rG*NJJЃ: ᮓͪƦݞ^ȋ4,vL}W퍓`i. &ڪe$U6_`7DW mxiJ<-,-!WX)U1~EՌmWvg`/az+z@/: ~@Nmn2I8㮯` NjxkeW_r.y8C€ԗ4Hu5h04˹qvSxƇǰS(7y+J+TKG)?R3ʷ|aC >6f kD }͍G[լI*xxB3:ӳDȃ#ݍH?;e8;װ'^/n[B\lg|6={86I գyjgxvk-FΝěy?Vk}7GM:xuCa,p{=6c/["oi?=9DڼZ:.m10XMEO3@fW'SpO0KeAq o%mh厶90<p2A ث=*h=@z# Ȓ$Kb=|hIEK+2pĈz@,%b9{%}:7- ^Ɓx*H"ԲL/:ӰP&'-'c#u<՛j8$ti'b?.!u?Ϧs=-[rpP{T bʒ&'}(t-K/]Z}vK2zGb1#lҦbP^wjۼ-2RޯBd6?+m,(4KF \jCkivK] lDmQ,4H4\kzO/ .$Wdr+L]u%`<6FVIZb5"gp ] pe++e>~/kgJ)\5"eIn骂h)*wܱ!?*wͶ\l%$\2c.J,#zC(_3Ehbc2ґ"J4 MByMm3j!b[¡ 0=KHSѨ!J:r (3@8Xq^_U6h !U&Vi^5Yimj2W9!ֱ0dQ(Hd]RG;5͑Oq(D՛ wiJn8if—*4.%ÆTL뤫+4gCA)u"X&R.K‹Eݍ]V9HFdyrlHUջdk V2aMpP;ȯk%mr@E[5yUd*K5GԼik@QIH- ?n% ', 8%h*A"PIkis&]=)~qr8g(k\J]*LŠn3QI]"*D} uEL"jOxhhd`j (D39iJ>PK']RǵHGIjl+u8RY4srzCiLJCj1]ɠ[|-;M*"9`2-Xi&r{9`nc,7l8 r(Zk488t%Y6IlG.9!Y JPF&BmEW@82a{D!;c1V_$O]nr\s؜9U_u!Js,W7ykaWɗ16 iw+u~9G|kq4Bos.^X۰#G. ޚWc#v)x[̒cĤԼsFI!/{{(sfoh u9]Զt+YcޗVs'X^ülW7vDMN ֘H?]?SzpH. !e%*:nӔ2b: 4 5Fic'rT"d!3XH;n`,Ȣ/1­J 2N@8, =0J/Z+Ϫ8 E-DXTj!bH*exb˙VVȏR8# n Ԇb(V~EzL,JdBټjP@P MĎn'rn0($mqOzzn(1.:~-'B E*%.Cbn-K⋾&41>IHbϬؤ,N*Hp <$f6Q,\kKfg/g(d:eIhF!0J('\&N(Q 1')(xs.:.O^*M,jvH&HAb#%C$Fx(S /-4"q2 iJ gfPJrpj4^4.&nchdJbI$/9C{P0Z,GBhϤ/v,rbTm߲EN9’q6`dHpݔ3N0I4 VE11"B e|$2^),/BpjNfxFȳ  ...r+f4мA ˅mhnn\R;(i$!G׋azˮ;04j;*rv2`rH2Y,6q\pC$iAVĕm:y>-&!QAB)!r*$3VG3JC&D,8#nBt  iFo2Ge(ĂA㈼o/V?o1;Ab28 ChB M PU؃,1d5rQAT5%&v42Of'C(Ɉ҂N^)Vb^{iP֚幸VNeXY3N![v~źHSATډ>SȔ"Xp{.ZB wQYQ T!;ӄ$ Tji $zV ebvSDN97/cLVQc'H(SւOҸ^NFkHN%L9pk,Yys1РRWUve3+`4P "GvCY[ߩf?HAb(]oFc%du\]FHVXLu!a[lu@fb1$RA/^tTKGbI|&WIeZU,eTAXDI6[G %M;[UlP7ET^n)#PH.G0m _Y"W,zU!28}Yp_OIWXTZ >cN)饚V&馝j שHYjUc3gxaYza2JiŁVGtPCmR(,W^b{^1WTXeeueJjOoY窫٫Jj /p g˅BzK iSQ: qYYUvr"B1HqT $oXPZdM>aX#K0%p] Vko-K(^ *^՞Ydv-7jc& u-*˸xҲ~Ѵjܐc:\U]y9B-x5lx8yQ^% ^aH\u猔޵k~ַYޖ66ywaKu__hnaUX%ː̵K%Q5~%^orV8OV2i&#mH Sjt4s :ɨǀieUF"q$^Mg=/$4 %j- 0r#U _h) l[؂PSתREC~ DYU䣸9XbH*VBĄ_.dFp LϻR䈑 %i}e>h]fN1Fj)vA ԕ45YC{+f5!Nl^-K"L{(^Iأ%|#E>&Q%xaOqd1Ȩ]e_/[7ΒЛTǩ qJ%$g!kP J]n/zSLڦCm`v d9S" TN9NlAT|6`A6?=f5O^)TԢoL29m?EIH-w_)H\=1O9!9~1'C~P4KFwbTa4{0J*q@b#&=s@Z4rLI~]viDbY=Q,5IE& z9y:DaT<ޥJڗsQ$p$;αTiYe1RP`G9hD' bΝMdڶ)SYV2$;ʊ;E/k #٘Ţrs))ZV3ӝXU]AGO ƖgE;%F"M㊃6݇0hV7kn~t̮XЬQ"RRT'[IWqs2$)lbxƂy%)E9gqQu=bjM&񈷇kOF,)9"ufmx b <4h羜"-A4 -#$"yTRՈ{e{1ԦQUZWA=DȜ>I8i\5t&]haih.l.G*Ɨ1@2d6}1Z7`quн$JSʰ.;^vj1qcVsS\0#ih\xJ "n7k,TɌo<9Nn)E`u"WDf-W=dw g4ˎhG'ŗ*y{w^L?w4w}k^7Q`ò̪ 'oSbb' >Q5΁upaL7*.ۆ6vu`Y t˸4>šYr 3~'sN5'%YL 4V?I)4ՉgدwL4x$c%L7pw'!8gW飁,yNU^4 z722V)#Ӏ 0S2W0{G(687X:'a(ք˳#eNRHw/-, %8PAedžΡ,` z:h5$wsPUQbM`w|'kfD(h!AqUu(qDo:qrp.xg3P,3C>zrp2xT]^^أ, xHiZMX_fXWJaOH͗ae޴}l98R;Am9B+kDVKC,\#5mͷVX7&( &ib^΃&PS;o4V-7XyP-64ZRJ):䁨#^ 2aabS_hifgr7fB7MtwN،3?yNeEyJIeDC8ٍQ]$YwH먕dN"oHZ&d$ c|8bB/|BH4wHb„{l搊h8_V6y$7 >1Y>#&B-يDJ,I5UQTz ?ؐEx&X)7cwu胡&Y@jxjČ|GNT:6k'3};}'B(*HdHl1[Wΰ`U3hsMD`h|]FoN &N {1X]jUA|f1KT֑z"w-(!IUt&,=fɐy|9jc8Useӓd)B'C|UPKwni9OY6te{FS F)lNQƦ.As({ODmQQѩWzl3Hv.m^˂^H.uKhB7l{Smlɭ8`h9=ʦj=":U"4JzcCjchY;K:`:w::AAj\> ˞Jɔ!mLhX 1٤Na%t8jM2]I KeʥHieeZvr)'Y2eE;v,d[&z<ysJ[*(n|%W\]w&8?ɹRխjݸBv%(+|rsժȗɛZYw .JU r5{cta7k3{QO 7I۹{i39iu[U4oxsʱ!& ,J{#˸i;R u#`?XD{6{)9q8SoIqzz0i2  Q銻fK]g[fcMt[jk٫bQ $<晻xjF*n6pK7C7[[wW mzjCRkx@{ xFVmƺhDj`g꫾glż+ArUs + {̸[ZV0ac_*d7eJb#su w;˥}G'+C]*VZZ;{'|{oʴm}9(#N;Ʈ̾WZzmPlK?|!Ղ&U+K6T,Uk |լkl4|+jE뙈Yk[oI۴ܵ?z1q| *,AcH\kLƠ%Ǡ|X<IC;|Q$IJ DMs$YQa…A;u(*]DM[k}j]Q=Brv[Ԙ <)^%Ve$ЇRM˵zI&mˋŴƄꑋsM{mcbcH=[̼£Zz5̫+Mn2+]8IW;)s+ų֛{b}x-[\#@TM-"|ʢ̰SOkk,zLyڝ Kǝ#-+P1*Q]}zܛ hu| ͏<ڏ[бف5X=rR)]d61] O}^2 HXA .,C Jd@1bE5fo,$KNLh#ƕ aI͇+k0S ϟ>k)$"eSFJ)JKpZ3W`'Ja96gǖi,M URJ7yNj*Ju Z_^xX]ɾW+ʷo=ġEBhb2~ʮH2כ9۪vG$l]n$αqɑ/WܥӊUL.Z;^LqpKtF"WU$dzͼl'VJ*F-/ BIÂ6J3W-<:OTkEcqj|F314Gd)I#WC -2J*y5+:jȼ6!dA:qI0 ʺ8,چm)[M,^]ɽE[N]4pCxT$kZ"s #|L85<-Igpѫݼiϲމ}'A{N.:9*QLyqbFU"4 g~_j sҠ'U|U#5#3M\ _nė3](Z T&X괃{Őqo~[a1!_$k2AOIb,^Ql"ŌxĪ.\Y0ÊExS\WN^~{h!H<9|iyt;'/Izrɽvˑ׀L,ֻcҔYdMosw\̉HΙƔ9c YʾBzXǓč+(Q5.`%{ϐrCd H%hIiFɋK1 3hZBZrZEEKXaB3Dh {b|2U N`VO^1"V%0S=xzr\v`> _x OB: $DtQ@KDI:b<)# YG'A*'%nm8U b|JЕ`Lx|ל7* !۬g8DESj"ns];[ݵS=v]tf wi{:j'P><tJ%وTGeFZ6(;HvhMjҦ·B0ղ,3j ٶIPIXZ9-tR؆,hoF6$qU4"ĺE\:rUX ygVBa?[Flrn43$A kJQwTl`{XxsYl,zʪDk֙ ^ni1)zѴ a@v8IJY1V!iGͪ:#٘[n4lzsN4{eìi]ND60Y񚗼6X @ӝaP9Ck- S44DUB"2 ,8`TN`n@3ÒIxf)1of6؎)+` m{4۰V{Hb3ڌ"g=̑ȍV5%.qnjr:9B,iGN%T1䚚QXRbl'1\n24zd,ͦ}mi'ȯK|竷oYգobzOMNn"Q%|#`1[ߡb' `m^Ȁ >ѴU%%YΫ¸Xڠ|@p:aj߳ K4¿;A)ҹC;@ "3+l[+2(k){B KrXPbEd`s +"I*ҹ z )C1$Cs79?ol83tl)% 6 EWa=KK**K2qHTAyAò"2tR:}GxGAEbD(S134SJ\XIP+8k0vcC/ m;-[C} CIѪC3)ã3LJ쒴ʔ,G<ٸ 0sZd:QjݛLjDP;IOhb{EœEÔECZ h Ǡ8A0 Gp!鑱;7ÏȅM뾚+XJƸJ'{80 !NzY w  H-ԧkA4J@z*ȃ|:FO.Q<മȨ9)hLM*tJ)HJ! z ,ͰOL EI]8$ʬʔ QƋO9L-n!=A5UK RaT\rſKu'ìŏ9 ҤDB/| e/g [B$P{v$BSƤM(rʠ˹ |M4Neߺ16D +-[HcKM) cʩ .ZtHxlTUU|)ITRϩF:/9S:9EB J3M\MCh$ڷ -eQJ4Wn݌AMQT-=\UTĜ%KN-ZM-1&K ̼ Gx:W<~Q$ R҉M̊ ^C-#RРOKlMcM{S׌SkdvD;m84 9SCMTQ?5:Y.ܔ -]TxEZaKE`EXmH,DՃ%>lҀ9NH-O:L5NL[ZTZUۥhW`MJgHɩa\h PZ:\ ]M5)b'r ʵM\WUr}`5ޡtI eRXda]"Xa\M >#LXu]=[[X,UVmiTq=YJF1kS?S8F7ԯZqܨܹp T|^,ݎ_N |ڵLtQ_XY΅I]doڟ*[5>Ή_^W>+FUv۸[_[a $D >:$JR}ֲֿ^ŭVbkIRp%vŌbUޏ_6 H *CUJ--<̊FVi|YFRyP]A>OYY _W[ Ttˌ% >`lJ aP@YQ%x"@=.]u5],zff na>-5Op̵b)ffm;bN "INf(vMZ(~{Z VE|g-&C>TZ~2X>SMDڥK|>g"mx1=X2nQea--Fo͓.H^ N|dKٙ`ԉaB"cV _X}e e_E`a9|K%T&jb>g EY5\պ~kef-ǿlBc c\$giVL;j?agu%-gUפ,m/ۃbejX؎臭WPG\'7>͚Wif&i8idVnWVmVvjM} ׼diմˋ1 Gi\j+6+FCU䎽f!jh6 4oakcLD!I輜ݮg,.ni[^)En2o]eVi4j6o#e͓ͨY5LiF tT 3noqRv6%Uwk0erJT[ 쾡Tް0 HfJO>uo%I/ξ.r_u WV~gY*wx$ֺEWHb\dip7oU)KƉ6}T'+djOf?j\p|b}x5[1ok6{UXظT|=ElG|WtIWzO gq^+{'zSށlq;G"x# ) 4! 6|(1bA .̈qŎ =jhG LxrWt sCVN8P(2@t(SN+dHaREV5+ץ[r]hPخX.5(e(dD j܃r~{vUf LUnFWaN' y^қ| z'iT rclٱ2`{nqU-} Gqɟ/IyuMR;~7|DV>J*?>9kοt~,rewHGyIkkfZ9@QXXwx v d '^*-z-85☟h6O?P`q D:UL$I:jQYpQ:7[M\u ǜW^aY-Bٹy,ԒhDyRdgMBɧKW({/c|剤|XTa(E:YceEn88h*amviitcpnZ+g~꺢YkW%E,~1lSU(ΊX9x͙%mq+Tof'ؗA7Fg[pFg.!{ Hr}ڞe_}|߯ /E`R|`aa5q"=V@V%k(H**lcs;t<"mj'N lS46[[_p&c{暭Q}֫zY"iukwʷJFhNΔh uxV[3(lz]VW\ի 2裟Ny8Kn&2޹f7 :m-훭xnӐ:jBF5粛=`{ڈSжv _;-ӟ0ˆ{V3.ÖRaR60c DV!TՅu?]uv6aFh" !ԿLrTtE3 nnrԈYBRCJc3&+m<\ƐH<8H7)iOMh7 H+TrƟ(ʩ.yg,*PRHX ;N a4(F2%g͸HTbtGpy[O´mqOCDYK/᥽_k{Ɨo6WjR0ćTɚOÓg/f1u2c\l$_XCӓZw{ D'g+eelM<+YP0,Ph,\aFnfTF .6͉^ `dD$k%Ruao\^DS16T7zڐ4IH)*.:DR*Ujիb5Z*Wկ5b+Yjֳ5j]+[ַ5r+]j׻5z+_׿6,a k"6],cB6,e+kb6,g;ς6-iKkZ#UUTSm-Uc+ޖ-nOZc.l[%iVjVUb7-sK-z{`z*_7/|W%[R׿o]5zk 7fwxv^7]p bW.oel αtM<`ӗͰw۫8Mbo8oIc29>q,a;\e.`rvT;T8Tz3Tf,TR&TH$TH$TH$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TG$TC$T.$T%$T$$T$$T$$T$$T$$T%&P(+H-1>ABDGEKKGSPHaTGgTGiTGgTGaTGWTGRTGLTGHTGHTHHUHHUHHUGHU?HU;HU?HUGHUHH[PU`chhkkkkljlh}klmxª÷Ҷִ״״״Ūתתتڪتتڪتת׭׸ֵδ H*TȪCVkFd @EBF(#GHREG\ @K+UpbHVrLL* zJˇL B]ڌx#ȫDY!VR,fRlXa"a."zjѿ~ v880`NU/ #xʘ/LĹϠCMHF1ٲaUSF?s͛߭8U~ͥpCۑ''^CB@1eRS6s;7xkVB(eH5aIf5V8C Rچq rΆ_UY&G,fe"mS2.eLS@bT؄E'5dfduEVx(T[OK\XLQG䋳i&lG('gϝwZ3hZKgڡ j}He0=(vIe6ZQٚ_.UZvwWz^[ЉT+~s5Q)r ՂA6fI=] f 5!hxTQe,FMM4cL6;oo'ݶLJ^[]M6/cM[ %SD1YI].u*9u Q2++4GD/0C''aJ~4%T Ӌ;SS?Zת)r6 s-5̗K}FjCSvPW^]w[Ե g};^/&6^,Қ̸dVnr>x2Z1wJ#mFtR +J-PǞIl/*~+DiKa̹keVl+n{SSeSnQmҽPi.n&e򳽞MghXs/y*lƆcՖ㸛x9ɣ`ʁzHvoKrɹF [2zeW:K>Ƞ&@PxTg#"m0&kT@uCZ3|f2_ᴆ.^B JТE8׽7]\/Uc<('y/A!,kX8̤%!(c/{N9_ ud/l O,( ?!#hZk F!`l22 5mjsҢ @׼fɴ9"ȁp38c#"R3[ă-6bC( ԐXY(VMg1!fCC`Dy[.^t=@u0E. וQ*?]dҠ8N5iCPuJI#cM`v4H#^*b"$jӢgW?1}DJmMԴPXC\Ȣh<ѡe"F1Ny!`dR) t@@c˃lnaf{ʆM/Ά3?՟n8in%o(^}{g4qE7,uM.MJb؇I׉nKф+Sn7@1؝n+S8vt]77(W%S00jef$&KK*Ce B%o꽇qUB GwuU GVp(np{ImpX:楁dK^l3mg E9Ro x@KvY;V"P2hq;fz8:nfTԵ| x*^ngRTGp0`Aj8VHo^t?T§K տvHR?jMv/ @ W8Try9j i i]>r?ƭт5Ox$J3nsۓYarP60tɾQ>UA 8 eh6rXX9 2PdYAڞIpj]V~rl' Goon+s6!怫 KBW^fnXPyQJcmy(7tãOgH-)u^R_JqKB$'`BRAdT },`yl^Z<ʗR|.f1֣BQa2.#iVqZ.XiH%-G?%J4>F!'Q^CzCwN%D _| Hv$ાD)7(Y1v?Md==D9qXX]qGo#6wI%8V%A^1shu5VQivN7jWe]FrNNrFT}V}5AdA d!8!U&8[A(P{pm 5x  P?eHvgzosdU){H51`7rdwhu oq^svt I]u /!TT<{DaC cB/UIB`Il#zIyFd=2Sr47[ blx]:/RZSm88HB%A ۆ@ 6^!_'85'@ݵn"Od 4bVo٠ ʰBv'p#Gk9f~-!p1Y~uc@A!P󇨱Oc57f4Cr.}%a*0Z!|M4UEpedfE!IL! @!w 3]@7ȃC Hس%J(YS_43h^GhcgGFaGSw!HuS1PHFzg'QhkXh# KTIQA~~z$6#`C4ezqC  Kj)=(T1񤉯ixd{hb`!Vtb]B]{@8hك(xDk1[*Bdۧ4Є&rOcCdOKIo1X;%Y)dTF1?Yvf~ ǁ4!eAR6aL%|fqr WQspCvqdȤ&([t߳{@W ||<ؙsY(^a])U#/d"d=cwgvM`Sv^4 Wn^Bʠ H\8 TGZz$5IQh!ZUgIVI>&S<YDjjUktZ" 7|{ZdA bPx᧛w eeY٩g"1 GF\V* #nZwaIR[gE&7gPaÏ2`jQ]Fsy9 5ʂײ'{كHBh} z1YS/ʰH*dj*vZt~CYumIPif#Z醷ã.JJxF%oHKjY(ѯ~`既x{g_T_!鈓ɘdF!?B"3ֶ* X|8Z8|%YCK5L]Oz@BBBA4fGz9.God6g5(NaIClx%eZF4J-hnĺ=d3qI ڂq!wE@Ya ` Esu3i=O‹HlETEfR%QzVY\/m3`"u3sT=gՑ=a~Vj*j bjz'h;#Raai5dk;:7|P8|:<0C12LX2eeb;A#i w0n$07Xfl°dȬ΢x@XmDw{sJ} z5qJ-QHQHF胜AHA1Wr0ס$$k5gg^dk;]]PNb w!RsrtUEEUtѱaw1 1s)pA,jF%+1#'Z`mYBH{{r.\̝xuA'uN +4X(F95(͉O\[Qh"A МwZ#+Bt T5rsdIW֫+D4B09*C!g[,B:kv rj`*0'ERT pG[{ͥKww%@rzuEfh5 +2t\5%tBu0Y06q棦Ѡt0%>aC+[hIvr  ' 2 eJen'wBKT(jd> _k^D+=e$Ӟ2d';/n&2,¡)u!E. 0n#v6_k-!2^4w%GOGpqv?\&}xYJ VkX@XP* )^TZƋ1Hr2b(*hҤԈ4A5B 6U"=}TPD2DJ.0 \K D:sRV\ ~)1jQV6֨][n>PQU Uqߺ/bǥiCJUHja[Ğ~Kё +VCu W\BH ۖ )jwGqCe;sΥ{܈ҥ+$a>N2j`#}ziɓDGMg"\(?eZ,m$flL &Z?4p I0¶j hj>P .bc0:|hE"]FP?VH7DB9,ҡT?,rhMF5gdȥzR"=>a> D9@Т)*ݘr!b:M! Ԭ9Ś* Xh0|p1 .LC%8Zż-= LV=U\*ր0({kT/ܮϼ%.*VV\$Ҋ3x]h-i0Wӻ4jv*,ݣ.`8-D_x}ƚXu@gbeK(Д0wޜ/L*,r&K3-8}Fk>Xbv|Uq{}VìP/* -YWS ZIά2#~1̣<~х) {A%:w5~:IHD1MG;bTh}A3ܟ8o$5"KТpC)bщh}pbo:^ !UlHSd),TQW1:NHeFJ3HT@ZʈHRɽu,2@P|¥e ]iCnKuA}h SC?Lu6L].e_^o2Qɩ gưGYO޾ս苒 1b@P&ģ*r`2JU6≓xn[ @)\$5\Kё^8+s{)\"17k"K&)9Q#> A>(ή_4LSC^dTԚh9z]^ jLBY7%kTS9kPYm;@^k;7.;+T.B &; oi1 B AK(F7#o[|^:&NyzEYS ڞh+j3`d%,h(3v BYj峬plGuq^efLZ\N-ms“iXЙLkpE2*v=9k7%(ljh@lt*ڎ)O<@t U#mU+Dޙ+K(#2@8sѓOI) #95b !'`9;#eїAJ|Q( fh:;*D jAHPQ6|@C|d2Oai+1hģv8X=Q{87r*Z'Jl4mD[7*;syK Xd ) j=! իG+,ɱ 0QQTa!%(Hdt&!M'LKa=';+⻲تvi]GH6hcP*jDec*\*~ Ȟ@@z32 >/ /A }7ˌ6{sAOzJ 2q0 c5V!0)‹_<2ŨlD -~r 03'[8i7 ӠNcp (< @SI(S0$C˺TKc4D4 X,ح]M,)ECp@I[KS, ^H΄9&蠆rVR[N?zP2ən #l+Is6ME7(]4Nr-+봍2jULILtUaNI\ĿMFW5@gZD"xL7 x#+rSjxY\4za8Gp"Wd55)Z.SIp,)q$.si( YEӐվπ Qzư TĵJ,zf5h-`$T"  +/V)W}p(O~r7_!&<8!* CPx)5 TDJ\>ȔQ8C@{خ&(b0m Pl /!BA0 _) R(27])X5t {@x 2smRv4 4 d< p3E / D SF[+NᏊXԂ腼DS<8JL{p4YHM+cfʺ +V ]athp#M:.*keԸNy{*"sV4+$aj$,NJ Ͳ@m'Pl(9y a c R`Ӏі +e7Tlsh8  g0͠И.8|ݸp=diV)YX" [0s="썠CK@]v (^JZ'$)E.~Juu$+E #*y\]9;b)Fl,˦UI?8+q;5l/,G2Pc!q p7 .렟~lfeI\EL)! L )JDE{W"ʣ/)|!1p`vM +Q ]= `D^ Z(bVґe& hx>m"VD(Ԫ\QzZj-"9|XC;%+$dcźTN>+T aY  ֨A֜3i݌#5j =<{ӓ aVt#l2ӧk/(HTG>r(2AdF6I%#"1 s$ -3 axZu /bЈ<遐sr#RPQ| Nal9py!FK<ؗ'V!-q]xf] an.ӧ==Tth*Ba` HKȶ)*rJޗniS]> aXK oqcK-ONP-cwt iRR% iƖH,@UFBgmI/[̻*Ј*J{5: p?]e4lbW =~;Ht$Ywy3I'C¸g[)moŶ!vjl Acdjz{A?ÈUIM NGʉQ4aKK)LIRGYç@:uW]''홟n^em_+\,&1$V^Iɴ2"S L\ؿ"云 6:2cβ`(Ti:DŽ8L,GmEVxSH0ϮI3c/^ t[ǠIЮ6m `[ 2^eQ/gRS=AzbVO p Ziq_ VgчW%`#'[j'mud YReP.S"Qvd=(36y[k0T[nUyeAfǜC !bP!Mb\]Q+фӛ4^7g8GǓT|ĘRŅddw1LPw22uT՝ Uҝ:1QM(_xCzJbvMHWz )OgcڒFcܑ #HrP8"럖UJ'Nm&eBKSut"=5qE;B=9L@6oy  GTHT &tM˰ RPD]$]HWHk)U"99UC#ѝIZ2L pD# wSxn2z9 niT+AGD=sIP6%V[URWGE$ᤥWE"]6/u1e/2, BljeU@2NQȞ5WFV髣sQFU*T %lkkz{ڸ^apBե{*=U82VǪE{KIk(ת[g];qK8r,SAɝ/8xB؝M@h2 B:q8fEjϺv HY x\h]o٠WB 8 I w#ǤPuehC0<9؋ LiIӏɼ&Ē) N$(%TMRȰ2xŬ 9ǝݾ;SeF͒b s@ZI\>b/r]!~'tl [rhMlTҀ0<>?~Vht=*&H۵؀XHEPTP]LkAUb ƴͷNjM"E+ݩRK*Xg-B(`DI:Ů( UO&܈Kc ̍Iv9C#iP9[A⩳eM '3.n6JOC+b\ LR%%R->pap3,>Bs!o~w9sr[\ׄ=Q,@1c#,wل=2M߄ep0h1gEQ+q5\نΟeDx񔌖90hn_h0SAƮܑ:wmHۍk[g>E&Ju8FE"ބѭff*s4Mx`&PRIŌP6 RxsY(e& V(-bmGim.ph\UKnF98TgO|5]n-ލLqՑnЀpE|8hdȁZF,*aArH/0EF iЏF å٫}K fJi Qhʒu EZxe_Ja_h^NՄ\mۮMs0`MmݐЅHŘKэNSQǨ 4 5/E9+ʼn?LpЬ!A\bnw$)eEYIڈKh\tu1_~ѡa$864imDPНkpL-Zx )A{q WܗC@R\GۑM V &x,Eŕǝ^dD4bqbVi(F?=DE8KbPetCz84JXT8[^$AA0HUTﰌPxȘ8D2BJa@,*ݱQ^I0dYtMQq1j1X#msrM]L@̋_DG !IC &BBF')gYH¾lpLYh B {mZ0P/Wrj,P p>BFR.|T=\4+\NHXV\u_+DׄêUP X=D)䭊J0 g4HHK(XBP`2\Nfv}-JieKm_LoE`(%rDgO.|WE* qgtj&H_GTZR~YlʦMu'/nY?-q7gTW(h p% [Qfd& l %FGe}GxW` Oڦ(m2;@iGcv^p ϵ4~1Ԓ f]mǕDi*}CwaPf8 adh_\D%C+$\``2,a0DYҙ*^T Zq@#Yئ_!G Y*$tHWoh UHbfIC+uZT6S%QKb+ M[A[Clg͉y QPNOm'n]naGP+KqRh#AO6ħ {6x[ U)~oЅٙg^9BFq;_V.UiF,t?7y1Iu_0W/7/jG?_sUYcd9Rl;,Y}%ԌܙƺjKc`E9!^{\я}W}㆛7-/1%}jl͞*2zq)fbH;)UBIA''9*8I Qtpk)~YI.aw~Y D4`֏ 5D9~vf<ƏOGyǣT4R>;%<ϰ'Pw`2 y͑~N̥˪c6}rB4̧Q8v]<) @ '`8{TB !>@p#\49RdɑHTR#JV+ Ӥ*PӹS'iP:ŠRL>˪WfźUV(Iq5&L1n$j˱Th 5K/=5(8`UΧV8je6m.ʨa&Fmsgʈ)1ӠAsVYίԢܬ8pqM7oX!a ~]u[׭g;kmXiխװJ){PݻOkUzuQ:G(zo %hTU`"84,'N7eb%99 `&5+l,4iTF̨@'Q(x(lkIqC[YJK$ Ta34 w ɢ< FEO*@C EB(x/(/BQM3Q-Yi cTBz p+ \DibW7v#=wZr%%^\ybh1vS3HBFG8c wR'tkb\Ƈ@Gz1 [` M/\z;1Aov1ʜx.]OWx绲/ :G6G %ꋧ:Ĺ.23o6,ذ:<uJշ} 0yd5elf0bE \@O-Sy`ED$ dQ*d1'ц2.4M޺\pwŽt/JvQI4?MrB&MXGHI| BɖL=`!Ȣ%)84qv&~ %'4rZi/) +;m} OPa[QU bm Pak @a ت ;=!@&0)\gR00\f$t^.5<ЉO|I.t6![~rEҭVӧk=)t|'M ?ԗZ Y v#g; R O]A_.z^c ̑Г{ f ntjRjvMk OS]ɴ\lj*~LFX58ɈdŒJ 3.RYp`gVдTx]c)#/?ȗ脅pFD=߾ղ 0зm0N~7oTL}Ȗތc2K[$:MŜMHC;.6^,$m>r<.(o&OQF{5pQSN3T{h:Rn2cJԒގzHes(%)E>6ď3zfR6syx&+3dnZvRe,_vf8Q,fwB$Q(ݥ92霃$1)lWgI%K)){zJq 4҆8ĖHFV zxH.+!kIzROOXQ^bmyc;hGE@t:ㅒb-V jrkZx8O?Hl0@ͿF'C9T-sm*%$JB'.Nf18CE # 4.76fR"\؈c Aꆃ e\ʹOЎ /%]$`ΪDUP2#&D@R/Nyw><"Τc.&"C Y':)& o74 Q̈b#: 洐gPLʵ$^ /.ϴ†&fK/wSkN,Ӳ+뢋'pZ4 ov6B#NbJ Lac1JCYKYt ZO!IXxhE~;P없0XA>,߼DglBCp-hj#t+| Ph@,ℤԃlppAR"!؆!cJL mNjN֏hΩ YȆ~i[t*oG y ukj{&p9L-ZL0ASn3f#K#b2J`!A#-1ǰ B*q]` !YRАͼf/̀᪃M2 sګ$H!.D섍th"+2G74?d"3FOfH՚3,7u"dU43V%Q8}J5]Op b%X Rϔ[,<Dz!Xl3ҳ/!FȥSN.;"԰rb+?b)=J"ND|MoG%tEC_ǂ^KKWOxgLLԊhQujN$xgq i1.nA=rAHOH!'pvJ l0|HeC6b|2Yr@ru_C`lҞ?(LqwT 2Q*%0,-uP2m'B7l4!u'd;r6vkTgblw@-@;Rn0LC,PFC(C_q ->(=> QjkSS0Bs wLw3lH*7od$Cpa f6bMPcH N,n`y"T`}3Vf:8ҵ]SbD{8;^Ԥ -xrMx3Mb&ȺH zAHvf?3TP׾mNe~!xXMx!D՟ |G1JBrC#E,&_ٕ9/A{;#t3I5ye#cvG6l'"taj'_T+ƕI⸱ų9[pu|RQӸ<@[,K+,Wj0XBǺ06 |k[[54k/<(Rjwvit=Dw-r—fcq#"/q %hD%hjsشsXaٵhͳX2z8J4£m(&cg6*9Pіdbc|3^.nnwQz59wЁ4uL̡/iٺu^s;4L̓Q': Ijѽ=FS42\dL4xC0\† qtew؎(P[\e+ɾ%\TpyLE`O^*>4pI?{?b}=&W:B\oYR~y~ QD$+HNں4ٚڷqCe(|t\iTYY2;&t7Q‚st:iBc$]e҆wF[2T-,RH*|5SMP:%YZ CQu!;yyCA*\N.TR%8\9]by~UQKUs͞SuB>ѕn~B1d$_!1wFE8nrfM%!!{bJ}Z + vPh`^]Z8|DbW/X͝Ў6XQ,cOEmeEQkH`z/b9=?-߰"xtA2z˒+[:|[¸ܷCwuIC]2^'aIzlh(a˒W!X^CᖣO^d\ tT`4ۼ&#^1 y4lҡ=y?9aYQ% د# 5Ѵl:MGj/+{@:ulEbh^EVsY֗j)e[Mf/Pxfzх%N$aKEXm1i%5ꆬTg Y[jZ%J묶~Aqw"N!xJiThS]udq{7`id$|xUƑ.e6i-hTXo›봧+쭳(޺iÚ: 6#]i+x$W\}ҡ#iuWg8FuUIgfFLHTUu.SzYTcUzU2FYB*cFCWuf+X1E-b˝jZeh)*EAWwxͫUZ m8XpcweXɓ\EkOT B4eށ)~Q] "AKNE׾l\NVv 4tj77c3\\(=,*ىAF /~O(ӤlJ7)Ju d1[5fh!4 䧠HV%2LDR\EQb 22Rf˘b1|3,Aբp5a|C N`! X"rbtPvBgXٌfCRmtsy2mUĖYވ0 K_w2%ysKa0=kCϘoqX(-S0|^D%$[j)E |OG[93\Q[AiK>Je6`ڃN!:LE6 %-I+Y}iN xp܄ 3)Y #ߎ=WT9t;G*1S'v qӳ߈շ$pB+.:Zc^_]"j6cMT)#Υg@*bPlGJ'C -н"A '??FTӛD\ST@(U?/R N:̧b3Kit!c:xm|, K$+I6o/PІ|UR(Py,:DiiDXނ߸+# -m3*< LnR!œb5:a1 o'"RQMazQ/% j-x KJsMb0_ f6-fz{t^ vkxuugd8.L9EUEU/]#7Y[+)25'EɩŒE*[bpK#N҈uU0"^(3FCĨ){޳s3638ʗ%*! JDN -׽sH:$_bXm.Ev{+\3HJFuQWJAjyyt-aK|N>dl):,BKoZ/⁦ |n@D"Fg'/]LT Dbl2UCO%ڀ˒ꄧ'c8Z7%B$/yɼHzmC$J[so|UEG]YOkzxY =pM:k}=%b_u7֮kx<ۂ7]Q.ױPŒw X/a~*㡶Y{Qgsݰy]kK>hh;ɬ)VG?y^\ 'x0qZ<[4ake7G vUvnC|+s5ϽfzX>U\7!>~FZgӡw>%6P)M mK}\T &[z|oHE}]*F+!k o;g`wzK'wD %U$@"%2[_GA2TQBZA>'KkEB$QJsLGQJw_, ѵJ Bzsj|3bsÇs:bF0wb|)tZkk 'OTC4rs6za~0Wr!~2G#U4:ZȃLfxWEh'#."sU$A<W63v׷фAsn6SWHNȍg8F|EM3Qg8TX#<}ÎFҁ!XcyP|6*Ma6dufxcT8W| 鐁i^`r1S$b3A9xqËxy!nyqVIIL Nq1m5\HـݨǷ )li6]h}"c|*jS,D߁yuC,-sIc9f Brm]$dT`(1DgI{waz/2tcer vD"3E4%'xoqE_4dWGinrv-מsɡ)7aQXԅCsGNxRP"xhcPWc1fui eEs^6U5<ڀl5l;ЉfEZ &*G78SR?U\6):A%%q n I{x|Z XրyԘ]wE\~xHd":RdMhHznst/^'.`y?幩} }IkFGžS|I ?9Z# Yk:*Ɨ)a(E2-ei6H]P"KT׺oeʞoNa;71?w$jkMɈUZ(u8k.e=7jE6FB<PG"!&#yGwt<4hfffZ┗[P-g7c"+<tC̛v ks+o)6K {8jQʽaڢɚʴȫơj,t;z۞*sϸ8~*Iv뗜kkyk{KN;k[I?uA{[)[ky]7ꀚ |`K {z^lʯT\{ƑU o &k?d`_+봽 LB+hl ifUcɺQ{̼քɾ9ǯ"7f*N}[e?bv}LE۬kÜ#`[|q?{8,`,tl cy"jkGBl*3FVhuY:"`IU"KoҜ:GMLiI\L:fܭ+k̀TG-˪x/cTx Ϸl)X* oʣ8$Ѷnf|+Ep&C!Gȕ ʚ%sͳ TJR-mXc\!sL}FӒ{giE]*zf;ks^ی ̈́-8 >i4lxCa}fb0E3xYɎՑ+<_9O-ϞMY~8ў+)Jj\#*ζ}-j  g *oiXƨ<} I⽛*MU ( ޫŕM)K2ݰ] @aͣ vsV)mcdit&Ըͼ #-8defȝ-`ڍ#&Z}k ҟ<,\5cczq U(a ]͛ VW$Kȇ;Y*gtffK.5QKֲn#~ʟ+X6 J[;^b#֛0䗸E_nٰ &KPo;;}==QJǾ;tp^mY΋WQwtlo>?Uex|a*o9.v I!WQvݒ_>MK8ό A mԍbu/-%xLEEݣ ?;$.rLxjaPs#^]?|Ku &= n 4=q] iH6Tҥs׽ѺNX]5 hׇŅ]OlIn Z#/ nMMl XXaE  $0aÅ.TYiŏ!5*q"F)+e/AIM9=93bB?L($aVQDCEFJe%UՔe#­6ʳeѮ- [qΕ[]yӯƭU )׃ kJ1ciuKYev#[s.bĔPegԒUo:pe=vm*=ۡoVHxHsPq'ls+$͋+Ӯq~zڳ+BBI v5LU4xzIPF3bKػQ .3ܨIp[w0.!JJd#(DcԨ,ix$íI!Bf@Vā_<)yνz6\u޾[;M' h:gۣT*foT㗦Z 9VdkǀFDxk]y:~"t#Fֵe"H"9T:MF#IX& **_\iR3B:RƱ m4TDCc S:N6%$ C 0*2I dɽ`N%y2o+;IzS%ֶQ8 d B^V|%]\9W {aHV[XNJT0P4eY-6F̊)*NđY)h!tǕ.r9*K}ʽ!W "a12*F)_Vr5UKGd˨+be'`FsZf6ŷ+QsIO+]+ |폃*ӸZjJ0Yy%B}tii^I{[*Lwm]ۙ灳3%RM+lCLVAc"Gqjnr"7C4j~◿y3[x^Xo8/MlB&ؐvf7EŨRbe%hOT` N: m9%N4z((/ ctI,S7nDP蘅׏uC4hJMb̯SX7&ٰ0cܲWtgkfs^X; ڕ}m̬>P9'C9ӳ^uY^`aB!껵eq|*j h;vG6D/?Tv Ǚ}^S|h!ˑ2CR*,Qrh6r4Ybls6gmi/DoAo[e~{W{JcKbrY8qQ<[8\:X2l \\ %g|3yA3#0C/R3A:";$<¯u{,΃BvK= §iK@VeP ;|r̚%0 +, eÈY; (ڡ[ԁ@c&=䉚m }>$6ejk5" YTEUaI,BY0AbX jt(R7rC_44)2̌48K%Fl̿2FQFqA`@Z1t[ ZᏒR[{!q\$9.ј|{+|Z[KH*ú7dŠDBlBȐ:Ȉ@*0􁥫U77} @A )5lsOC2s<:LS<} oDJS,5[@H9Q[*^q+.$*!*K{Y$ǧJ<[ W:EpSZT>*=b G$*ybL;` K` *AüRD3Ɇ1@q7%6ǃ ZG+'̈́1̏ͫ89!GaBŤ+(.K49Es,@ˢ ϮHO1lN,lN_ImjL';Iѥi,tMtC J$B GAgEsRfOpAD NH*TQmҦi RSt> э䟃"6۬J!M@UtMaO#|[ſ$R|K|OU,R- HI- 7Ʀ`K7͠dNТՔdQMT?vԏ8YAEkmNi뻶hDv6os+6g!p6e?:= Vbfb/j.v8l+v.jU&˾hצhYmr emsg iTt->Tm(c#dfn^|5>H^Rjt$Sb)f ,ʠ~kjIVTﭮe[=.kkL cNH!i(f_L>¿fabHaԼt<8)#g|V߿Ƹt.&/Юq '\6lنPd~i!6NB{oʚ!&>or-rxn1o0Wߝ_TL$]\l-j0^︎jo@oN`}䮆o2OttpFF-B),>X56&rGt~mtFؿ fVt-][lnlŅ I;w4J}rG&ugrq.^hfmaNa>dv r*5dWVp=ǎua~eQY*Gv[8kRvw/Sl3n56%hRآ·kuo>xCtBCsAGoPtw$tenk_5PAH'yo _d{Z6 7vqGq`CVC׼4: mxpzTmvZFvl3ov_NrzFtضdb>^Մvnw{f u|IV}?Z+uC3f1RlqƢ뤮kxMxӿ.}l꒏Ť)ᛧf:}~^yf{kR Wfwb-vqJwJ\|Onm (k]qzhygGu%WN#vA E~wr`%p A*T@xp >T1P"ć/Vd%"FTM|J[T)̔1dsΞmj֫ўVz6lڭJjј|` O8s.4 r W/ѺͶݛ^9zg/?o??N!9nV X`2HqA^ED^ac5^u)BzXcwy8+׊&xKf7xփN6c1xڄ 2`:>UPGV.QQT"8ޖqvفܛhz\%MKYM1uJ"zFae6m YةA z6PjH5Fv!b'.jc(݌HA6>jFirFD2lP:쥬nG]A.z~]I&p'xfɮyɞ[/R{f[R\M S hVQb)u4HcAxX|-ʘrٱEfqi9kHQ# 3. %Ŵ nfdm'ukb/WsfcVy硂Rhw+݋hVVUVc|4^|m!lh1^Zbj` ʢ*y蹉ښ‚\I3EyC+ZҞ;m^*C[NTfH!2,nܓ G2 wN_m>rÿÐETCyI; Bo"gJbJjZyf2`*x]P 3/HS  zqB@bL* \{Q 'q}!j!zǴos޺>/Q;Ru^ 3ȉ%E"5 0Rd+Uvt C$iH&*b4RF[Fbͮ1 wcElw$ ?`OBZRJ)шϷD+]">[ %ZiLuyr_ݬg~ t,?pp@z!7wč8H Twa :-IWt`-ɍY Omp ]hPbӅ\fB2W7> 0/oZo}L&ۘ[p,dŜ4fv*?W(4\f$:&c`4cG:g6p|(L.g@'҄3KjKu||i;Z`#lH :Ӎ6so&&M$$T$$T'$T2$TG$TG$TG$TG$TG$TF*PC5HC?GCCHFFQGGTCGT9GTCGTGGTGGTHGTIHTQITiHTkGTkGTkGTkGTkETkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTkGTnGTtGTGTGTGTGTETETDTETLTUTZTdTkTkTkTkTkTkTkTkTkTykUlkUlkUlkUlkUlkUlkUkkUkkUkkUjjViiW[iXUiWPiWLjVIkUHlTImQJoFMs=Q{5\1f.m+s,v,y.4?MSTUUUUTTTTTTTTW]gzmq|ueu[oVjTgVj_njqkmklkkkilhrhjkikkmtǷӵ״״״״׵׼Ԫתתتتتتتتتߪ٪Ԫتت׫״ʹ״شٷ?H*TȣCFQE1N0nj -HRdɊQ4GK0UʄpcHD洸MOS8j8ÎWl4)76 UǍlM:fR1o&JV+1Zm)%lcN3Vkݸ^F\Cj_~<ߚ 1 .ŏ m aFϠCMKGl԰S۫qHˢ kIRߓ0{vF3z3frl$jkWԧyϿz`h`~&ai#&1Wj]P:4[L,vR)O:܈{AuGSeV3Ib6u(Fo^_U{&5odE!6r__ d %`afdivlٙ.9M׭ h(l&: ڨl1ɛmJ"n gQqq) 6iE)oMGt'wVWlwyޅՊ-ouH֖ѩȪJݲ6e*-R+mfZc!pBN2fhr&GU(PU4Yo+Ksw-Vd0IoeJ/U$u]qEPz)SU䖔Od]-qdJ&s̍e&e4ì3;o?&C:F0Nr(r-%Zz{rn륝iٶ)o/[lK/c* ljk+Mi| `WIfk?24mg!BC ;F[뛩Rϴ"r}\.0,cݶk躉J)yv5g[Q/YҖjj~ೊuA>レ>b@g6}B2znbE FQ\KvY@jX¶8HV [xЃR؎2ş8ˀJ"nmUy6*+3dVԗIUܴm ղAǃvCqd֬ )t AAyPˌѼr|)8V " -BQʄGh/FyDWdZ)14F=F-"-uғ@(Cጨ4$*RN-P#g5K,14:FB=0hyN!bz(5ᚷWDnrA!*8I sxv臏k?e+\yJpfs >Q M}3!p^@G{4MGBcsC]6j#PJM+_(fz-t) ʍhNt㈔_*M: ' c[Tāo"(ϭr2CTYھov,6.ƣuxECBem381t $+Y0@5&49^XǁфIڏgғi8Q8Yݦ' PORˢ5;nY%Fb;f6y|IrPLU52iv˯טיNM# YV| niA/Le), " Œ$g"!ȹY'#E[CՒ~IQ/YVU[㙊kѠunaoC=̼ >cS2 B=תN5d. ݬ[ G- iik\ Tŏڨ餩jm'[NF@9dfrDe=kn4Kƈȋ|y~K@qxbl}'-b~QQK""lj#"H=7^ϟ/'\5[ˆ1w&`(6UIjKk(4gd LCO(4N1h+ 5S5QFɉyKM,fw`xo/^WHc$iyX9"bP<|>䡴l&WIf6( ey"$6d>_ K^x3x訕Vi?5ԒuѹPI]G1Ho/RS$` J[ NQw d O鐲z  1j "eKם؇uM~5oT֜s,Zp?=o0`g˲`.2ƀK~Y?ޙH5Ln+vd1Nxڕ\+`,oTfN?ΤSŇ3>C9\C5rr>#c8sLbQ(egyOaV3>wV>W:1 P炃 @1XWuucER]pU&$vm.G/-w[$#/AFY[؅`W GFGj-Av'1<#iA$$#R7laDAvOoy-U2%]%GAGguiMKu&kVݗmyS{RQ$3n1x|ȃ3 AP @h .hTT)@5=Fio(?"+PUgS_ 07iv~hq"E+Ƀ}c>q5E6xGzU~cVKr r])gl$9A4((Gv!*.'rdI46r&wKe@v-!!z# ӊ5.X4݃;|=ug5b:fgSЏpa%EBsi6HrpxgIGijgHy(r yf(f?"Ni[> SցefsfwY!! xW1|0|$ ;'6u<"F1Kvd0%hcXjq0d"[@?J %89x{1rz<$QX6oF=kW{+Ilj`Ism$uYElwIJ31=Y;eY5x|˗s ESA (L!\^9OXz`phDjYTa 9 (0D7%z"dt$䡞s[-w uZyqD$D[YF$&D,\XBZZ-1%Ū fa&Q=a%Q6g+jS¶l (C!!\\}Xg3g{T޽]@SQM~u2~¼,obU5̘:VHUme6)"@>qfc6ד#$#%hF~rVXľc죉̦?[TM 0$59~{\?w   Q4WF5ڋB.UB7HCdzm\p&R7=B(EA w80N(6''tj7wҔKJRSCfкU"BڦeSa:!9H#ubEz4*o0B#'rR/<1\xߵ$Ws&'VR=,/1P5WHj̣hk%.Įu~mi2 _ ?$'rb!od$fMtce@@9T-6Zx}B8*q1]$*$>}wv>X–9d,ZIHSť+&(c{"n>"MI6(eZR$?h Wxf$+a>IԹI!ϲqk`Dړ2i?3E1OGkݫ7Sc}HQx(൱|f䕓!>F{WwP.)5W΁(̫{@j#j7!z,f/y6/dW^ U؍8RpRFOEq׸'8z<XBb+%f[OV&+]`x9o,Ke.W!M7$x<N*EāoZ)aEј@VTؑH+<(3f,YS#͜MAg>8r$[TVȖ^Z~ j^V{qE{VcNqJSHśW^}8T&HDD2Lj)nnk۶c1ڳgǥYZ#1S[[d8i7u()1WXcmVLz…=RQ}z~{cށ;T4rTRu^[7ly~jŷVzR&QK;xo<!dH&2$Q0h,w j1 JnjEZjIRjj#R駗^,"#C1PTɣ)x1%'Krʗq"^KŜ)>@qhO%ɛJ0HnFA袖#Hh%:z<1'rS=GХ"HQN1z; [H ̘I; "vFjM;D 5ъ{7RCբȲ,܋d'gi3[sL&):b8+Jя_.аТ[o )vrȢV6Zz!ne?!Ba98aMd$BU~z5sJO2{V* Qal&P|C򑽱7_B =u mNDn<Ô4#(:9Mƶ\Φ{IzyF̟,7jsG:d ꩏)Ҭ(&w8LՁBBzNIIpF&I'NAւĔ7'k x\cG6p,~tk>A0yy*$s*JQ# NՌ4d!VA:S W9c?/-,lrZ1jx`K}s+U=e &q\OH&7,n"E?m0zQ6";J'#@ȫd+9j Q)$iuH5RkHl[E>#TAFY͑e[`&o;.r+r#%5fNn *WLɫbD#@R&ʈ7yPYp Ȇ'7( n@4!~c(^]Ty c?a%m$y@7b"'X[c䭃XFY_h: 2dg;UE dd*cU GJg7 "HQ"1dAQPH;@©*wB~YKKf cnm 2M5!>dCz4 \ HHgY;4`dez 1EŤRSMBl薮Mnu!QDQYm2$U QV$הPͮu}I^"\x=I3@D p0؁c:+x$w2lՆ3WꎕMUe$J9OTCv UV(Z`G5;q"=:sgE)(#8U&tynW-I(^Jf!geSl]W$>&2[()&1[+hƶ?Hr˓_QET4WuPZMCA?ȘVEeuvB{*]*?^ٝt5~b]A%mkJRnÏwwP2HeHji=F;` ̨zvc a@e򍏃?S cNLM|uCѥmԸ6|KF<, ,T+:U^SD75Tvv.=*38Fߨh}M_\4F~RhI*b+<֬ʝSчrRf:K4]m!O.5F`ŵ`h"KqS$ DB:pK) }O3I8Ԍ?i%5Tf\v 5_}sɏj`1Ʃe>HxVJ17Ia],)*-_S:Ԃ͸BŠ?%_M0 9OQ "Yܠ2[26Fiڐ,>d!bF̣F+E2PI%;EH$FHMBFБ:O4DȽhźaLˣˑ"I5=e| yA4FM<8mɺ[.ے>Vi 8I,G.*:"t EaN elrkm$ bepn(%LUP_  ZpV̌=S35e,ExQьLm((.l+eX׵(LKi(EC0fkٶMpdY̔N EucPYs 1 #1ɬ_7IlObpd2ZxNUAܝxc2o2 jӡ1$^+ÊggZ`HH),+5Zn7ޟXenkVTr*#Gs50p5r qcɈ\m0fb!3E*cn$i 0+P"/WIZNhF NHv ?IAxu@[ JhS7 "W xX׃jx89a ~+cƁ8ѻ1!YF]%I t)7zWB%pDevb5$S\LPmluK-Jt)Cz~kkndvF1WaTJb5/Ul}gLl6ivc9SpU 6T~$^O.9)ϙKgG*g2WUt'nɾhsW=45nlST4%qu}`oG]>~vq^s)S>hSg8iC`r:ο1P$  v!Pbf=S30U,W!Na !w tD0_b--V)ZD< (@L:j]ELeF ,rꛓ㮳,NBRmn.z5:J r1XP5`1 HUpvS88hQs"{ ?STV7 R4j̫1b3%n; ::׬RoKao򘟱ޒJhM!P`F4j:f2'q;߀ w“ggHH/6br)F象B)\p;D% /]K'ϱi#hDQÃ%#Vd1w* x۹b$G1yWaNrTQ|X%.VԔq㍵]aoձä]l?QaŤp8*AݧBaN7`$j"0PEhT7p}E2Ut bCq%3itn9Lg>G7U>y.<}JI}-~;G߈g)Ҝ ~P6 q:E\"a1CDqL!@ ЌPߌDU||eLj<p \ԣ^RZ J|ʀH ڟ;YeY ]$D-~<] 4U[g9 HMe"IU[Tːġ$YDr[ fȃ?P $vNQхɘH= N/EDMMT$Pǽ{K}bzN˙_% SnBRdKHF/d,4i<GAH/Rrd`qdבYeT[@s96s}c!JW]`ۗ<8F؟qJF ;WZ^\a}ŝԈOg8νx)w@HD?$ptMcl6VLD#vtd(~RF7k.Elୱ;J4 FĆ_ I(Y64mHRu)}IEyPԨ\IdJ Z,"\APKI~qZqO-īnJ%. PꝎ&-NxjJ1k_ZB#ZL e$ w4ؽ݌#/Gz3{QXR;M_EkI[yz=pb$&M0HbgFF\e;5(Xo_/v9WduES Albc6P4^{3|`F=-5LwLBlĖ\ˁn+[6;\vpG6.:BF\=ڿޒ/D`wlݏ~BQIqO?Ͻcvǔ̔~-y6ډsp(y>hWo +.+@xS C !>ĉoeelF[m3,Ȓ$}#K<^s&͙2m֤  gV'RCM(R5ZPftaԨ!&XeўUY}f|3e uBT:1+54hIbd^sT1pU3fgz$m/۵ۦFZXc7lٶ kRBNw!^xyRyrf#?FxL{AծU߽ <͗f[m۾6 _^|/'=&.2i.k7mX*,le)"PB ;*@B2ĒLPmފ^ do,kOm&A!/JOHdh18,@3DeR죘h%/ R"L ˰*: #X5;O#-3F%㦠2RR1K1E#륹D .D)^˨4zQ$-[(2xUXinVZ,K3fB\g/rHhZ0n p'@s: <Vf;n#q j~SjLÖV7DNDcFQM/F5v-%s-yZ&i%)kS=K-KAG|B/Y8I*r;霬sԌ1ԫ#IFT!5y.}H'm #C\.R4Kԫ|a [iOT Zu &g:R^CS('Ŧum}zromP%na87WxÖ:4f䁨wcVzmEQ-ݯ1CF.Q[^v,xeM2<6B&eҘ إlt;COA nPt ljbLDϼ_ y #ŴAA.UӘ(1Z.5>G3)MJDe~r)>WdVU\9+jro\@ʄ*pSBv5 Sͨպ9HttӲ*x=!zn݇\O!-揂ފ#7 sMB B L/.=maRfE3 <DZ2c7bT' <a 7ef4A^@z*5ƕL6OB3"-5gNfhKC.%3"ts7MŦK+ٺR`@ŸKInA&Bo[<[smcI{b4Uzܮ(9bq&AQDӟg>i28NqHQɃ^)$ b٢ӚpyAsdJ :T2H3LFؼH7S;S4i`CNlnAN+FYSPbG]l:\A_YpVƆ&Y#x3W23/]8Ԥ/ǕHK*xMzX UUUrv?WAL% zőx,,NO);{HK,4r-3f)*J)T#=֨T/S[{])!фIƀ@?.m\tΟ:f 9Em̨3l͊ `@uc oYQoѫJfX0g/jc }h焥F^ .7@USˣlv֦E)^JY:װmƠ3At4٬%;falũݪzGթVX WgU 6b-**7OW$;?;ƆϮ;V%͝'+ˌ<Okb?Q[&S"GfA(ajT^h KxKin&} 椨m՞9 F4-[Rpy"u{H§R ^"l0޶-tkDU?KA\- A̓2r61 ^ Nn "Ai?K\Pq]G8,Uow/ ީ e)8yFb(^Fw+G,FȁF2- ݏ4(/=ޏzֻ'8w\Ԋ4* 9("77|4[r]n+洵:Ȩdg)tGs3 ,auĮb545=LB6.H6B˼GbxiNhb*ENF(6*}2 ք² ?Abj\aޣB'dHkM0ORQ5\e'#,Jq.n'j-RASld-*7p>rFyѨF&Y:hLd n*LOĞ`(Sv0>>Hb.0EX7r|P}4|G/ &6z*sH"ϴN'FB8 PV^.; 5q$qwڢOoLZ!PRm9Q2- jSǮ_ <ђCĎ č "k!K"Ha]>D4K.2"*8e}I`'q"F}  5D ͑f==HL ij!QcXvDGnoCoAI{0T<!UlɛjT! $iKr%9Nh('F`hG,TT5Dsk0D#\"PÖo5p& "Q3D&:Q8N9OqG!oc&bVqhAS5!B?Ա2W"hsV[o?!QVQUfs2~xa " } sxcxDf718; 'L[(lEjmXI&v>uDY)OnhhI!ovPb#b9JQmX#poxkn択JnTl8br4-Ԥp6.tk(leRt~[W" !DNMgl/V O4\-QRJ>o$4 ՞w\xx-tKCg).!xTOMU0z _FDX8j"`b ys$Gml]y׬U1'PaWRaE5Q8N#%B?e&HQ -]T\5p@kΦ%qӴfP"+6W*N+!BuPrRsJBiLb. * . Ou0>NJp@7WcToӗge Bjg .빞y{CG G#t&.Z$*<08U=dl6\5|3oD/K$'ʌYyN~RhXKZT~q3@ kXVc([8%f*B{Q»8+"lMWf){Wz &Q/.X/)M*٬vmu2_4H6;n;JFɸp&27ǝ y wyYiM6&`JHΓ!ZV,8gTv0v{8:R-i FAT2bd"+gYdQd0Fa*e'<[6#tӅbGII*"W٧\h)<ak:KI4_%s#ǝ@Ʀ0IGͽgCVуARCM#jӲ|N6ܙyڗ7]Glgp,X3 zYxQyL06r}*x#r@Hԧ$r>ܲ ;0;Q5ci€8iK %"؄U<Z]lB!ɟ99p<C2B#hrWTO~c! 5Jf:^d$!j$8tR/(߻W+mduA_< >G5vzLD* "Qdim S6Ci v~BS0n)9Y؝=h%fضEgN?]Z V3,(l u{7GϾZˋ><φ (65@C@ b͔1Q6y$RXqF;rq~G7<1#șez 3'΍όM*)<]hk-Eܦɇ&TيB ׯcz%seЁW$Օ* νK7/޽z70D ⭋U.~:Vmql'+vڅ> p7ygؙkG۰J[>R#Nlݳs[ǽnOhæ%:eƞvʤ"V~  [~P c[9 z*X>&anňXVPd("2BLe:3=f$"JĐRUN/sHafI5C/ eRFّ>4A)آτgfb aZ7X8'd 4W 6&a\D`~蟂:W+d&.j։Kτ gylMhIM~y "hiEGkm½aKme&\r<G^Tt ,FÂfL/(mP*N6ZZ.m u .U\\w`\ ENo6xc \o_ dЛ+fOaTL$oxČqIbK(dT~$)CG'%#MLrH_zE%TI^ffJgmUT_ VcM Y9a{1j߸l֣zTU۪eQ|vħw78}B~TV[f믾- \jiZ5*a٦:^C܊Kxڀle<RĻ.-÷)"/(+La #-NIdeREv< E@'f&NeRnLS:iBͻ$3ȌZ$yk&Qw-dPvo %e(~ǁ),p dH8¥iJPeF @=]ldZQ'i,3Vm1,TFS,E 0-A3Ę)@' #Ii"Ƿ5keQ&!RڠyMA9*v$b8U-#xDbE8Tk&`&z+I:-Yb 5ڥHOk$.[4L^J)(*Eܑt;PcRv1TAI*m/o(E0%_)!Ɩю̏&0\*JH< !a*c pLNZQк2PB6BSK݆'~K.f0jW5sxEz֋UXMfĞl{mgB*(BVKuZXd'B%UTKcF3oIql"6wRvRc Ľ]T0B"iv 2]}-S 55rt# ¡JCmIUr kTzS*N߀W{؜ &<~euw2Up57[2W -FG/Ud (Xq)kVTbDNINc\3{^P ̥)]E@;BQǩ\Pƪc^NeZ2Fm _uݽ 9GCw]ޙvc/4s)Jb꼪0ޗhfيU-nl Zb_F+L'٪:B+mE wb(?>! t 4Xԧn#by:N9*ЪNo@J~׀Z&pajrXUu!xF9ޥU *r l^9WlGʃR }M=Łs$3M.ɥyOJUlJ@yë:E-\٩!xuj͔ߺ#rF3 5F*-Q"bjO=i;֛wSGKO!5۞Yc~%2_{\Eu|4,}Pzp7_n?a(Hxfxgw9P1wgwH{e%U-r>qqKq'H&o;C?Rzz0}>zS-*,G7a3NucNz*cxs:NQt׷k>aTX+WDز7;3P4y"hV~Yu^džu~aqLv;$EO%yySyr!Y(a(Wg8{Υ@  Sd=ugnԖl s~(-bHWgf7AA26WVfoE69{Yx) ;9a 36a|!jǸ=7 bi{i9sOzA֔~~ m]l#X|xUdZ%MRVWE'CI$eVȐ+3#fe^GD^!s_؎e2KgMlߚhAa\QO[c"\ Ba*KUzKZYj(%f$;':wۚYd9xRƦG:fǭSlIx~5ˬZ*T#m5;D[ B)>zT1mQ_0uy낺kg+r&۫{q{Qt.뷅۷jY؋88P!ʽx~'V 5@ᶉztST\-ҫ}r•J3H" xLm̥ ;*QRf*=ZoC5PH&Z̝Q|ϱlS  LlI\F=6aqq)#;dXȐN*=jؘ,,$ {|+C‹`U'g +ѥ;ZS<4<ɉҘ(j!CVf"$d+˭*ѷƢlwR*\ 3Z.xLC-0D B_C~\=>C3Bn^ݚuACC+|E3 ^C$LطH m~>B+$lNN>eXay茾!JlG>-@N`lL˕v wB8X+-'vV>:u먘bXuY'PY=EƋzH+W:.#6~N<p)Nn~ ! _bD?,|;hCO/](-Z#oTeSxհg*h^1'}B ͻsY^~٭"*Ͻf,[ p"Ph+y(ଏV0|ӭ@Dad%q2pQFР<4[SK*㣿$g|-F2)k2K!Ҙ2+*14,+DBj!e妈))S%Rj.9**$54'ETo!HԣT"=:2cdJ$Z2LTJBZgU༓_I_Q$ ;j>yec<YFUK& |M-QGr5\t{,EV9[-VϽh2Gӳu >lǽ&gKA,u6=뎠SKOln7yXjGЛ cL)?|:-$Ae pjMzԦcڦ km;fz&KT')4Ecfen i LKMwq̟m-JDط #HeRr~L\bw*w0_v˜mn)qE%5$4b [macN(1peB`L'F H[j_ 4Y.–]ot^A7vd$ Z'NubauŏkkƖ7camH6ň Ɖ;lݸAȄhA^ANE%OL :{%A T IMlײSqk LA .qKe;jY`"cB'xj r w\+¸ҙEȘ٢3Yn.(-*]#pLpF4D"جz(om&D-%}]=HC= N0y&5R%Q%K<+gI9W^ ')+Vu4¾S\`{~1SBZڎ2{PєdT^q^ЍbDZgɪٶ.f OP=٦gqAY+@Td)K4k=+W͉ƊV *Y&Id %FYSOݨ1-+!A?PLJF,exk'R̶15]s M!٫T]^d ٛ\_~ju_|,VB> B6q-3bj<?ZRr#r@gd lX2;_ft~ߝҩEU6Ks~cLxqߘϠ xtU5Be Z67l 6Ë`jE126UYlPn,|7(zsL7HWFCȼҊCaA0|#8(ny2 k_'2Xwvg_ďlF<9mqkQْ^g`SB 4d[+@'S9$,[1+V94]9-l۩k {6[b~?jB7Qmq>, )[A{,S4 :C;XY4kB-BI40l;2?ZAxmx j"pʌ@*(&YpZϳC&ҋ‡0uٵϘb;+۲ػZě=A|8M㫽im{+9˂;wB@,ts_\,aD7 E`,7[8;|®B1<+?!E^ #!%ڤ=K99mj9:2@-: D.a3ABܹPbD 4:}ӈi?᫐6i;A :1$ ڣBy ,;ʚ+LIüä*0ýIkIzbX43:S>:A*j*,AUђDǸ*A Hb|=iqhtrD)E½\aEdH3+̩el@RKBFrLx ]ɴƐb TgFeLLLi@y0;g,:!<ׄMd[4DDǮ$jj.uTΖ9ٻʹ !I!$J$Ȍ1EP %=FI$O*3ž%1 POx V 1K NJC7x!;QD/!Rxa : HAkEFc|,$?d9I &\(%?y`Sͮ -4 9[x *&Ρ"-#Qb9F-Q*}lLNN|B?ԅ¹LGӏ:LOUEҴk)T= ܝ@?H\MOBe08HTP;dllRPh[%ϗSl &QRʙ 9U AGrQjKv9Gת|wKK} VQ]Ǽ=!]X!dS!C9 bz٘tӎ!`LD R)Y+7uؗYSMl  .AMO9J!:/5XJ*ZTlbJ~$ONl̎M4 T RLUMP)8)٬?I[(nZP>O le \j-2rBIBK՛9EXt=TW`ZyMxxE} U`P%BZ!mX߅%#SZ;aO13HIIj$ageVPj"6kmb&Zm}ߤQ f]-p3]ZcՅD'm٭PрW`[5,K;D_[ޅzR{S#0]LqL-/^In ASC_MdN5  Y 0_G͗Z,<@V-9~d`W2&݆.]3h(hGc=]ccR݆;BVa>&_+^b$Y U75gfi䟞SQgfV&TL}8<\Z3].;ڥHO` f ~BhfU}NbߝkV=j +g|5gecd'^#&Ff]s%~P~ffh߰B*c260~ ":H[/lllic׍6kNfc 8mˬLE>LFjn6-jԬYPk uA9y5¨䱔W^9w=Q_>HތgT:0%Ti^kg>pnkom",&F5e G?itOkk#iqvoMn`y94N6/9_u^q#h^ȥ.j&ۥnr)!iu7iHnF)n2(78Pl?cӲVfHO`NKeK\^o5?d cd &9R`k$tFZe Gaom Auk@^NxiP[/lLO4&#Weqf]HGmgW=PM!Wcm8n mbvޖ]GJ'i>2r^-rcف B91Gw|wX?n`>t&֩WM`[:`MqIc 9e凞v4OGo겦tfV6KOyNlu~ug4sVEF[wV Ty\ou~uy.c-6W/qF cYn%OrbcFv'hc9n9wb}ywc˜Li:t|Mmr7궷%q,jz|UTjoσaMWn/e/,Py܇q[}Q*iΔƞpxxְlGΥ~MJIdM( ;QzM}|&'g)WKin&t@cH(@ y8LÉ+bES<( E&K2ʓ ?~|3%Ï[f'7!YtQ(š@DҨѓD֜"&TGbyUk֪\z UC$˂ p͑ }W.߄$o& \s0 Q$lb{6u+-}ThN:a"Ҿ'#wPIlmJj6m~oa?v$Ze u-w /q+p|k. O09ւ;qᕣv*[\@> ރ0:pZ>. lXZhAL2~eԙ,h[фYEFG0LmBzFC1Y-!dDp-l<[s%z<׀|2#҂/-NH$Kf7rrdVUNK`OicᝍU0[."wAF6}qџV1.-I$Rkю3 eGP^DfȰ92;XiKM:FWkzH'bF~z_6B]ɇ|<]vGo`,F c< TnQnT0[\ =Y9B1lc奘,\/x"U-= =飇rAO 3S Fsw>35qnd`f,41ϳ/}D :)O{ӟ5B*Qjԣ"5J]*SԧB5R*Ujիb5Z*Wկ5b+Yjֳ5j]+[ַ5r+]j׻5z+_׿6,a k"6],cX#=N#^,O3~-h3`YrKE-fZZeck[ےVdsKjVOq+7,mQ䚶,t"Ht]~7/vkBWeyZּ-r\Ʒ l]W nhٛ].ec{_{,6V-p1\ V` VeS+3695qbxEn[dWG?q ; b>obٵr~|ϙΝle%􍹬1{&AE \nyj3\8,]8mpkF'+g s/W ZOO8і5-^6gC;Ҟ6mkG; !!,@ "03 EFHGHGHH[JfKaJPGDC<:*445+*G%%R$$T&$T/$TE$TG$TG$TG$TG$TE.NEELFFMGGTGGTGGTGGTEGTDGTEGTIGTiCTkCTkGTkHUkHUkHUkHUi[WkkUkkUkkUkkUkkTkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUkkUlkTklTknQjqNjsLiuJhvFfxBc}9]4X1T~0R{2Ov9Ms?KpJImRHlTHkUHkUNkUhlUlUlUlUlUlUkUkUiUfU^UZUZUXUSUOULUMUQUdTyTTTTTTTTTTTTTTTTTTTTTTTK=}4y0x.w1u:uIr`p~sn{|itbm[iXe\ggjkkkkkkkkkkk_lXo\~ikkkllrŵֵ״״ششܸͪתتتتتتުتتت٪ت٪ԯѹӴ׵H*TآFlIE36q2Z4)Ɋ(-i֪*F<1a _^<c-MӨSV=҆t~ᇥGtZ7 ɛ8q=]\DG[A0wSnj\$ I%>OܒzLuꗅqg`5teqv68J(C چ1@B%XRNWKagao2$)(L(aSHSn5]Y5|ŅZ_xX'\iN2hfz6khݚn^RAjH?| qM]V%*RPHy: E)z:rAq~"ȝnEr-‚& 2^yV{ayd'0]k~eI)HI`Fwi۲9mF`@% y?ZUقLDc.[׾ARKɴ(2|V^C+vU1oFzi O c~5^#uQ",l/K&me;1j$3 0. JI GIJS=gtLz#|*6f6Iщ[rY4fLzWWK]VTa8bKbxsgfr@?.|s4sbEc8m-2Yc.T# SREU6[NzEG-*yM[XV~7a<|A%"C Ga#\S&gl<<%BLCº o;IPq- &8QkDExK+c).ԍRƇ!O;Hdx laCUY1}IN(d%Qӌn8'љ:W{ndWV9 wq]F@xL_\6ܤ)gM&VQəbN8}<%D -C!'0>|+A2luHI# 0}%(dcͨR"SItɐ3 a46I66tԳ70/`C:evC&l:L iPIAJ 3hHGq&|~w,|b2'pQ3$ *,.tй]f}m†HW մ&PIaU`tMHI6!HQ:F9 hJ'9|QUbrфʆ mY]fR$:>YGģ$BU8f & ē‰ei\qXkDMLemp/:()J^;9!IA/8!IE^%qQR,%]=@"V#CVdj?٭/vishX M`f̷uy[ȘJ-bcJIZDTV=ҡu`C_9l=;g*_1Dm68llx 67sbbO̱!YO,E9SQCXr(ebg:& P G4PU0  5 t}u]7oQEgl%f"v;AfA$C2j`P[؅ZovY fv aSnSSqx8DUbݦhP'Q#Vzlu1cPJJ[CH%EDWlеI>Q\.3` &GCm9Mn.>XηX p 58@ \E%PgY\f>A&j)r,1eH%p }'q[Rpb7LfMad5A )s$ui/7r6cglA <7qZN\ASsaza3siy4KHacA1wly¤; r!cH9a@=FY6:W(9Y+(.oKUVIlhlGuDžCVpj &8.^drE\ASfA8|%%wqxV92g\rFK br\up.2v9~gy&x93R Xђ|6H5|`4& Ks2##*3WjKU.TF_6 rqYF<ƕ]ddFv` ,OI#d:sXbw-4wK)UUb:?Gpo tJ"S8 }Y9|銭P_2naOxcBI@vU($w[ⴂNvp闩I~HzYd`Z Ip፝Mcq3CBOG gc 27'$y*}:)dլ\usW!y6ǭڭś.-|a?( x+ W y '=h2'& c%q%V]ҪfwpU˨xѪ=@z(⃎WI2#ӱ#% U /Fm%bVjETKt8a#!gBaf(VWXcz*nu"QbGIˈ|?xg5ȧ7=tѻt%E&R!W@o+k@z68ثEPY>QBd>ò5U/ 1Gwt&fJto᤟̊D}&]I1aߺꭔo(}:-uu-'9( Q #i]/+`k: ˫M_ԬXHws,˾ԫhh^1CRdIi<@1G)>kѫ_ 69FY{'Y1{Ayv/w2OR{AUFwrnЧ2<  (P 08r#Q 'Ⱥ+*%_E5p+CİPDA3l<ԗ"AaeI;QfBSN|ʟȶIk&o~ee -*9mS'Fe1L@Yҕzd vh@& 9RZGU _IҳD Ө4dy\r mH%rMv~0WxyKG~xGvv=~Gߡxn|"4'}3x.~Mq'}rTTYQp+Iq$+Dxo.OrmrO*!l$c,sܬe:AeE!{*-ot'E*T{'uO}4TCUNﭚI7$VjXi<aAZiN5Qids!:7vWcs$6ee!HbLz#L! fgeʳ˲7HTuKX50.)-D,ee!;S.¿l \t3OU^ plw(0V$R4vB5Dz8N)JӶ(4SHBQ&eH[#]P" lh!!tiAVx[29fm:#s,Ԛά*v*>R8w &>sE*61F3h7ӉHl![XG(; МWLN8![.M͢2H$H iKXg0a-!x0XXivDƾt$J"*|63^+L؋<ס."Wo{RGE/=5*Q7"Z?#ϫ<4kFf&\K <4nMT>fKI-HMTP͌2/cĂ+jDixxx>hK\*jc "8߿y%/1fs'j#Qfٿ IzF&r,>_uKa xciFX&?vMƔӐp@YPgD2`C:Y\H6d,t\c$Í>1_F5Y$3 T|5HxXz)mVEI)c2@qGY҄Et:!/ Gx#(/7a&y "|Sd u`<Ȃ$Tt2U$2h d94gp}FHVr>";^:IeZ 'hQ7.9*"U)D>`, XAg B$~ tEGg #T 5S" IyICj-΀?FD`FXx-8mMѴHzIϖO"#@< :|5R@#wdaFY1;4 ql7?[Me+1`gd ΈȈo%[Y$ѶU)|ꘒ2"9s+j ynH'JfN^$H'E,EkpRXBnS*gl01u׻ J#^>!;5zd20K#̐Є GA^,%) F҅&2gu-q-'Ff98>d|DB2)W5鐆ᆍ yujd"z3pů5'L/gr D##Č@Kt0RD0/:1]1Ra+Y1Z} :cy6n;_bAk~uRLY(4lo~m*Wh"H{+q2q SܨYƵ* YZK.q>N t &Sl ؘpBIG $":'Pi%&Qc$^5+1V (0.qF\ʬlVu.v`?zϘqjH w<P$Ӝ:CGIN\ $W IC2nJ/Vw*2ME,B%t 2)NK_ZN)mMFvZl|.' Lc:.WŠ?ʽ8%a=]XD?J~̓g'.:yLj:"vi:]٩$42Kv+Hnw3d ŗ>⩦x#;{xٷȲlG)j Zg:]I,Q"%#9SzRXJ!ZEeqɥ`Ӛd k} rR?(MgZ5JdGY$ %0J۶۽xnwz+aA-~0@dxp^8;.;zP!< /+7S@vf0Xhly ۈ4()2kyg(,k] xllr6Tsh˰J"\8(#SJac~x8~CEC<;SzA\1i5&ͳm1* S F[,(1ؘ8U4خH1Xj5$TݹH[k3m-82x0;sɶ2?+vkYA7j+RȐ2Ɏ t={I/Wn(8 sAs0A;Jλ7t<%I h*@iӡ q O ɣR,hQA .C";yUR*CQBtm98y؎uѸ 9Ȕ̖4lʌV\=blq\.KšC.(aL.};0kVܟW<=M57)"=&y٭!W VS<1WF5Mؼ ҫ<1˛2,YA-cr/j.u=| Wܟ<* ?渉4L X W75<T喐à1%uI4Jz)$2 ˏYd  Tazz2$)[hj,ĊͮC (J,u(t2 3s!C RO&aи%m T>ճC](K5бSّȏ6 D=%Q,!ˬQݷK6 p\W|8ć@r*>,a7ɲ5oē?+Op SF$Y>l  Y:! B8\O҅3T#̳Z.-0 J 5ӋBpdJRѨN3>fȽf: XK(TnUD=;+|& FՓ~|?B7 5x6^bT2^8!GȆ%̺h#KMŊu(-ǁ̾kf cEy:-qj6,5\TN[޼s ?89o77e،5#`E-GA]Y̜.nQ7" R)XS[sըR/"ib[rB h/t0ޘN0N)Թn"q3x9J9TLڃ]E~Jo(u ~{iAwdAuq`ǐtRr b.j> {/1VlEk*i6j. YS; ss+掔Ndk He>Piz݁J:=͋œ&H.֏Qp˺4TOcD ܑΏ#Q >1.ӹjy /; {*y_> 6T&m-On};^u3\hy8h_nVو*VZ_CLvaP%XWnaa=JcKa rHՑi$H3}Ȓbd}85S21Kϭu֤SA`@yRI!AI<|#wBP!ѡHrKz_0%%6s"BBL 'R\5)lhVlJ!zx-9a0R^1"^vivh|uAe(Vjܖ-ud$uWZG EH]tADPs&5i`əus^vq:968mQ1ySE^x"dUyUp]HUrXm@߉p*,Q/VճHN]WĒNGSL[U*u8eMM4JLy]6Zy@uMPI5QT^K 8S*v:ʋ7N'T:卦Ύ^޳]XZzS׀䴚RQqGڝ'ܠ\a Prܖ9󙋌EF}CG zxJmWieZbS[=@)[٧6ތ>!s fG Y^ lep͚A+5K/TJr<]Mp1f Mr1 ⏊P/،:ȱˇC;Zd\C["dč䐊`bQD0P"^ݞ8n#%_ȑMUSJQ4HRP\l=Z=)'~_Y6Bc v̆\+ , DCz 6 4tNMZD>En9ۍuZCQU -KNNDDLiʃ m]ܥW_fX>ߜM8:퓝 M,MX!۔!P-u],"񴋺 JM$I|$PGNMtidIMLQ }M'F=R@]byfץUy)e8lhPD5PPCOL8qV,]Ŏ4R|R4|T>]jحh9Ȩ>HDlwTx\|lMq4HPJ|T'!HȤDCLXRCKeZ=d_4Ƅai^Ē^4 z l K d%$ 9rC[<죂jĵA*J8)B~*i4iJiog6n>OH, c`frYIP\c 瓎HnTLGR^Qi.gQpp9i@/զdF \PPvŭFU ]$ H"~gTTۭMCh.N@9qkmc_Ϟ,9'nu/sL=mLx4W@`Ԓi7pY[cr_bxIإTR~Q`Pڔ(5V{ 0|N56uZx KgKK][ mOUB .ʇTx=5pɊWDҨ W%ȥߖiB@8 A:{SUeA؆:` HHªMįyvNpgBô6s0ǔH O̵ҋz;\֣#TqrQN ^FLLn5@/,/:(ڥ2kݷ@RjxjO=u9!ѽmOG{v*V8'*o{NW+8xjcp :D5x ֊}WogK\**F͂韈G_KMky<~pюEK޲ rD7-ܵD ,`r)=CxG||љJbϝE=@})/g2 `: EX:@O: L&DѤE1^ԘFA6!(bfNdجYŕXR&JYnFhN-| t#ѐ%Kr (҈:ʼne`mVЙU$Y]ϊT{DYjFntڭ`_2vTMCH<1!XVʂda1s81<81SNk%6`۵qm"B*qmƑH+EdsPϤy5Z(y!;FJZT2.EK sSi\5g#hRHyfzzH :T-;k":- uh4PȴP%U+7J(=Nuhvٕb>uw| ?b!g"=N $XqF`Fc#Q~WVa)2Db7gmnw&BT%Oim_s+^늩Ų +)ɺ?2TeΈ:Xa͵`˵dNRYt.(>~q4bXA&1aʲ2.Ȁ2 ";VS+\p]̡C )yqU4+Ł! ElnOt+iG JP^!ugf?S%% e Mj +Љx2"APE.+b(r6 Ir4(e$1Sf2a. NIH1|0Nj"& EqCb0T rS; n`)CIY.Lruf71 r@D?[$YІ!F\#AXlLdהlW biCʳb,Mr2y&"7QetVc8#lwoj;w=P}͢`U&|I&酓N((Fޔ)Ja|V>YrXIW_vG7lI!Cڌ쵧\1M(5,YwΠHdHaB. jUVH96:Ѕ>q !9e7Pd.`#| r^us--qIb(l%]|UkL/u0}g6Q vV9%8e[DeT;@>g%6j9rWDZdCȡ l01GGpED? m.XnQ0^h¹Ahۈ½J,mv1Ԇ"(%۪ 08$HZO|n0Y0MpPX"G/R~Xpl`.!t&1,"dڂ>;>\>`iEf>İ8LA1#Z?0)HxJ0d$i0qym>e'gj%*I?LǀOx`@'d \6;i̴ ɖG&b`N}\FHmV)◺J%)G}$r.4 #Ү6[@LJ" hm"1y*j i.5Ѝy,JBaK@D+0qKR4SqȡUrUE %+"EBn =5ZcZZ)>!\U6!PB!p. $vƥؖ@J)LG&FKkɋp4X* t#䄷p^>g^u/&P fvT1N/!P~FR&&*GCCMetK;&*AN7f}\ 5ӃmA(PBw3Q6Xyry}A5>jB6v)2=87@o 7L"ܘ{$#@ 04~064(YҜIZ).bgCLC>w[ نW\S @yEF~"4R@,3xx  J$(:RH4D8JV7$EX_rm~EO1k9AlN,d` ,qe`C@\9R/yZTHcȢSfWq4g6x%L%pvVpbg.GoV~ܘ.@XbomC/[?᲎4 &t #k];GՂ͉/40?#4 VX[t4#1(A$b6ۆ@8"ʜ 5D 6uyB3l-32g̺,35K$c7#=xjO $}7E}ǢÜg/.֮<| FSz,k9R(2l! HucL2iIKD ԕTMR]xr^Vfj5Zf8 Eƅ]M nn!cc:ʠ+7r]ɑ[c̜3ݜxh-R3gnݚ"kYe-f!{7bzkS %(-ݺ2ȣglo`ѻK J2Ȍ}Mڭ]4.MÆ=p{h=`y\9Ha`VX܅:yMx!VF^#"L iH(ݔ5Zɘ,^)(_ SVȔJIdLCxP˩sZCY(N# LJY[hZFJ3P%wѧPZGjDǫN5]eJn: MrrܰX2'-Ī%Eh|GZ[QzmߩJkoDuۮg`]a,p !q' Bm+cT3)DY ){ZU&?ud^E4ZnB(!ESJ\U(<#cH4fk"&Xd'gCs^CE6>l9ƅgfN-h 2 m`]i٠ʆؽh*^3yfmyDF\cmV-5r ɓbE&gnytJiR4}mNDѽn*dbZ+?0 ,|JO"^duR3cc_?X{u$Y>}wIOM"O} Xv @(\Z"&m<(m3M 0h.I,yD*Oa|zXgBfT6F80_0L7P-JDDq4CB! }ִ3<$/t"t8'zgPQRxJZ"!ӜCd G>6cfBiF^1ni "C̢ &ę4 ;"Tiq rD$lVǧP5ԢC6*pmúT>]I/HKn}gJD4MKk$n14cg˘ uri}H} I->RBVn>[K`z=侌ө~谤bmOQVe]cbvwM!Q8ggcP-xZ ܖKk p , w%װ7hxez?~/og?2\6)iZjcd$}z 7gx8vmN%ތeq @+6]+9PMYJ4В#E_6>r|xBo^cuLϱ:{h:l +czW$rCƉJ{}*FG8FڊB}㈷toϭf "L:a N DڢBŁS`)yzWP웿َĵh+ʾ,+)u"ud|?0';XwvOWH:%ffUP)sd$RAat8Eh"8Cbte)Sr8xW_ ATWEFxr#r% &1u'7(GWcötllhwlRvɦe`Gmgm^YjsG\SUCcZR&mA8~d]!Y7oW(bw=T!v6+h8!HтǡqIES7w#DdvP9f(b5w2؋_AcjpG },B`#@ABQ%}(7&pUVWf!W|_ba|VHDXGiRW6(}PHTc~hYWl)~hHħ/hV6ZxfK4P##ڑ0",7x!HR/U'K)Q<&p/w~!*ٲ}6q YH߷+%UsHK#rt$VdL'a"i`Pe%|f8SUDx1VWJ&הtKCb6 o sco t0eRhc7dЖiu9zQ*b*rfvO)l'Gd<308t=$wI/P :9tIWkg5g(ÍMAsQFSU9J2GqoͤEZ#i0UAcJ蟅fn8C )kYhG϶GY6|(~{y[locqRɱFؚ^"r$efl::[=iګʩz:l(8]o5Ƙ5b~ĩ6qŇ&DYy4!fg+%y#/i8{^5D 1LYK)8IJÊqOMzq*;}N BK'txs"^4..іZi];J.!}>daʧ2uT=~4HI9J@iSih7yۧVP *}1HmHrRܸvg${URkz1l5mC|Z8D)BNs?Mwdk3B(亻~˺gʧroc33'؈OӉ!#ۍ?Zt2jwjc(v l/{(Y y mwJvBpu [jزzsy*[9+W2ө2x3iD` Juytɾ:Gj_𧰵k ګ⫻bʚoq[t}O{[= baKlaydwI5<4?Y{ ŭuw+$ 8ʸX }7dǑ忑VuK )09Ƹؙy+ÍIJɝV,ɺju׸[< Zcz'xJ9̫Ul!0s{y[Vx:N]lvuQ'H˿[ˑKLaf:{ʅܲkء@|+Lۆ#:;LEߗm\C<é,tgƛ,z ]0F ŏ\I7=̷Sy!y{<4/{5ҵ{c{Z@Yyq VGW'&FͻPHۧJuKϤLШ ԰|^ !\4&W:ʮd\p: x!dd^CYy, j-e}6j/lטw|;.-l Z6؀~Jyٰ\ԶWnӖD }kƩĨh/ƸܔU~1?=ʥ;_4]#'0 ئ 'MLj؋u]mhhx@e\ʇ]<_Mբ|'\ P |ײ=œn]!ǯ~}ƞ^sk LZln 垪n-cƆ-[SKu8y# &a=/2ܷ~o!Sմ},moM۪LCMى1$O"b?^x'1lDŽ8RMۤŜB@;ԾK *}.~eDBbJ_,&,Ï;˟9Y=76nk RO|T/Ewq.?,NQ;51km` 3)d$߂*Gf|".أ`Q ;2Hm` t%]W8niF#HF7<:kA2=D(KZ KPGɃBqbH[nHhĘQ5:W)8@D3A$f Lr -'KxKX=47Nm ao_bf&. , HRC&%1J;F/!sR DuP'@$c 5VC|4cF! 䯠)dۦH)V.bv!:JDR@u!`d<)0 )%dZmX&atw4Q-y5"ҙX: P, piRzGiԸ/Q{y•Ӏ,R70<Г_yхLvCBQ:@N"Tv64 xz䡙B{|ˁAe)VQ}@|*R9j2NS_ 䘺ܗHe-UC$pILb* ՘Ւ*p#4X>^~ql\[LZQ˄{r4>:7/b[Bi~9/[Y13H쭶TR 4:0(ӯ6قu:\ #K GJ&i5tBrmpeЭs}*֑r*/; 3U y.ߤd`xͯ_VZ1ɸEkU`E1ecJ.v8CH籶-xn`g#z%2_<0W=Kykji)F KòjF)]PW|o♻-[rw9J e(s(Zo*Nchzu,p\' 66\+a֮Ո}]/a]y ^͵jk?wps>ST\38e+\P GrM C\EBԶ6H`ysoJkB 3=պ^ɱ k. d;G+7&P> ,rOC0|l2krW&-_>࿎4<21cXk>`&FRl K*mX3 J=4;` ;84{;>KB 4+;%=($;ѫ cS€ ?ºF?+r^qkC"R;i㈼c5NjC(ϳk lGJ  2ҡJ BDZ3¬7ö÷W XD77H"B0FS02BuH&d F+J!'H9 Y :,?ÿ9<Ԛ< \5+Dۼ@11@rC4,[@ܸȽCFTPҹz0~u-80|8.*QJ!R09+WYIELD!D cjIdIjB zdɟ(I@2cB #հ4Tc!FTа,^cZW3K{qc<7U<)ú K*D" 24 %.jފFAB*%rEb[:{K7!\\M㈢L-dj0Yh X00;8)* ɛ ȬʙFN#us8NG;Z9} ;G P1$2ONj LOKޒ ](eZ0J|!L'dh/s*,s¬c@:;\,itE>F^d;P =QK @# '8R8ьb ēPnyO^ 1#O~Lj8#1΄+KV4%fRg˦8QcI>2Q5ŤМ*_ D+A{% >\,Taۊ\T]T>&;B@p$ѵpυ@"JѤ*5)5s2Tr HXNNӱPKG{ԬNu)+D4*.<] XQԤ J)! M0r:< *%ʳuHPxeQ\ѡ,Qy%{W}W!QJN͎+!,xC' #+pIR;Gdv$@WP1]Uҍ> .rKszYǬ6YjJXIBl)t╎6sS,U9CE>@E6DTZ]DGeTmM˾H׼N]X-[oJ֎"üȗ@UA[滈C Us 1U [xŃ`buKP]cE[1'ZݥE+. (Z=:F]Wa$mT6Ema4[$VP,7P (04)տ])_"8]R?|RP \,(bѨQ 5ל6)  x^ֽ:ݑѕBURQ-^=MdCW(vaU#Dœ(US+mRL,ʫ`=EdBmYcHY[_SW}z2/I}:3^VXМeE}] ]~f_Zz+cFixEfԋ B9(Gk)Z egmbĭ^\Z'\Ob+HUfhauhd\0(m^Q eC'ؾUD3e~٬ө@aE6^D^dnfgqb(JNUEr<: 9TCǓ%fKEY⁾K0Edqd0^[n]iz"gkVYB^T<ۯiifޅlB#a6a֗@" }]w?8 O$NYNUzfχnmnmmQ>oc. V\+$i9cWS$;1;*^niiN&[ yhiKMT^-8NVgܶC y. V7=kD5XNn>lWa`kE42f>< TT#Oֺf޺maHvnFf;۾(#ǍpEbYm ce]o:?/vh]=o-e)hP&'oFn!2`&s eɮooOFtGN.qO._kAwnc˓V$ p(\js_dkMkW.="?r\k_&_thl%/'S 6 q ZMi~l.Dv~ljv=n@Wub=t`=0V4ܾUcbE8tL^Vsle7@6XPuQ'ѐvtIד:2xP۶'yS.WqRq#gzN#AXJ-<>Uzt-v3vbXvAWqiorNaDR9+_X_ڼ`lVwguigyz7uïx_=z&#˸8<7oE·y n<7~hy{/yzrXݕx?[xA6wy}wP?efGUz%vp?$2'̣NC5zN|W9/`?}??}nww|?Ϸ .z eY b M@XpB:l!C'HP#ċrȒ'hJ;l2e4eؐsNv9PD[MjtiѦH u UZ͊kծ-"6WbˎMP¶hߞkvZn҅׮^cЄ-Yd~Z!Zn,qdʓ[ΌyseV TWTEfxh_"QMmܼeUU˖7|+KA^o>||x˓?޼ӿ<)i֪EVyEWX`g% ^RWaz ]VV>XAn1b'fGev*XuwbjXk7LҐy7V^GzdV)cFK.[Zyc A(u񭗞P:SAKn^F}{>P:(uP!bcE5(TZH_JJar:פbuA2茫JZk*+:劫JݺclVlih2 בwbyWVtiFܔ֙ەXbe>.[.nɧ@쬳vi>!B``؆s*ZaeBBZ[䮙qݚjQ!oSwR>ŒgJl{[$&ֈE)]]!iKb ?Iվ]ySB'3s 2&yg~k덀%hU-ݑRҘ"rŝ+|ppzD#s(ʨې nOf}܀n4YIyИ:VF7eזKyIF?ߛЏ7׌ۼLjP/>'ܱM \8]qO_Z*kdӏte:5dS䤵dD c4m7&@oy-k˜T-TۙhhJX5 l "hDؤt^` d0!(AŊrW)eR*$a4C8%T\ vrp56eT{N(n^ T(ĥXn  ")[;4aMpD1늇mKw4(J2N,+DdCնj0B4VYJHAk_0_ۆb^jdO̊ $^&F2JҞJ԰qsƖލrA PH=4F#iӑt Җi lJZӄtnܣg9̄te"CWzLt<`Q3H^e SAˏ\dy5u!sI 2#غHesLJԛW'kj2v$$_]~'~+߽>;w~|gϼßxe^:E!UIU6]YN: q%a 2^ -a5!  jFB&a`  b 2a Z_]E꥟:injF! b_! aۭ!Ya$J* $N%bb&j&rb'z'b(('!!,@$$T$$T)$T<$TG$TG$TG$TG$TG$TG%SD0MB?KDDKEGT@GTDGTGGTGGTGGTGGTHHSFFN>>D  "%-1;@@A ECGAG>GEGGHGHHHHKHkHmHpHwHH(H>HLHTHTHTxHTlHTlHTlHTlHTlHTlHTlHTlHTlHT]TiUkUkUkUkUkUkUkU~jVeiWTjVKkVIkUIlSJnIMoCYnHdlQklUklUklUklUklTllUlmWlm[lo]jwTiLiBj:n6s2v0w/y1|6?KSTTTTTTTTUUUUUUUW`r~tmkeg^cV`T]X^a]hVkUl[lglklklklklkkkkkllmu~~ʷӶ״״״ششƪ֪תתتتت٪۪تتت٪٪٪׭پ׸ִдMH*THC 6FpLE1N0LJɈHRœGLy&WT%F0sqb҉>cQM>DiЛE#|jF9RJINP@^/ NKl*t_ܬKmsz8C1F `d* "igrbHH|MEbFوK,TI4o1Tn~-qMt \Lmf(DOne{~EV\CEV[uQhh6j%=(,~Px~;g3yl\w`⢴(6T Xt]zujŅj\M A{"Uٟl񧝉wUWy{.Qj*}tIه^CJB+R >a6alm6W᷅%Xk)N3~(iqf^P1cTin\I40lp-#fiߑHđƙc.yŕ_QIYN甗4W]b4S. qf^Jy+a1iU4+^LxҜ<mZ6E'R.[O6&{lVw5єf6ِ+.A mԤ=Z/]4rPPs Ԅ)"S}qQMvZB&Jj'~i#=(+ǺSRGZų3V)/s>ڈ.^7 )Q7&*uxR(YH5eBJk] X7 6(g9YPQQֺdR PX Fт}D! jQ5sD2e U_Jo.:_Xesե5& [ƢCv!E$k?%N|m@Jve4͆ miBK0[a?v@Y(6BZ|D/Rȼ5827rx i5-Q>&ՠYa%e@:r'QGcOT։|۽&iX G{zx#}zlp‫; c eYSu\L_0Ӓxk*g?  S-q~%jIEO}X^r88e(&5l}H27ܚ-J.sTkgm^Fc;ww4gpA Фw fd{UKo0;Pkpقcم_969Hrk^2MdS9uM}Cy9gFA6D9NwRkbAX_~s%g6-€RU+Sd&'+okoM*4n@o@@c1}`w}GF5rCX{kS4"HC(.1wCwwFZm xgwlYPeCl^!0RE*&%Dc'Dq&w\DӆV6GzN!Vy!H>wmi4$3JlVj/?G?Ƃ1؃44)4x>Ht+k!7DHdUdvg1xdA !pXlB1a!N~Pq_8CDhB $A55+O獷A%1#cF&2hsg(۔q7AS<NbDɕ4)>Q]T7':3)p3oH@<6}Rp Ӡ oV:kkn"_Zdz'68#SzTCS0 &u^*d`VIi%pR#`( x*bqC cLbSaa 6VgUp5*\2zJ@,!LDbXlTP46y 5cFA\o'ϗi`%7B2dO(~u^U" 8YjNwQTup̙m!l<9!lxG8(hHP݈rgGx9tO&f?8g(D0&4Vg/z\=%8FrXao|94x|n:,1.H#Q 3Br/L2kVteYYdT+ZT@p{Ps:ZX2ZA0 E,/UdȕmXX.5Ug-i7'FU3W 8beW{D$RnP8|I4CgX߉}da ad ax@Ÿhtw65WA`sx:ڜLJms$H01wc*1(g㨍6)uqixbI-_o- {ts9JD9:3! BWw$>(C230>%5 ec{kRq6?qwa CuC6CLkw &bk00kiw3=+(F:j׬K@#%~7 5Gtr2DDN]di ƒG.EXr!{4\A͕*Thܵ5S5Q|Y?MtiQUkAEnI()Rƞ1"}<:OoMCX>A{9 [GvVRAA,vXvF E"#cKN4IX5k“x֕ƾʡNva]0Vv<Ȏ3UA@V0 \)-uƌM6عfYw-cW=gTA5,S1~Zاt 37Xu*UQ%o]ȪDqd8)nWzW=1z:.uSJBE/6+)avfQC$~NH5[Xmh' V>P߈|*BRJm5uS]nؿ80ziSB͆BInSώ"ۡ2T%}-UfRVNg[1h_T<9?E՞jw_wqbA1Z680vb:-4.A,=SXw g@R0!jq#`B22BD)\`#F5j$3cG$;RHRE!J# ATt)S(OREPΤrtjčY AV]~V؋!M֤0:rҥIXyiU)vD8KM/ۘ&AƔJ櫬dp;uT'˺8pHiiXI!Cϗ`dݻ]r; ,j)@6 ~NAvOxȟ益ZNN}TN9tCj`X* `,颙& rhp$trfTB$xKEZ˂:l钎R,0,,Aʄhy„lX4k3 "F,qF^0E1K Ū&b44M,Ɇ,b4KIJ#g47A%;=wd0KZP+Xa.Z@y,ʊ_('wt -h7"ǛvlJkN2VE"Ô(1Xl\;XJhEi:XmSIhċ*28QֺZ4] ,m-;N*FtYom4Z_ex`M5#5˜ ]R[x 7x,8@yR΀3, hH J`3gr:G ; Hg>3s7 ˢlơjlG[%,̒mE;ER̎#tn -,MiLɌhO]G~AsJElפTWV8po@Mn/,57Zdۑyy`9iwi yv. Rф6o؂pT( "^am"اcdԪ`V-S'Y `yXAʳ;qjhGZ&gCLLΠN#0ɘ vE&JQ$d}GM4}gJȊEט 9QJbMG59Nei>KJ׉t"g* !p# (&D"H"bJ`b ع`8;jQA+HK'G`3̗6եb @Ajpw@@;TS|G397}<֪Bs9 S3I%Р 3 )0i)! a_h9 KY%,7N]L RQDF rT=h,XˠgV 0(׹DlPss 'P$8)44t-R RXdVddZ R RV+*BE7pX2ZN۴џQ+K4seOxBIÁ#H CNtsY:( m"ℇ@2Yb,s5h~mIZIQOd,! \CUHb>/(Z]^A7fjDm ޗɀ>T"g@ksus.t;53GÉAp0 4z/z# 62( C{A=\0I# 8; H)搡 yBx)Uɹhd*L5h1 =؊_p:%j 1)r:9PI6wP3pP&ܱ wXPC7}7J<DZ"7;{ăD,3@4"&{4/76KƸglKsyEQ8g<Y_ I(pG$2']]K":*2Ҫ>T+\܊ z#3tX88c; 񪰴E\ȁ] A{3 ߀+-)S k8ʁH*qVy ܂ j77ZC+ᑐzj8I@,lC'R˺ ^<k]y,-D VI|0I@ 9GK %Vq0A lO t!;* hԴ7Dt06WpPp:&-7j R hLyBnNX/SˆHsa 0WuZ쉌,ؚ<~{J @6ʓl uɖ(FKW5}E@Mʉ ,sϸɈ WlE8 T͘ -WHY<䭉'2 pQ-/WmK]fu s&ST3T̡Ɗ9 gL̴E–D۸WD?MEֆ=F'G~GXN4Sؑ'q˼pU{=\E 7@B(zsK{^ /*K +N+R\A7eY3_oz(aɃW -շӤ:Ѵм;-u;s8^Eez7@)M[ WpAc-^μ I1˿ ?4{L"-ʋQ (v x6Wo5 W.$dyvF_7W,^g ~렍ٸ2ЧH88OB'h>* hLpن/۾9gl \z 8UWqyTaWk5jDlΜnc-G}F?k7p3ckD2a84bv<,`2k*+ -J~ ӐpKt@kEY}`IzT]SKv ,C·'q$qiD| cCTeyжwٯW'XNcn2PhB2d(ЇİO*}8T1+TC2 dv eEPLd!ډe1ۋ0(OZ2W&+:Z8Ɉ +z?e%v(оz,d+fڮ' qTUS)oRA"@"țTTdrC j$yH 81y(d *SRȚP.2cBBK_sUsTtJMxfKZ{n-_yk1>q\RF+E>Ue,[*>}Բ3H D dPˬC >7 z.4U޼Y)*M11>uImf%tY^nNUUljVguHw{63'cO$J&MReZ5fJcRg`_ɔQ2NLe$0DzնJrF.kdN0DBQDd!0pL[Rϱv$!YO7ZH$(G}v[.gC|R%!2`'Qe;`VM|ycCg/k*lhR1mB'ϙx2V̀ˡ-գ*닋\_I',zļ"TjLr/5Vfgsu XՐ"$R>Bt%+ ZHф&,UNEVEFY~RQT28Eh<< #!B(хԒdZI%)ӄ5(e=XM,*$z 3V o*˫$Էcg-GI$'2^cULAє=y Q"t2 ٳ^-33EBds6@jgV+kI3ܨ22e+m!BC{9fok+$6Tǿϩ٘^C`M±yORWF7Qš^ 7_(21`ނ"X"bJJ', یR0gXl'\t' _!zɦtĽ W\Nѣ!#$ɉ]E% AUڙ0͆bBI#8iH" d&`@1XVuL ݴ],7N{aB 25Jy<=vᴬ'$ꈺ^0Psr"t:<(PK`O?6L"Ť) ]ڨ1e3/r*~Nhzk.:e(+j=`iȩBK='\4)z['ݛFP5M3y :9s>ާV0*%ϱ|̆ Z'M1 F+S,ΏQ+#G3?#^55L_RRXFE@cіjڔ{9hK1W40c<''YiH~L~X`D$O gMLBR^a5eJi8M2iPbalF<i[hА _nʁ)1ezx(pBUNR`?c⤇P@BsQY׭Ҩ[~Ma[C-N\E{<LVļjRIEa霮WZylD<%X0#Nچ~۰JDۀjVLݠ 4:#:JK9-:8d8!ˉEa6 /SǬ8RuP8ɧ^'R,橼Ƨ@ͨ'Y$Bi4 k@G~EbȦ`{l4]za+XP2Hݞ.b(EP+a".GքS&t\OP].i^L⁍d3[e*q*\l)ZCƲNwj؀ya@(C~eYC\ՇlX9cv>-LJ`ĬFpn :^+Z(BdĀ.ZU!(ԖM|weJ ,Č+T0mEkH Ƥ qi!ݯn!=nSīnNe"+~q SJCg ZɈe~ܥ QJK콩Ia Ȋ!ē9֥d4]h  )/"JxK*i8&F;/vX&06P\AV@HMq jވJzRקL~$gͻ(^zP^qrT(~ƴ DbO`3kh%]C@dTx01$4:ƣrEbƟz} o0T(NK7SR^aDA6)#Itۥ)<(iYfm6טbN- XƔ*A,ǸFjrMlL"-TfA%o-6toVpI''C"ZPf4| QPƅ %LȬ/_k¥Lm($4b!)QܷNO2>WUbԅHO*Bhk*`ʟ5t7fKKG|OG7HS73M3oQ˱0ڨnd$OTF,&{Cm4V\~j0eMN(FSдtLRLSa0E9_,3ڨ,ӊfYY{Or_ǂMZi D r344?XI` (DPgT4-E\ꔋeo-߱ ljGtt1 l' \BG7X9oyo̶ 7'@gD)󬆉fTE䪅nuR4Uy IAAǟ>јtx|mhx,I Hbw}7jUW#MA0,H2 [Sf:,Ԯu_9re\2j/U[+K+^e3 aa Yt6Q" \wJ?_.:lW|-6bnjpBi-JcMxk̸Ylq7|EFtrG|whT\@J yuWwɵ۴gtb=Ć"z{GI:>6 VtlT}<u<[DM4{grKmO3kuV;TR쌸\ÊmJ1΋-o8fَ~v`Y9z-#|EhETP`| ¶ˀ=lE&ڐ9g>8eCcjW;GS֧2a}x6Hsawm>_8,/Uߕ<]+%1Do:Q2S 2 C~a(W_KAS/8|ND|=^HMH; OXHRe3-@P 3P A2LH&@R(FD /N21a!nHC.Bc>mf͘4c攩Νr*C,F B`*@*jU]}Rai*]Yv:2QR={KMS6-P~r˛SϞ<دS$dPFrA!IļrfMzVZ*zi֬&Ɩq!m 8vo޿8NjNAts>g=rsp6d }Ȉ=pjTvd{T/K4aSqӾn9A(N/ ĩ` i Ɯ0#o?*pհ>Fd-uF |x$2$2j%I H%&MR'}3 $e!LBL0G4r+t3*F2k2ʹKl5BmlTLGd#PB$$t2M9>ͬϮ\!]KDQ>P"YK183H],(#N$62Beh )lv 4;e82#T40‚쫯Tcݪ!3]6[{p/Pjf`k'd,N."#D.2`)]/"45BȈ ]!*ȎX6֖oaL ^"lZQ W}#,㊽r+,S,@VTBoTk.vZVFޔ⤋2Z{VzL.C kjjE 9YtIc6ΏΎq$UJ|s߫~lO (z y"JxUt4uF*_goTh5ٛ܀\fƱ͔Ҕ'͆ RoK;u57-l^@W9Dc {r f) j*[Y["50n=`72X:D)1$*UԔ=u,ms4ODM+#U xA߰v8 t-NZӱcud':| )v|1dG*Y.@!@ðȱg ~R@;-2AP/a2Nw!IC\5Dz spig-BzF 2"Ķb $7\qBFs2M0v5fV& 9*ɜpMxL4"LIV.8L(I&~P^6` bچ1T,zxC +蠇6"$G8‘pь0&'ANMl@H E•8!ڔ0V"ԘK]0$U*g{3- Gd{ݳ#, 86-!\(};F ڠ4(XGQyi91jo"$5Rb-洽b$xxZ"Z#pS[ P QѺc|r{ ?,H@%ٯn6Bǽ`(/,CdBɠ,L* -e AZ a]l,D(2ӕb˞sftG_f^ G(%- QYqHR·s&4%e_.d?^qTLIO'J2S`ˮ,14mfaLⶩKv9@2AwΝ GCDǘ#5i78v+[lgN!V(KRXFU-W:|XF?ml[nEP[_(~RI Pz:׽gWBQ z $t1~ټZqY6mH^V+ HcAx[vGMLkzܓ!̢(8znz0 Kbîp.2$(ZG/GT~p̦d!.ai k9ƒn-lR%% y(i'.AcU6iP1eL0JK㢈J:J¸.LN#H6-;p;79b%b-4]N>1(PX;Cg Dz~(1)">2^7EB{b2)Y K4':KjP0,4M~@5j-> <.%N(j(',r R >MDdzCJ'KY:I"!AxZ1aGP;bUT@$4&$S1/ F s%9T.-'RK j\ Jt7Ee7d~E+e(USrprSp 8f:ZCc0:})*UkQLЏ^t|u&ܦSEjx hH֌H<hF)!@@ID"P_5}!"t_(Rw ِ储C.(sv 33@fE%'4EJtB k %q@ 6tmU`睘#^I'BKgWu[.c]Y@Zevě&k=B Hm6+)׫ΒbtH%#+B"i"jCp (&Kzrq䢠G+&fe.J}_) y{TUrP£Rz5uN )rp6r"v>QYŶw*0 $ƿ"/  Sy_ڲ-ChUwuTCFGa%VCRigs6W1&tuhj|v̜Gzvka@l_*;n}fT 07s28+n5]K$Z-ruuv[1IU@R- L[LO,׏9IX4'~ȅ'1yr_8L^%~IFqVx-p&EyuٶRH$u)bxw8dp@"Y.o9`bq(4Gaa%ce,E4ZBrZV"tStXRDn!uw(/lYZAsV ujYf%RzˑêQE` Ԍ!;8fڦXM_2FX:"||/zygS1oR[jc}6M R7u#^f^1otQvmp4V#s#Ww%G#gه,f..=Ϭ.`}„]D!sq&&Ù?EԫG s"R!5/Cvu?yԞ.e"vWYC-Ư!h)nB 1+@'-LvhPF:FuT# `(')ĩвw5zȡ{vbPG˃c- 7 m┡H[5d)L% M^741g|?)90Dhp OQ*&^xV0sZ`>v~U>Q]0(2  ztd6k!/Zhxh0=v'MOZ!A f`»yyNdSޫgl4~N4pכu+zx/JY'rJ`Q}HDf wZiq"U]XHeZUXaR"(XC\F؇p TIråHGd8рLUC_]2U> H5T*ZDSSKNLP\Oa^EQa}ɦn"W5#^ Xz~ў`͙_pyH>xZCمhjj6iR)H fZ`>(ieʼnBNZluE<[li cKuEe s]s e$]Rt ;_m]Sex@ǥov a~z)eS5ҿ,(c|'0 [xWvm\Wǃ9\M-y R |b3Zy^liE4TQ9 2jhzR'jq*HH8jF_YQY~RZvyy 6]CԦop/#MVY}.}bD뽗&bƶD2;'d{}>t֍l@68x*ܾg6cw"b+|%&-32GN鼎%N=N"jhai0Jڿ@j啞Jm*SF?mFOS8AW/(KX(,\(BIkʞײ%mRn$ܴ o Lt#Ċ,Ԋc.I'Yl} ]Zu=\jƕ (9|Jxkk(^d%SE]h*SP 6c6% w / ꔍHE bA$=~EK/8@m0p !O8a,22@XkT4_C<>_Hd5eO;-?9eq4GGɎ5xlB&jfΩ=):dȫFxܲb#Ѭ+>= n֥a֮7Hx+})pڤXH/ɻ$ 6$ix ދ<8Zk,ƨC eA*Ypr}eedه90vc&S"Sf$iMd1(1YGP' ?N9!A"Mc&TFKYϴ6Ԇ *a IŒU~8:ʏ g7+k;٪jJ%acE%hLV^b HMGv"%[E6'Dk%+XijFeQḡ5ImKNf4|cDԪ?Z@:&$szEBKhGvCgvjcu05nZ1c B> k B([ŠⷛiPv+ CL퐡 2,+o&9Yh~_,Xd݌jD^EyR`= eX3̑=&HvU >#16c v.۹Jc4lVrf7~"3&AO^^ZϫIn1xfE_+vE1h3;KZR;g: [:a~%l ;P·%4k2UVr\gY~&NkVh.j=FĻjw,Gko.*B2ɦQ4;nnQ+G&YF,#" O1y[,\i 6D7ċEhAfmfD|ѴN'Pې-L|:tKV}n/kp-NE"]a).KGp~4Ьn#ͱ&x4.RL&;Y-h"l 0z8 n#eGFڮ&d6beT Xӈ%Idl2 o`YrF(`p?Bgꯎ[[Xk65_ [B'dws$y(,y D[5h([G?K|*<#{u]֤'w{*g B;wT|B$x'ITYjWqWM|,wj:Nb$nSdo*_7z^uexhQ`vc=;=9yGmWv^% ryfd4uC0&ȉyg*HS#( #V"RgfV'i{hAEXWPG*3KX;SaF-d9bX4qX?w|[1Dj\Rabct{fcX˦uWSme~dgmw13xcгo ^T"[@eWB!,)XcMj͆dq(sc0GtmRCH)golY\ NfSUAyYNs0O_ot40oжN!:؝ph:&kO7]V2KJ-[}iVڹYŚAx'~Xq8]*(eVDEAUx4ZGc4"px1@nM:x,Cx%t?*{x_7H)h%Zi'&{hlifL#54^"-fWt]E@ Oz{PzFh2Vj,BYS\*m vըtK1I'6|\ Vax4 es#Z1 L#XpyZ $kW֤kst2-y 9V٬fM*X8jVE;<^*YESBDPWw!sǫ+{=!Yvx[7^ʦ^4l!*bꂆ>|yoi&t3.duQ1 3՟_fv;hew_{ՖHpi&5ș 7(XjNén{!tˬuOaYp![ b@؃{GTP+7liavx>븘hڪJ6Xc%i[˹ÊakIڡ;#!qwHFh{V~K7(j3Aة?v{#hk%#f[;kw, S ۶=l3z˳Գʵ;mygB r<_*YK[f7pw7X1*- eЛ8ix;Em‘Msˆ~u+öI˾%Dl)\3LK\Xxʻ;\mjG( ˒2[NF UZc o|oSLhs;nb ;e{ H(a.KF ,\^O\SMruCwG̸;r 쥭5&lVOW}د,ь^R{_nMak n?:O+",]M%Vx.~~B?= l$8p  6lHB2NR`"C>R Ҥȑ'U)2ˎ-eK9qDSɉMFdP(ģI*EŢPKFu5UYV`-:qKNrÉGdZܸXEjoЧ(6I-2*;nsgПE&=tiԧUfrGׄ+9_\'M j {8<5B˗IJť]<:ʻO] sNj?u!nI"VC-?^$,=)tpB"pjpBC+K<,rK72<+(1" s 2CÆ""lm.&8O֚Ь'r#쬎.Q&]R+ >T95IJL88;k 3δO7S:-\MZφC/ >c6΋J,`U4k˲~u4ANú/H5X_o>YKQ rQƭ\z_gn&mK'A9-7ҲWAAV{HC%*MЭK>27Oč6QûL/c;hɸeuSj?H`xta^c?6e2sO&K *{T/p3>e*^ FC&C+#w MFKm&MyʿRKLIDGQZ$ߺf ]sԡюR! ju+[@..i|˔w eYܕ7oBj5 y4:R Bc=YO]Q>L,gF5,j(C^5?6q*sM-nUDKyH>}JG?\Y4ĠmҖe0Y9A#%%0YHD>e1{V\98hi 5)Ƭ^sjM;UaM禥H!_qO9W4 <"KY"P(l0t(s J/WZtYT-%\d{2AL~VhKߦZ%4qa0KT QBeFWӔ*BRl' 3rZѝL1 tklPʢ]𢮝擐K Qa@e,\}u !9PJ3h-DL/Mc`6lD:[Nmkob nԥ>M/e Kᨐ&c!x<Ҿ4Ĕ%햾Q.:/+[7*JlFຍW>,9bl,ArAC1+ UD4dF4kP\b VmBbJ Zы0N}7اoo5lCef(&:lm]enV}]uy,4ntNX?Y㕵^r7eB:$t,Gtu,kV]Fu=2PbM[E$lq9/&q+gb65WaFߛt ZZt6,e/߸˞l"B4rRu[b,$9O~O[>\;teNqˣ_lWX-ڝ޶&6]ȣ Ӭeh[JF- {~w s*I2dZ7 4IY9'f07כO5hu:~UuS KSTo\錂t\O޽]s89ŬI9^;2ZӾBr0>`n8}SKC{w{7\?h$)kd8jl0+n$l t)0{IɲSbdɃ-jtFͯO i Ơ\Nؓ.!P.iεL/$ej| mgUk%IW =-TԒ$2"t|J8W`C<WN53 1#XOLR"͗Xe;$Nhݹe r]>) mٽɂk]YٜN! u1R([HA9P-00EcIӏv䭽cD-i 1';_P"MۯVoʲi[\NiiFK1aّ*+mϨttS_QQ9WhIP}heK̚d^Xf]Xŀ>(xiB8]?SWda.l ^~[?&lx#2heU9ŦEΘ5֊n.my5hGncjTm憵énվk䕎%!ٴϥ.j]ӝn./sS.oh KfNb.j;a['݄Tu:Ÿ́Էտki[>nv/え ޸1<KV2Xׯ՛Q+gZI-"rp4<`;!2.d`Q#]sj )ȼϳiQEM<&Utt8PqЎ[ޗƒ˿e7vN.IB"aMcm ۾phcIi6YkfklqlFXS$B_ֻh]tV6loewN :`( #a׽ǨmFh5͘QoJ=3_`'iW4g; vRr>& *!TtF'Yoc̋xӔ#H|ynzz:ebotL Y=p+SNS߳U|Tܹ\^Ț_1wTB;FW?R7v_OmaWiY '_y{7ʚyy٢򁬘FV.sWGU )uTu?\dx]dq#qׇ}.M Z+p-X2%]u fv= Gr5\KQz?^#CQ4]]y.3cާpUtts RfovQةy4| І@ T(!Ċ#R$8Ƌ 7 IA$I&C~<9ReI+q$2^̨#O;}PF"%Ps*NԨӢR5ՠZRvlb $#,}FZī7/߽~ިKM|BVʍ%G^0^̅?Rh{9eSrxB8%WUQ"W^mUXf5ZTB:[]ED KGZcAXHD" ؂5Kj]e"]9e&Ee'Po\m sDX j#r2W hWqE]1ej6dMU?Rȣ\b'T)Uɟz+ga~,X|n9QCuSM ZJ%6Ju(D^z Y4XkB*ڭ2+ԅhgF_ g%Q~j&o[ Uۯg)[E\IJ{p13ըȺ ɓRPYbײA ti}U.CZĪt~4뱏=x/6h-TSP$'!B;X6~kUm3[wgx辨` ٫hoV/fN8LNi怓a/b^FZ$JIt:9胎9^zoM iVMJ~uLF=s.o\D澲'Rt9(߃3ڦ,nlcOu|ͭ0{joJW敻 ivOÙHb9% K u6pdE,4X\1 d2ǦcCWR>x,#%b!G*鍏h쑢h(W ! gM1t+^"6()qHG ՑmzTr 1}#'RѣCrSCSnD +Ԋ.vpWtUPq4;QL6X P LRuˤt)]З4F*j7$3stjYl⚧dje(GGrDi ڕ9XrW'`}bagcF2,T4 N8[f̺ +ʋkj^lJ&N& $X% 0=Ѵӧb uN tblƐB@p2< ɔe |&Då(;2&?Q*1@zY,nI[\6е ˍR{RyuADzQ+ǞHYCPA^!)qs:]:n/ 푗'߼y_w^zw;5z^d's>;+{o'=o|=zx^g~zŧ_{g__{?/v>?>.~S o}i_"aq^e^_Q`)_ݞ j`µ``Mݠݠ _  R] ` Ba]2\!^౟e^ -aB J.ۍ_a!.:!=*"j" #Bb$J$Rb%Z%bb&j&rb'z"!!,@     >F@C@@B<E<GAGDHGHGHGHHIHbHiIhKjJoH:yHTHTHTHTHTHTHTHTHTHTHTHTrHTnHTlHTlHTlHTkHUkHUkHUkHUkHUkHUkHUkkUkkUkmUkrUkpUkkUllUllWll\mlbl\lWlUkUlTlTnTTTTTTTTTTTTTRG6y0r2k2_7U9MsCJmKHjRI_TIJTHITGHTGHTGHT>HU3HU;GTDDKBCHACG>CG8BH23ΡIU9Z1VokBGGR:>s,eMG-$TESC5o2H f1(Q@be B/BjBDC%'0p B )YJ1N,uHۃ6!cvp_{ih8vM.m XZuӵ R`Z?JpK2bbu٨/ )bBIT3Je!'Ta³n r=]MpHiTa%bimra |k2\ Uù(U0e-6˹ RtKPcm\@<يVG6Zi$#$攠$g Yx,-SN:#Фց׺XzO鸟'Iϰkm/xa sR _ Ø_"v3z pxFi8>So`O\JZGkk**$EʭkT,'hahJht.VR;`Si o2s{HB_q WPGD&qڔ 'b&ebjVEKo2!M uHze``l:$"ӂǃgq HgyC2*N_3`^6uuF$9'F i7Z]'S-F]o(6H2VWU+aXx9y|j8*VrCR%džWjW`kX_y,|4'ĈYjpIzs:8  'db-т.A(1,FE=xOA6P֙52npbwpu$!}QvfVʸ~?j@((ԈPœ q&r)erX[@:[:r 8rrLhHhUp[frjDd*lū$.'eD ؖhdОiFpQK(q2z#&c%(Re'!}&6)k[;6L1O!:q'$]=KB1<çt6]Hgڑ_AUtGDԫU(1"Gk'yl`F*֫B㇝zX YhW GN8_Q<+r/dQLePe59o۴cVHP+O?դ82Q"„j490A]Wo4[ڶ爘m(sۼ~KQfy퇻ClqB!6! @.[Z.KPST2%òKj*tͱu0;Ë޳1 1#`l %xZ p _#3xQgG]]$DPI/s [7LJ!|mIQ晈rp!%,5xp+n#u%06Y@|X=8  M,7kZ)7X6~bJ$)r(%QT6i/A̒*wa÷FODLlBq'CF^ĞˬMzr<#2D1> gJEI< 6`ӠޥT;v(S,ITYp I5iuu<@@`hq [IU/ƽE!98<=Y~1/ḍw'@FwP:xXŝ;@eLb:a#ˁ(lM r*l5BjFv),aiq*,ssϥ3t)FfUoLp)Je&n'AwgrmD s&B!14ѱYR,kʌ7T 4A"+!K/7*SԔv#}BCmwβZHf4$h@VvK*61Wk&#s#aej$V.❡gFT~0AM16zu$:-M\#$;Wz60/#"=ػA}*<v¨--A-CsZBzYA@#uݟmodL۔Bĝ~؈[s9T6iTÛCy->FWM n/`߰hż9ꙺ#M`nGwi!T\\R<tm7R=*Sb/e:e½U@kz 1=ˑDت%rD.=xp%'B&9񂤢Aikk&ܪrƈUWߦ]]}sarqLM'{s2GKyw_e7|.!{E0 4WB~eE(]I'eZ$!]7^pgd-׻/aWM.i]3t({-u@Nucj}D "RemT&,un"C@#?1dd(PC%)t} a!M}cn6)rhPDM %F!C҂ %I &]iJJ* yeI @(aC EETRM xMH6<'#T4'ЯeB!Y`Ղ LOJ֮Yd0 U0T-eU5P$|Yqƹ (,ԇ+y.b^~D`eǖ]f-_ :^mu(6W~ӺuT SώݴU\j1{婵& v1JN2 w(C:,$ګA*PPnj .|B۫d"LTB 멣f<+M jv. TņRBED uHHĮ5;s/@;!Q̴4F\|!MBJ= 4lPPC9c0L+ʀ28 ͯ;j"6&u3H6LE{ 2.*%c0.o#/arUh]N6eWlI8!SMC 6[¬,TDwI:\'I ‹7ʨHݞk`+UzXsN|@P c4iv1]wQ sYv\U ]{TtWТ~k#~_wUCGh+z($/->&8KT1R :׽Ru2 g3l҅0C\ReGy4dA䶠T넴gֶ$@"veΜ*5d0vhڠ sB!ٽl('I,݆+ We)A;o)(;BJR) GX}*q mg-)$"Z*Qe$+XE yhS >I)1:vpʢ狘/̥U `fdѾPQLtpP8 PA|p<U!@T4Bl-"-CVTr]о&h$=2:RDdlIJK@iy$F r>˩ɗ\i4fҕPȟ8S)jm_LR̷uBJXd)!k@✓7tÄ"&jըIvѵDDFO !@ِ*HXRx4LT`>@;j%>sZĖ.סRRц3#㸷ޠ8BMwAo@ YISRk+gpGgK٥RKmd-&' qrH'z,\mcⒷ,-饤,'mC!l¦ '2zXCJ Hǥ2' wjKxΣU'9j!\uNQ%LCrN&EJ$ZJC/e'qHQ?RSíc\?EO;`!RjT=2?~~];M\*=G|JgÜ6$!r.1gtڎއIOz8]ad9"g2+.ƍYU_ \Aȣ8V1X%X_ 90E7Fyf!'L=(:JXSX6 Rc<$c 9`sMh xJ%p7›+0%Fγ<̫6G{3o*0< F؉L-&h&=5%( @I =W@!GVhDqģh8 RVR…*Y? *is6eЪ2HJ6JȨ H4 7H|$HHV)6x7kP@<А Ķ)DPrc 3 ђc8wu#0pr(0#T- U2@ r)*Q-u 86W2.l[)+S˽6w<|H<8ժ>;yHbD6 D>F{$T +UZD PKEː}8ml: qR5,cI/%J">Q ȉ022{*3sY31 Cb~)wo00)⌚W07iZTUp>ÉQ@Q#91$(NJ,iu4w-Ac Ju;iSڭR}J*4_GEW:\HԼ/ëw/lG088qao+qP_9m &B^IV]rZBZ0pG!gof9E (AU|AT` bOS).ytK˶C~Z1{]I t3ɿ @|􍂰6i8FC |-d\ӌӛhw n㩖$Z/Dڠ*0hhEqp149,BZv⏭-DT Vmۂ)A0!b| .Rc%B8qRlR!Cj81G-|Ԥ%M1lX(PPgKUTIɖ2an  S c [ٴ~ՉZ%ZL(_x T'8Pfe@qEkqˡi!t,3yrpDX`\!DUX , k\JQ;)pU|JnP^zy%JDɮuhmJ'\5̳ ʧOFHHex :Si]Rc!%G>kM4OA S_sQEIFYK,V1[Y5Q\eeL@tZxnib<qWBMOi D R!OʅL9!|gG>DAYxY?GaQHV?B&VdѽٜF'OB'AETTBioRhhx]Jpjy"ašBۡw]5:ytF|)Jַ9IE($otPV\01訾q#sHZLVX ޭ~lIJI'z& hjekU$<7[.EQYIKY'j n!K veYKօOL gig1}2K> ͅ,ŭ_|PCW5r1sg=Ʊ,rR!M#W RG_ϬGK#gIFi«}G{Tr#'fWOBބ*dAѮ2A=P.9 PೢNTB+aTCPtqA `:8HBKCC ) "1@t9ӄ\#Ԩ+[s HK-&Z+ VJ=T$%Оr ƈ'F.G+,.Kͦ"59(ڑJ6WͭNuƊ *PEr!-ws\EoJR*kXPY( rsb@yZ,wU8| e5&M,|c1Lt@U On-pT\i(QIr8—5w'A.|󥶈(os<pD#hjX:@|l,X6*DLg 3w،A33@&ě@aXɚ6U#MidSIF29(IzG#)t^SڐdG|$RV vT'ZIPV(Ü[K:$'1BZݺ:p⭞2{ EJl\0$IVXk$0^Ū֔pRxu%f[IpV= 6:RXf;s=b$U2w|:HfZ[(Z0SN*FB|kT? P~&n@^cRl7ͺ2v+zԆ9$^C5_.0˰0L_b#8ŝBX06-XXqcŻY3)lڒ1rxk[5?u@*:n+oTqIôtR|2l$ZEQ83ee-#t9Cpm8rS#1> 872H_IA刉dYvMj>H$'|%%$\D5&bMFCϲd!/EyUB"%(,7ڙLװm tSdd&3IӐN?%v^2ˍ꓄F9eWJcdv| ߢeY+n!} ;P  6fKHym]-nY\ٚ29w aĞ_VI=]L˸d\}G-RwquvmIQ\ǻQ|[ JYRP8*YAI(D\eupZamaRa[=QIxJG oČ$.QIwaJ ]ErI$ DKם t*{̙@VUvz#INs'D(XRФ_'Hf,1% rrT^kUđqP4Cji\\P6xHY_hLIx_ZH7*B(i:N,GM-,҅®G9EO1QhjSE"*qpAҔ`i>f梔`ڱ+8E_*()#uZD})v`*<(}%zWdhi^Iz 8"Lo IXA4]$djItdM[噴)&P>W7VM#m%^nfJId#u})H Ye^ĝPQLu{iVCG]e "QWƕ6p|(m|m=Nm1B n>rS1D~y7̦٬͢l%GrȕA5$UF*Z\Zr|PĔOve8T@IX&'^Ҍ( FȭVI=iAQup<z.(k0āDʮvN"/.jIVibT>hD Ac18^Pjcr*mYni}}l]k:>_ΒebeeJ,_Ll 0 2ٕ*\/ dʭ\n/Цi2'''(,_IB,/l $&XqE Gbc@(I= ۙ G<'.Srh^} nq$:d&hZ6gܾ-*cRP<ڙHĊ<)#hmommIsjh@w`F50 ^N@ P@ ^GeER%nD}#ư481w*L1PK2L0&YQȠ 'lO}IiL/]R Ke)o^i[]5rVLԣ#0 ح}0DIrsRA$.skb"b *>O`L8NkaTFD3yET'IQvAAW+0B<ɪ-j7jC@Av݆n}̀1&jEhD06lCbk|W mL,) t] ՜e;9PTCK&i5zC6==\AF8v \@> C⬓aI^MsbK>6X"y)O(@MJ dUգK#q))iJaN=OWwоAAw $`U+u ϊ1Kη.eC\q<:XũA-$Xn RѭP;1I ]>ۛaݿgF-뜩%NtP- B #cpɈE?S>e|'"d },I6"xH$7ج/nі˴/.1g_BlQZ sb}qCوzU+-}@$I@R~ȥ%ZPS3`t!-2Lƛ CDĿJbߠx% EeJf ]q ZBS@YC )Jt t LfH?~){]>c?H{Q tg]rOrNt5+" m 8E#m37?J fB*) 3|k?pEV>o䟔|SI4Qx}1?di'(ςѢW -)r3('V+K脰YҞ pʧ=-3Jf9I4-`2C4D.*3 HԐ.,Qѝ4(4S$"Wf _\r#;F]& /+I_֠T˸\6owxDa/nI& rb(^ 2e>BdBθ6v52r8,?sQ6PE#kv,'(0c}"244j99cBa ܢAM5C,"RhDM϶h q ,KHWr4upT4CQ:-cN! 'HH%F_ң8+Evu Dž{J7CAi %A691.?lJ!+SkpX1WC3{2]n+OҬSV?&Oy&qN`]^-lbejnUO54Bj 2rf;UeQ!JOStER?Ka+rgbx.LeN<yJuYOטH'i-JCtb쑶4I`₉A I^fFpvL|jB2fR}dI!VbbJ|sEKXf#X.'2PR?;VO?"P҆j(*29"v#Ed{34GBwwy6Ł^3Y T~cP1Yzrt:"&H%(1Wn6x>'@ȴ""TcQ,캢xGvǮ"a"r?@; 4.;u22BIͱ,f&5B|ZVev. Ow$VZb*(6ĉA@j?EV|b[/ 4ϥ/?w]e_wS*©‚P|y;4Nb'k7hM^rdf1ix>oX;i{|eIfD5Y|#Dش●I3r LoޞZ#!-C$7!qEnCtжZ{H (" cn$HoMwkPr!zA$@$kW焇Τ)npguӇoztu=dhwc'tOxf8"⾂p!58^3xTkDC@ 0cN7U _-|ӗɷ꾶WbR%ꉅ*)}ΑT9"})ńL`bc 7H٣j8n_ޖ}ς˜#`:'@"Br :RX:-zŷP@k+o-6c?bߺيͥ16Wo؆UΦ&! hsŜu[d;A1/ sO!H(mj8bJAb-qi(9*q8U􍷨ewiCp'V綽[* ߍnKxlWyc\WLD]{ [:U="ۼeYiʦ?#@MQ))Wvt~K9WzZ5ΛQ]Gf_YJ )3f ,铈2g}s@3Y iu4!%zjf,0bƸˌ?cp)3Wrzr X:: Y-}ab] "@| a: d +_0ZKε;$X.},Z)#oNN%MJ{3!(P\}Vvȁ:$ bpR%dP(F m#83 ulfB²2c[☥=+] |u[~ d<8IqUv"uZ 7͎ %D b=r~cק^c9]9[a^5l?Fp0 t V|cZ"2)}sG=u-XY_J=\ò2f-J :ʑe|,!y޴}+r(hrI%}ɻ\H/'hC\7G"#> ]>Y5ٮm'$pĀ1cĐ:eo<#b.)YzU(N~]ae1=m/5"\WWom/J2,FRD MKӒ#*d6*\1ݠB4`# \L55g:UQu8 0*#)sA5f͋1B֠`?O !4q2`T6"UG-jBȔmAڪL*eyk-^rGGSܼeJ^a)tnRa2/ ΋"~k&`̇+/Ԇ_uw7jcW'&{,duY.r!~jLY!˟<=NTi,cӊa%1m>v]WRP5%{zCph${z[}Za}W?l`uN5%־&̊O/(zkᵮ+vꉧch*k\M^qrmN>:l;mΫB 4'^J<s|oGZBWSeT.ͺ|4a/0=E9: [Lq+XMFФ%LBn"2Z)fn6:/ o)s:q<{&?Lҏ.!zn:ca=Ύ_ MjsRL i-")IS^RQLHB7s6zb_!eRsI5z^]Ihr'Va7i{trDh=HX0b!v$vsAxj./f%}.Q *`gߵ'sWY2-A2YdZtYuRI;GT=N'*e6yo{, @_ "2x^wtK&3%@5#tJu/hzRhCI9u^1K?=OIx<.M|aQ{WV6vl,Dmr7Xr~e!nDf"vu}?Wu|g[c8Ӆ:GPCp58D%z.\h|F>sCb4XQU6wHqT@VkT2ʱx$&>g2C30؁-=9Iq69#!T9FQg6MaK Vw1uGdRIjyE|7gNRVIw!do_~vHkp)NBmcuca!5 qOBU`]ňa ܲ7H4_Ph,$U1eT?kTgI2IF ٓqzKsT3^agi[Y({跛{E| {QOq1@ʁ(Xg:-y2,*04h&Q)6)Ʉ3zH7|Wi.pD&C{hPhmQ8W!_Sz=t .Hs,zht ʨ\1~ElbymG"MI m]aR͍TʺĤ b; 54CܷvD6SqHuĮ\b ϭLbU,d ޓ<|MY jNݷLtu悎"΄[!צ9-齭v̬ko~<li͋;I0N¾Z:IV ా+QE6bqק ^Wmx ~꒬^nή)YLg 1.@>QJ+>*%'>@p Nz]ԙ켛Atn _xo At¥WV l4(޷c/=OjЗoF}؎_V,Xon]g paߙWqA~È-te?/1Ÿ̏NOXZMۄq{4sv>VЦ&wi{2~θ燮ēr/ <|C@ X"@@(Ԥahp`D5fHD!AT塒8((KGq *-klS JASJt"*%(N\ԨSOF:jUW Z+S\}[Bi͚SkVovGPrБۮs{ xܺC&"EK\RSə7鸧H T[ziԧ^'_xF<=ݛվ95}yJMP6M|pe;ZsIPG%%"pfMZʕq#?k˶ k>L@C5 P@ K/Tpn(2BG41 .j1FXE+ Xp;l+!Z=L:5A 2I)Ϟ#t[7f\⽌E.1POVcۚG P=)r%T fi[Q%~+TT[N`-c1֟zBLJ5w[̤W/CTLk#?\y _sSq%\4qyy|})*OZ٥$UmMt/dEO/X h_|!r,Yp$WBt؇DM,$MkZ/o)!(8BmO # Yv;$2OUX:GG)LK: 8yjʘ3 D#Yy>s"JtI ( tW(0?f\1=VDDlX-"9SJ>";MJ 80:…jG-%4(`᪞ m9B`.KQ)wuP.L+sPHӭ`psDE1z7rdTyUdĻqwSax;S `%8NzSعzQ0ihiRIt*}xsZPcV}&E›w[Lp2d < dKT s%O)՗CgTڴ_2aTŅ},k6M*鹳.f*`MJstyd? b,Q,<zX5alc;:@($d)hRTl+m}#3ElZ2F71C(iI-EnwPV9 Z]-ǦaM P;v&\1U nt=ÒAմk6Mlo!e/H=ʜ8!V|mŽԟe`XB]Ub;NV} }pY􂶐%O:IuRa=in[5m*JOY.T``[L )u?MQhdZuZZ Yoh%m1AVBhGf_۬;V%Ja6gh"EͱMN&j5M?ځC*<ܭH-tҽ snؠujOƅmqXcUg4n27ˮ r7(">j„ s;+$9Ҋ(B b4򠮡"[PҴ38$& bʛ˫Uk+ҋch2ޠ,*(+R ?BB8`8:YG#K;Է۸$\@s\{*|5@b8j= >B4b930JA6äA:!T+(HCB#If܉̍xmxi!%&l?ѯͨ PZ=<ƒ:lqãb.L?27\Dkp8DGӳ}}I;44gּ Heڙ-PKQFRKBWỸѬװD;%{IK" ؂˃-9`X ' ;+Q|l* "MRpkLdSq˫b03|?~{Tf%0gS`T;}Vӄ!& jmd?K㬆[ZʏS.," Oq%y)q1z ϞuN.8e$ Z $5ءq؅iu Q{g+ 8):Eb!P x1u3`\y›A= i 9=P$[eFupaLEccdžR9>NDYM"b S -e]eA*RseerH\9Xf/=˝EOh9FF=g' ֝jj4Tx& Tn,o5k@`A#ZX' @i\}נ"ݤ KZs^hΚyC|dV~e^n&-\jl>Np#Y/Ґ5\Cwd!\H%7c3)x9 ֜<&qE]g֍ 5noYZgm]]0%jB~~hX{1RXԮ.\9b-=vTZ-j˾l~p&&ΞfJަ}50q@ʉ\ T\"j.qv3쌀@iPjӼ҅cqm¨!GÞjn ^4C]5} (90(SDޟѸ,Dq6_~UlɞsWǦ`fp[vp?);@CGB9mrP!AJ[ ONfvl֚jrl~DLnV_Db%rV&gA~rAe_'t:: rF8`h!ӧz-V5a}N~Nhh6h[k=wtsGtx؟wfR@ /%8BVe3 cfcnq[Dj ijohMgOtu\"/k#OkG(^ρrbƀC8v%BnI&QǑ&IWS/l:Q;z<:!Mas@. Xw؃ _0R8=+6= Qi ~ `-\nIxP6Đ! Eh!E8E"N/")tJ0ho͔#M9d&?m@BJIi@E6V]Ig hZǥ]~!Y*FRbUQWY!fYiUSY|'Ni9"ZStWp¤i(6_s$4Qkl)^]ǞꞮ߮뭿xqfDWF;!ZR;&d]mC 64" Dz8]KbE󮸢G*JTolEo@88\uЕJ5rCEYY ya&XҒ٢<-c)q1 sO~3ѭ(JօoiqLb SP!Jp'G@Lh3F oҲ߶+ r:Xin2]T2ͅ[VN9sP5aw93 b(r+B `d"&L?!SXB)rS@60T: *1,}1֒ Lem^x"'|3$#ϗG6R$$Ù\2z*j:ɚP@j췵5CeP?WPSØCJB nxSpp֗~pB2B*. Un]g Csr.77}!sH;bDIco:44Q5B q92qGIfb1&^c>'iJ*Vd*/{G4(Ҧaӟjϧd(V5IshWXBwR&`ʫ*JslUZ!& { Bqh!nl5=gX|+9Bi[ y%!v:a7).ݲAhX">-"8˚(T7HI%<LJN4$:b9]ejU;[vcF dʔRn,g|#KL@$ukbn&3yӡ81Њ30G z_Jj-@ 8eR(}zjN3}m) 鷾mLm]CNƢsqd҉ r\KlXε˱(a/,Lj19j#Қv #(mC1Nu2* bTJuaa/LZHu4v0[>s妼lkZDT^&\ ~rb9 o^V'c܎k7VaZlv%B5Kұ<.`O֮"Z=c!kFֲ=b-4SSb֠ʆig"qErbr9M&x/ #GJ:W]6ON˜]1,ٙ1[cCjx5/?W^/V̓]r> .J;JkZE‘?DBMnD܊Mgx:Xs^75@e\lBl0HȴX.f[*I+S;9Riţu SZP4uoZӝ[k7f_7?w^Ż[U55MWW *!XʍE n&V/QZ\ 12P\UNR"%h 6EtDG(X#(bcZ"NKy]hUfe]ZY "!b1>baT u(ޥ\ V1hidqIY.5}f ╥PgQ R,]pf^ a]4fTIK!#Z2'M gr*r2gs:sBgtJtRguZubgvjvrgwzwgxxgyygzzg{{g||g}}g~~gh h"h*2h:BhJRhZbhjr(xÇ.'&燶Cs舒*"g(((hftΨvsvh(h i((26锪(fj鉲~閊i:)V^uVi)^'>'霆iިFꨝj)jr)v)&j闊(ƨN* F))b*(f(i(Zjv꒮zj*:hzbj6i*jr譮h6Z꧶j*)))^*rN>i^+bhk:jF+fkB'Rkr,ƪ^i2j+Bk*2ztR"*J)n~*lͶkV֨,BN*jʦjmŮlJm>Nbmjrmzׂm؊ؒmng@!!,@G$TG$TG$TG$TG$TG$T>$T&$T$$T$"T$ T$ T$ T$"T$$T$$T$%S',K)0F+2A*6G*CHACGBCHDDKFFPGGTGGTGGTGGTGGTHGTHGTHGUHGUHHTJITiHTkHUkHUkHUkHUkHUlHUlHUlHUlHUmHUvHUHUHUHULUTUZUfUkUkUkUkUkUkUkUjVwjW\jWLkUJkUMkUWkUdnUfoUktUkvUlvVlrYmr[mp]mo[lmWllUklTkkTkkTkkTkkTjjTTTB     ""$#$$$'$2&;'A(E,H0O6U<\CdFgGbGSGIHHHGHGHFHEHFHHKHSUv`k's+u,y0}6CMTTTTTTTTTTTUUUUUY}nnlnkqkmklkkce_XbVhY{akkllmԵسٲڱ׵ֺȶ֭תתتتت٪۪٪تت۪׶״״մʹH*ThCF4jE36qFT)$ɓ%-Vy1$ːU0KfCE1FC6Ov fP5?rO.P:4'NY.#,VͲcd۷~v)U%MmC{  `J=ɐ{٥&L;d/p&4f& hzRKXAEulbI:ͫK)N\5cC3ARvo^ b/Qʞoޛۄ7YlƧlһڟ`/7zUh8`!$pԞޖ8"Kl*.r>{8HAQ1OA/#b2zJ:z:k{TKk2b[IʌGx)ḥiCIgg IqM3|E(mP}}y \eNR{ |&\E ĠH^H 0-$2fJ@1T0-aް{lD\zPHsPx3a[n(jWٜNc*7ƕA FJR$}Ȯo/%kȮ|eI&ȢΩ@&%$$ EH}%]PJ|.߹"6 6.&30Z&DBhG?P m=OM_n DG nL8 pu>|H\gJ)0?OFo39 sADU)$]O}'UO5D\ eMl =h?rށj3H3ɣЊ°} vB}j'61*n"Q /"ewI(H^%UJג;Qwre $ϻ8U$db9"Xc7 cF nxLAik|4+a :s7cqO^m-A5@> T!'9=( N{WD֘%x.KŞ]~26hoY%6sTHb҉t9@a .+hWV{vKRxUl&<n-|MFcD!:I} Z_Irj)@#]@h& 5g&Zo W;exWSqϖ}l0H?Ib &g\%fY{"$q^_b TW|SahA{;S\']'b4|2[фA{Z|W2UIRVkyr~Fô2L2zq2q5YFf!wrFZ+pf,'9ylp xp< HH^us]r?J֋n *,2q]6F0 BޅuyobtJgt#'!U%ӡ1P(4.D5}%H/1&IewHSpLGwQUPxk@~Q_dvsg_}6y5#Na@zՓ$i$z'qWA'W*)kSB~eRR4c9XpahE  +̀B!Vҏ"qhQ.8BA}ъ W VY'~pߧuN9&YǨd[2INFpÛ03J-PVzfrpa9ȝQIre(/'$2iOIP-1EfX A%*fɩGO#!Q(>a cj)D}w^wB=S/mQt)GfJtt׃$1uCP%ERzֺBpQl*EIUIU% Bw:6sy99CdgFZ%xG1]DIcը{$6▦Mdԙ6~bA{N~*QB"Gh&-%cFeY% "L:Ĵj#a+!3si s }~(EGB0fT!X\L>6 Vcӡ#%CWHFv9/P,/=`WIG" y-4`7410xjKd m@iٶ+Н2PոeGYLO,}[2LҢl9PD)""etC$,_7bPghd!K"=+xFGiG QH;xH%Ha$ $h=g"l.#tx&[F Q_~vn)3d&lR P#& <wzeY*5ZM#alòh{XSi4҈}-tq#MX3nL{L$XZC"hqmSJPcͫ6L=Rg4%_/owo$Q⒤s0FQ=v@ƦU5L4Ck ͮhݬ2N-DyL7U*>[DMEDoq5vɽ ' ɬ~(*|{?">EU+Q Lt)01DXD{N)3caElFg"mQcx9iFcғ?vD B>}J'%nYM??v,c#?E”2YCSSUE4zh+MʱΨ?8}e/1@S0RP}%)9lVU)FtT7(dSÔ~LW;*{)N[d%)Bx*e闞y/b1; aU&.e;A#q$(Et^eFpi'x-bS< ɵtF諣4^vCSS# 3BTEea<:u57ҔTP sa!f\AG-}="nX&1E #&2j Ӕ )*h hX@ MpьN:QNxRe''M3D-( 9`jFTM3'ʢQ6)Qհ\ʞ5KZm.UUnu~U*4 F8qd ,Mŕ-:( ͚#mƼF1bD5m_lns-Ԍڳ*sk4Ԥ Oj>71Gv\=;@4zUL.\+tåj*h9D[To,ZQ#'!>h {.ŠfRAJ2Wʁ5&/╡c$ ]7Ze*x“um7 MG!VG& y yF4Mƚر( ]lhI+u(:wfyAQ\HhB"!680ZH;t`G1HHGf>]pWj``%̝ @4d6k ʌYos;4+%R Gr*sD&ȅKӌCOF J&jzGF03yFJI. 7SC4Gh/bN7oC  pL$:2qxE ȵ16<zڳbrJ'͠(.{{tQ 5/Q(h6(':Ѣ*`F95Ws3x 2bGd!9?iqur1OjdDy^ 8X¨cW$):mR3\OGEhZ6qccdI&wP:円>TxrS2'0xڃI}I73][J a"d䭰Ҋ/ĘHkG`љYI6&8lixDC%&Yy3?G.`VM>S||}LD ]EL|TQf 1a Sb!/U(ZME=i%xӓ}DPT/P5 Sa hkGeh(* 0t) dv:C)702w3d\WBԬ:{ǁsQ #6rQ@khr~\Iݖb~O.P`G'[U^]G|tk.e!.;8ɬ%֛Xvs[" ST)#u[RWla~t(<#K&ӎ?0ϰwJŁ@bՎvHciljdi)\,ps\DG7\<u,@˲a[&v)(Nn.D'~g ~ccBeƢ+ ")6UFu=))@˲rV5wͧU4 Vf5G2qxƿ)Q o3 $<# !MC;;{O{\gC>cΐ KTT={_>Ұ)OA~3>iRTv&Zd4k, &quN\"N{L!]fx*:jRy%lC!оYAN0b #4"8ij$vhtH(haɀ3; Hvظy A 70 ʅB";NN 2Di 093. *pCЌ*=:.IQDF -6 '4s%"әð358 :S4C(5(Ƞ(jjX3TL{PTSuQb99=製ۘGk%k+i%J%p"ЋGy6ɉ2։X002 PZc qjk|U2&HZC{=Y i%ɐ,˹ X5$+%:Y@Ǚ@$+ž%Ȓ= s9:J[J aB: R1C hDS&R&t2  ɔ)0D<◦1004¡\Jlnx>d>-Y<}2?`jj恾7hF+*ڈβ0Fb~R5䓝5J0[q9yr,i-v{rBg3 4JB:Fch͋tfԥ*|tFٳOHc-q&{@*qC +JP|f0IĥS^FԘ׈AP;Iȹ)IĒ<\xKG¼pC!ҫQhP nja8/; wb;PІˑ ,1JDP BLj x" \s%HOh XSԒ:1IYݲT4q "mXCqV՞%谦Y=g?((Jp=\;ZGܳ&bBM1w"v.m@PnޭZ^P`'-u֒ MX=O/ڦF'z `5 Hh)JePޭ %a2!~1+hW2:$Pc~JYҒi;8z8 (fS# + v."Byaw0 igFi _cp1 vmoK7&wԝJr3J'jyP Rv?+=$绕>-l l5w5Ow$}urcJ;7Eau [cB 3?4}:wo 0unNB{2<\=Tu21% ]4f>4Ŕ 7hAS224RUNg !ń{8^6%BM|(Ҥ&e+f.RvMi1ժ^b%glykq6d']R^( (,#J~.htw4wV9!EB&j*=E\qV=ujڼI :.hiUIQP}]W|WfM2Ly8tdN1DM1HLPͩ!O7-7lЅ5^ڸ/Fی\grX4瘏8jf;u Z(Pi6JӕŔ`RmZmݗfQ!E9A"m-u5.5s:|>,(,;,ʛۜWۼkȹMAYCzmبy+tW=axU@ RsY58嚺 Gv;en$D/\U <(Sz8X?_'&al >!HӃ`'W6֜ *:) "L5jC .|S_2lleo%p5Ri7 YmIP_p; 3 o.Q"S114iyrE[QVq \򴧽yS]j kyNKXr"O*EXE$HoeB *a>U VFE1OoQXL7#P,Tź5|9Q^"N9kJn>UFzj tj=I.3'D 1cC΂hҬ) O/4rrCaR.Fxr"Kf9c6_KR #|CAMEßilUyb*WOe'#L^yhWڌl%P jE v4IH33̘0"/KKSC!d iF}"03L32 .v1?26Cw$m'\Jfm2h\Y'uCf j/øR|N `cp#@)voP=6Dn\tzB? 4G$Fi9!p9F\&~:($SPkD'_xfJus V2n6u5 `I`Idf%w=ũ={sqSHj悞,#_I751üou)55n_+O`|[ΏoЏ0 7B˓m}F:ۺMe|ɣ5n> DN=|"(2Iq9VTw!㋚Dlk%D\A_E \`JQDf,RdS tЗᅭ =Ҡ-L@R^`x̉ 恏PFz`ۼED>ޠ8>%6*잚*l4 ޚR@dmV$WQDĞN1KD.HI^!F'2FkDb` z$WbHHtB4DC8ƶ_`u)Q:RbINşFlOMA:YT DJ4PTƁЛ+5&9sƫ1Nw@b*| *FT1"ٸ]،Qi% Wa2?zWPGDT fQD lfD'aWQd9F:fNT%0<"7LzҡIr_E|QpDY:Z' WA2' fx֘҆K* NQ~h F3Dh.mŃg-ηAЀD(ĒUbNFKDڰnS+0T'T"Fzr<\(ZoqNǙpX%BR*` b)hQZReq`pE-ԖVX,UbKu\DfڔAShEUPT6,1OE Q:TDh8 nFbz+&5 %j,@ȑ\|% ymjll xgT'nD~hAam]&9mXU{R_؋^B`LJ0Lsܭr̦zT A\F ,o,Tjvk+mdnfĉv6ħ(MAt%]vM g)1b#I )whiI`unI V\Ūjmjb0B ԏHTԲzKq]Є "]ҍDH5Mrp. pCƅk{-%D0FJGJ0Vfpf#B7aǖA*40 ,l=ŕ2W^Rk~SAI pƑϸyvHDĶTvjFRn< fV< r"2Fo4Q|$1<ڼbv+ , 榗orU2+[U9H4CD@R=-ue T|D'*t}-+=sWN^*9 UZs +AxI~[F NlśU Nؘ0tk̡Sj.2+vqBfld&ky֏KF4:ڟ.t\J8Uq0&/4 JNSLa#B2lvf| bHYJKx '7TE(,Q@ b^V':UyOz :wY2ϰ] .on|Bp^K&Ed&OCM Q! #zIn+HDG]^H\xMM곣pvF|6\6HtE䂍ڴ$#+"[{l`綗'!:[p㘀Fy@t+ Y9آqiwMNsPjؐ6P0O iXpkU~SHݷdr~ssrWҁGzWPRmO"j.d5W uh)**W!R4+HD۴m2-:.DF ݢFZwҼͥpGvLΗ1_֜(Qz%hZmUuR…S!pڬCQf;VzkǛhDsu׭c&D?^|yᑎZzY=!rjػ>۫.˱*j)l)*L.6tC g 'IiPjY": "jo/"HϡNbKQɋLbi)ɥɞTf;A1$3r ȆJ87-rR0J6 4@+LЈҊ(F I_T@)=kOΤ.j#ӴjTm 5rkfQ7F?!0NS'@IKP 5@sFZQ(Ͻ\qqU4oOb(N+Pҽ;2ҴXLu@) cڐnB:,$LQ!e4jIޭ"bH lͅ"SYܘ$Pu'( ˋq*£+f."䀧jOά876EkTKó;WW¹=TfJ[UCHLJiF\UH"ƴ YXC=FltO]kONN l}գlC2}b68+)#}N^j|w#nJo(@KRJƔ{y/ ĈObsj_f$70E멪k4 +@\f$DQ['$7Yx欟qJV )vE% N.\Bp9s% ,`iZN԰Hn ;D/O“dE( sR|WI ی?n#UpR҆`<%TQ Rzhn <2 1EBĊ}>ȂNֱpcIjH!2w ŒֶʅglCCh@42s'ukFLa$:G\;irs+`&>A|Ӷ7eXV.4´Fu/$YF#i_J:Ff0sk %6I{J_V9JuWYu "b/PE!sGypoR+8c}< Zp{.¡ ?:bT 4_YO%mL %g:r51V='*⼿/ ޡ\g*^Fn O1&x|V I 3/4KYr LD""B&7) h0gnIn nŐ7t.1× oO":Pȃ*'IBKCKOHhވPXo3TAߪ+2P>p8P e@L ƉW&"*gm"NN봤m46nRDD*""DPa˟r⻜.nf NDВ)d%*א/x1H5npvEm *Y6;XDS09C2ÑT*Ԟ`Pp)^!Lxo ^!l╼kٔ/vD' ާ'b~'F.OFOXf$"'h"2<"$C%5(#!5RD‚.rr*"N)JIl k)YJx\K m94AcK -uXL-7c" 9bq[/=gN|䶮"oG~/Dh$1rzS@DA"K$'&>d8Eh<Eq#cC:w\<Ҙ6pȨg7/IQ'&7)P9*2BVEqOl;r:l.9AlECN&$B!224.Wg+.OA_2@S+d ͑;N1~)RQ{K96<LlE_#سz`HB\9Jo 7hhDD%9䝊 g6#5b5$4C.NJ%47;$$c0'KL*).D%(+@о10sGBy<e0<2d>SP],C53Z8$1"(24Ru8,ƾSS*cȜO(ç5gL:1Ŕ{b538yT2+ 0B$QN64"'G+Jj!^IMc,ZM,-k16X"=GSDPD C:1rJ0OBLْL BSZ >3(PcÆl):((c%ը:@-2|T)2uA3;TuV,0`J ZM>k`5V'*!‚NVK"Zd{V2!$r'\"&h8%%)Bkj0 J6ŌC[{JCDm"eB$Wvs76& I8 UI6 h'ŇfJJ.,P:9S.Y X[ \}Ӏ$/L4&GgK#xm:W{9h^b-\ i |("Jrf\NY8`cυv*t7a5vta轒cf9ܭ0LS4'78IՁ@Ww:PE-8/R3tބ\OaXɴ󅉢Ggy` \ Bi{98B܉r),dBʏd,ES+o;ȴts}Erc4pTH.F`%޶b9ernGnIןtpJ !t!pɂƎ$F.|)~X0 ;NuxB[$O󪘝Sc5择CK5+^E!x_(]9&p-au k78I?Ǒf6:(<gx_/ιkU.0S6 <Ҵ%\"8 jke$:dt5]bDrQkuoMY#6s3#A~Kw7`L#n$Nss'պy%.!@u _Y’ʊ1ׁl-VA2d(4:I:ct]f"xϺr37Nr#zUm@b70M,SuDnT$łXB0QbqFp v)ȦmᙟuX;e\*钹$l2Nܒ^e%خz[X({RB?Ghs,C  /g/QVm|Eo@]% {]+CƦGf2_8=; {m4աCF7NQ|x|/Ɉ&5I;&5H !a>f t=؏ڱ4Q'@|ӳ'.0L:^i(ahrLIyьÁgj;.Sc2􃜫#C79þ-3+,ѯ%bbLsX> YNgjV3;5NãٻAa>B[tgo]5*G\F]}2cwD`ɏfc(<4FBLBR"Qg#oI|[|jsOnJl o89Z=*f9^C}]![ 0p!on%k 'RC>Jvk?%TjeUܓ8˸+%NcUjy{Y0]<b ,)\tR0))B`ƍM4cNj<,WlM_Ln(UqƂ!;.Tid2)R<褎<&oddJ\v5R}(2՛5s2.7q63bÝ)ԙ߈ BxJڐ!*~ɒ+Sl93͚Θ'zڳәj6,)]:X;nbc&vBhJꨦa oQ7SnFjQ pHXe{]ܐ@iJ,$}zmva;_GEߵ3 (#gb~I>VK!%FjZ&b˸Dw #>smX! 0ɴY#]iXb\QT.-,,gt<]I ' \`3Y]1_-omq`,9*hvۜaT.R ݬ󭗫oF.Ծ/67M 7~˧|^{Rm34Pjxzu=z\ lM;ܶ&^eH$"U$$6^?1Y*F @vo0x.VW`4GK*=fJIɗSBUU/ddf!1@6E;*xɷ^iEz &( ҎCoЮ"c_&;`wF1(EG̡RLl[eLƑxFaCUdI|gr\m":{ >ȸ Nf:ߌ9>G<֡8!w;a۫9Ѕ1il'c66D+"[D(Lp]k ٻZv oor$/8qVi3tB-w!wm]<M!L _Kv"=V!K]R0RLz.֮JNek7tsb5^m_C'~tlڛ':>xXl1o﬏yavj3֢n6"Ii=0]#E m!B$3R&KwF%5/S[Zs"qG@FJD3 )ⷥڠj$x P)u8`esC2cE:E@ф[trVʣŨ㇑U}ӈoը퇝ȩX y Rllҙoˊt)WQ;0AHjG8D(2v9>z qڤ+X6ʨ*1ʤq6+zrDb_D#ؠK/ːLL1!ΦyK5S|}yjBS{v\ǽy̽xGz-#Ա}ڷJRl{ SY8 aǁq9߳*,dLx-?m+>OIΰKvMzܭZUrޔm]r_U2*!ҟ;Х-bYQ.ۻ ,~#$lw ڍNTup3DBCD޾Ω)Ι;ϜY@>A}Nn\5 }ʻ1e8IPx*LQBRH,Nl^5+O N*:E&״l Oa؃P@j'M6lhHލ>u ש"e4vr;RaQ`ѨdK\|%OG>ט^b.'_F܇3 !єmN7;2T$]h~>7smb$9S~#:1њ *P^KdqH[f\-+6U ^^[$wxԮ-03Ոa3ڔ1]=?}4 ; ⍾Nl:N;Umoזej KK)=?T`Ϸw~>?X=qeAܞN24jp;a^&t1eJYr5գ@#HqD)nQGCY#EM~8p 0#¤)pJ 1YN.:Mib*Ed:s$F#aJ*Oȱ+ב^^%;eYgզeKX0Q>;׮ѺxNQ a~;NMJdةcF\əׯBP@UdLѰfŌ1Sڵe[#0NIgq, v;snsHٍoޝw_у4o^bz8('롱J֣nփ{NFCU%D.꣣~ym1=.>O!L%,ȱ暑3gpnL@TrI,D2*Ա`T 2bkS-m͈l:፷'>>|¶h% ٓ mRK3tՋӉL͹\8gIQX?M/V2!lUԌbGOXWhC< 1; C_*Y6sZpܸ0WB/@ #̴+Gu7W"m z2 VLٖ X1a1fsD!&uq` XN35vۚ!6qQHEU}٪r1\i矸&%O(1W;iM}e1342^k)CaG.%f r_2,\nuYEњ7g]͠ͻTp ;F3ޭ>/7cDt,Okɚj ؏DN;}vsO]q(x9hn&;Sm!sR۠gI΢B롸ڻY._Sav5Q.~;5vO;x@b-k nq d E2c[7Oe:V Cȸ _+lKmN avC0a ?qT%SPɮD1j}[[1-4L@H77 nu{HL53d& ^1edИ/*N`Ķ]~3A$mX:3}db?+Kv,;Aׯ1 h" e(,!fd Dڰ/szɈT>UlQo7U ;-yF/'c ̢q8:dl^AǩzV;s)4J^2DW˾"b $H7$B#Lc:G\ъ$]׻ S!SN\@\&e`C;I9l$bζ%nq Mu[^FjE+Ry=͆!& %o߄NY ^TB(< U=`ŗg}P q{l2ֿ[~zZI&fd¸bvqߒ P|4o}mN( J7_Kg>@a&ͭV2\5i KԬY; Ĩb ɍyf4~*wޔA0`2n-@Y7HɹC:.38nvsbScC.6 ʮUpm2x 4kHQb #(egĤ<*noH^d6)2Ev12Ns rLU[Z&q=6skush/ojϤў ˀtzkgҖk.Ds禽 o/s3Ժ_#|MS_3&0f{7C8YO|NUg8縀7 㙺Yg9չM-' {|n:6dDu~z<ܕJ9O.  tEQ•+ň:@X XD_XT.M' qJpۯS ɢASF0"j¹0FvC'xnijʣ:\A>3/?T`tZ0ydC3%y z@ND+LL=M@T9/XRX1-U:ECG: W$B1EL!9R$*tJuP)/+d|.t+J:.\9mR6țɦ1X#4T6y+?E( ȋ,>NJb4c Л n90MT=Lg\ϐ)\˙0@!'KTrEʹEΔEC+Eh,˗6,ftMI;q[$%1Fkil'Q?#y[KQGs+K+ ܹxs| PuIQq=L8-4JssQQBBdls3i%Jk1 :8#yʭ,? Kv-v-Y˜LQO,48K1 ==sJlSsDLO Dd;/\ J4 :PWsRB2ͬE_jBI)E P*QӼ5An$,ĢT UJLz3T(&` lۘ9RR;l/ccOGS"mœz Ws39I|HGFu!ܠRan]ܟQ./;6-\U % K8;Gn457MR4Kd e9ku,]iڵjG.VMM%sD Wt-WuτT׆Sn)sOOsl )(09 1jeXXXX &͋ ^L=#  pܐu\f$NBnP#B͡4u_Ȫ@#Cg1\k_^F EO^)Y_Ul 5g]gttnAxwFkX{%}@|+P`P﯊ -Q>0Q4=OQÌVa]«5nnZFc*eXv!6^!ZnS84 "Lg֋qu&mpۣjE{ҙ#c8ꮎi&c;.뻔g(< /Tmr둍єtkSݜqޖU8& YnR8ɮ ]Qa$nX]M_0y>oVm.׆4Waf7 ɩu KmČfAtnv_Ivtvuno'xs^Z2,v͙y+d%%U to9_s#?%vm/؛s/rYȷDpEϧ%3NJ}bn5u>(7[̃dbHd:E9_h?yZgU8qy 锛f(Wo5 x^7nf\ 5^\֚8OxXr#./Tzz:?:.1'ް0>w·] EBtdʧF(%턟tG VeFC^='GmFR(ӔGy|c hC}m:_FY"bw eH##Ni}cvu kvezf/$7oӺ{ywowxwB߶U2"Ѣ8mRlx%0!Ѕ@$0 64Q@b NE?rH&A 1D_ib̂4ohqPf>su:'Ѣ?EMtҦL: uԨS  "vX:&.rkMFt(ۊt"\7@uUM1߶u쫳0ƎXqG8)&x3bƉsr-йe.[B L`{EWkdPF.xQ\:a|ȑ V@^`R)ʔdhM=5O ՌphUţ=Sj٤L`VtexU &yA4]`b6!I;}6HXi)nYoX'wƉ'{Q}h.j'$kEL.H9*n2uM,\q~)u]:j2'v`ugwg4Ex> buG}Basŧ& kl~M؃ NcwY\!m&*KNƔҶ嶘n͉O7>A;&ei3MYS8Toed/, 3:0dʙ7\y8(VX3' s7k]s&^Ϥ'ΛNdzѣ<4yՙ҄KtL@Ub!\s58~]vd }V4Ń5] -aMz+|!R$tƊԎ YΔKe9AYuX+Roydgt9^ȷ۞z6 Xۆ)S[Gr4sO::ղF-u᭖pY= ?{{ bn ։mz݉Cq$pk%֠+/6ӑ+BZ b5mtc4 2n39be@!1vB\bAriX2Up}ZЎым72}1G7J׺1PmۣkW  _"%iAuC"7Go}.XIK e #aKSNR1h"<Md<4Kv6r p]IcT1T2{|2JWZژkNDݓ.Nіhbv_jTp뙸[\nZa(k*GNa#-sn7D߮1t+,om9X$4%ZB!0+[oc9͚pn!\Β)4T)r_uv]/&\>}l^nmD_Jg;mY)s[}XXSW5W;/ mf'CGD^[> ޱA D>a_WPIe zVKT,T]mǵ`X ȝqGTME  u*ɔ K۱a!zl@ݎ YR0!)nQaF.hf8Y5աMYש|Yҝݱ} `{uv_{(X`wH_`|X̲8)pYb]d+XBABMc,^0^1f c2*22c3:3Bc4J4Rc5Z5bc6j6rc7z7c88c99c::c;;c<>c??d@ @dAA"dB*B2dC:CBdDJDRdEZEbdFjFr$8G.#H&GC3HH*I"cJH$L$KdMfM4Τ63NvPdQ$LdRQ eK$R$S2Q6TS$VfRjIM~VeX:%YVW^5VeZ%[^#Y>#Z\e]ޤ[FJ]j%JXfZ_r%aXv%V`&fcOW$dU^ƤWN&T \F%\%][b&_$hff$`eR$OZfOvRYzfP&d:XdjVzabf[6eg&pfhrmda6sZghfo*a%Xp%b`a%j^K*jrnNf>e\^'rrbdd_g^:fqF'kfgxB#}Rgrv(|{Ʀp^ep2fz'sF}Bg*2wz4RS"l&XJ%PnKw~&ndkꥌehgVD֤j(BNt*ffnihJih>|Nbijriz闂i阒inc@!!,@   ##%$$'%6*C.F8E?DGEGGGHGHHHHYH`J`DM0CH$SH$TG$TG$TG$TG$TG$T<$T&$T$$T$$T$$T$$T&&O)+G14?9=B<@C>BFCDJGGTBGT=GT7GT=GTGGTHGTHGTHHTIITiHTkGTkGTkGTkGTkATlCTlETlGTlGTrHU{HUxHUsdWrgZpi[nl^mm[llWllUlkUkkUkkUkkUkkUkkUiiWciWTjWMjVIkUHkUHlTHlTImNKqDPy9Y/c.m-r,v,x0|5@RTTTTTTTTTtTmTlTlTlTlTlTlTkTgT`TTTNTKTQT_TsTTUUUUUUUUUXcq{^iYdR^PZefkkkkkkkkldlaybjklpʹѷ״״״״״״׵ñӵְ׬تتتتتتުتتتڰ׿״ִδH*TFܱ JE1N0LJbɊ'-LRȑ&MŒř1ars1En8$ȎUּ(tGSP@͈!UV'Ϯprج`n gS[m -وME*H"6;!aVxlj K)Ʀ/kƻCMӨQG]}!;@4 ܺvY{5ϗu{P |ۨm#tKFU l}jZ5[0Rcx2onfRUP&jRf.gVՋ!1fчq*֫M-F *-juF+`dwՌj$g]4kMJÂU)rׅp!@ 4 :"QX'>#A#(p фOCDW+|0(lTxS@B@B@B#dž'GB eWVEn_ Mx&.bF/ \G.p !YF7"^0 w'z՚/1%< ɘzd^€"!f-+*4dR0 Xv(F9vMX,u;wzҠatRЛ$4NAHx Xr2(["9JqeFќc*[ eGVuɀ5h`pXxa&s0,2G_ *S }:wmm6p)hyMM(8T+Z"ݲ.VzҴtW)'P-ݮqw{Ĥ}]^n{\e0:p9xECy)B%tJcWvC;\B#.q V!Jlĸ\@q#1˒d[j2rr"E,kL$WfPՂ,p-ݛVͮ4D~(EYbޛ,gԵu=4z zFaCi t}siݩir)o[A??T Y68&GHg(ypuFaw##?B47_J+BeT Mt"en[TQMQ#e8+:0T S4X%vU;R%jFu2Eju"9n pc`fN @P8JXPh$ wn@QUݶk5#Kt%J6xƥrF%68TS#Q ?ՇVw8!JW%[KTUc{B4dtn”L3I qMuYFL68.YFHgXpH؄Xc pPApR88fRkѲ*&sT]?bŶwR[V rt gY"D)2)!:k`D0s.4a IPBSR4+t"u&XQT#(T#\JuG%6_uAhvjgvG( <(Oh OHfPǸ>3ӘNbO_X78a %nHeu\Hp&yUK1x8x8WOF& a#2BuTd5!oc4/&+Ɖ%Ed@M[sLU|d3qd3sؕfn95Υ{~}!eapYxa`UhdbPθϘSv>a& 0'_fBjSteuyV#k1* F P:0K2UtI+ UuUv.!JetY#WlrgTp9hD׃KG-R.;ekfpPZ!f ~6P~eyui4iJ$iv?s't}`d#  *zD>,Qbt-)kM]«ݹ]\ȷoK6TR4QCU5[Vid,(*]>CR"RH dj-zFY3ZKFoI/s<W@NӖQk rPM7B)X'Aɲ-$K-i!^kko/!&wmQnUvI$$`r*}bUeEp͇t'sY;p5g:ʢ,>%LXbM :[ƒZW BW7GM\5!6x㩫Օ81鲈,L<|rԬ$gFtSQLnbX}&9Di;^w"i;~.dں*+u" KxU?|aaW~KRo4%cÿ[$XT9>nP 7E70!V8{eB^|rdyηY19,3Y|".p "j*YP?&?uVO[ojO61*~j#Ealk&ϲ|',bEEb"qzgaRPpd!LM=9YCp,A72S]w*̦ؼF0E “#~ I7>TGu ,BՠR\xS*!]d-q(2:-Q#ȫ2j(iAya?q#2-b[ǁ8'䏌;yv?qO5 YʘL6<4u+M9 1XX9$XxN*,AS DU|StqJkю_",A%)GWW"SqQ2D|le)X:؂x Kq/PIAX aPOp奅NZB4TZO$o<&!(c:ރQ>!?10][iW80x-B.(^h~-q3 YE3,(Qr֠m9!'mkgGqI_ wh2jhv)b c07wY@C7k(?&x*]^cc%mNLN qoAko 20$ rp &qamapmxrɴn"O,V*.Gb/]h]( 'm# i4NZ6$ۤ$FO_R~*)Wk]Li,-;hB4EsQ%;ӯ@P۫sϪCnc] P֌YDžuq_}wuV 9'xQճ:SAH0Pd=Pn4Ule VDD'G ǽAa }>1q)Fujý pBCYUSH= 2x"$HDz!x.{H)BZCAG9>6. g!^Ⴖ,@c:ɐHIPp }p*7qJ@@ aڤ%] J ԶBOkyR! 0\F5c0b 01i. 嚸eL LWtn9A I@V]STWYxU7u"` p;g-DcWԢ;*c'r R83xr˜Ґ8jC1qU(8 Năs * X(TFPL(N2FjW_Ra  du_ۃ豃YNtEp67bp,jt  A:REnK*͎#@0 a8A/SUe*Us&H֎u8 F&@r+ՓdpAz#lJXm[g{7vV-lU{֊'*J14fY[~,7"ʕ_D$+h\DJK0cȸJ$1RYz%Yq@b5B 3OLռIRm൨/R:7dXX `$2v3bQ̺Hϖg2C$_Z`yk:'ljZrRӥ˲3*xIo颐 _rH (̎:vxJ1$n5 ۾.T.W݌d>f4}y(ff%<i\'>ӝ֝tga)MJݰ3 m&-Z afHX; h`u or{Hƌ/7Aszh`3@bƌS7@r AƃARōS'. qźҰV&d@3%+)QAĘ &@LK;'L g(bQVhAꙪa> C2u,m9*;gQ/N3.Ѓ^_tFj%:n^(ijsJH[(ƺ# ,0uq @<;i,;8;X)CABAʠS% /㴊ы,<  bXA[< tJH6H4$Ҕ+H$< Ip2^`p38[p{",R,N|Œn+I \l<$`}2J!JsxB5BmH(=0A[J" Q-ѩ S h&@iAD6|'z (ZY9*1+?H«+<ʃدM̸3Mm0MՈCMҫ<GI~l9ʁh3Zӆ4=ZFӍ7+XZ?G} n\nHћ"ìM 5=F!.)9: 4{&N" zt#̎ΆCЎ̤tP/0N3ToHԆ_0wTZ Er`|J >t %B{8X+6<89Ԉ:qX0A`@pQ҈%D922LΉ[c Su87I*u‹ P4 =Gm#N FFy Y+)O[&u,AXRF /*ĉ0#Q3$4F@ йͬSNΞ8ց Ђ ӳJjN BjTN%B^ б Ĭ=bWmоqZN\!zHN:7L0:A|J۸ y׎Y1J}1X<'m8=a>^rd9 bIuʛ;.3m4ؾm%n&H`}G @\GTg؀]ީ}HM@[bkh7(6QVaF_|.I]̚P]gQċ1 [!LNa: MVM4h*Pՠ9Qt]i+y^d AB# 1QZ8}bZ zF">AbGoΙ9mv -P^K2T"=&׃ @Qn2*tJ-T>#f#aFM;Id :e (50-̎h40-G0)0P fcb0s蠡ϯԢcVNqnm%Ve } ]Qnufg=T)1fy [[qI赠irҒܥݐ^zރi.q_y_# .8i!᯽(X>= _=Xu֘ YťY|A`G6ozRqFX8ގ6ԍHU-Uzp$N'~xM1VARspɈx)fZ\ tZV_ 4\0$,/(F_hm!5?&hd; i`fWr#ꂝ C3xc_]Ùz L\?%0|? QXg*Y\Qe*xK+}CYZdx기Q7u9Ѕ{XI v0Bv ]ٜï o׎x~s9^>~N6Z~qkg- Ih`)(P .8B1eG 'nRe*8;6YX1=CAɸ`#\ FӧͥTj^,qɌ n EɜڴIr3ôƆQZӦ 4C#p vp6 -qI6j'Uj9Ywf^z'9vAX6r٧D9IM$tWB(%TEtBK=Zt(ZabaVO1DMz%NSQ-%Ձy\#fDRE#Hpd"yT:l>/PyD\ "lFYn{{te+5A5+2jZHXYe=UWgURxmIb-$R !GvJbZ+_6Ye wL!zI *~Ϫ6ՕB"l}u.W?1HH0%5_LLʚԐ.? 8FN)89yVþ~jA9a(),Rg :/ FdtksjJ('jrجQQDC^9ϼ/D(BIv"g[b:OYb(S I8Ό ")$c6( Ҍ!TT`C MSQθǃDO ! A:K UZv:/> VGUSb2@j=!h(,ŘTZ!)z^RCB$S:j4@'h!dua{~ĂV#g}T-+F9 /# .HRs6:B vFŅsQ2Ԭ&;nq3V+}2c'b}MaSW- IEVIQ`Rʇ2H-eCͱ^3 6$=RIԹ6t+FKOu _lÿ1x%R).)n(R[S1wH² ~yI&-v\8TAqY Gx82l:n#.=&)n# s$:->ޞj, K9ф)II#bIĬ)D"j&ً98bڜ5'!9:s&abY*;:z7cqo$V. 7d_O1KL$sE|]G/w&Ї%<"t\w] ;5lO= z rQcĀZJ<ɂŬ]`x^yޭN iZ̈́~ڥ|<]@%sp tQN-DmUXEI(Y}|œ>t[2WجI [Jlut  c {$N}HS Yfm٣KUdmD  ōDK`e`[M]68JdkLLeK5+!Q L0xF/) Y¶t.l:lzB#~UL)MEI̮פ͖E l?R TgVUKIG9NDBTA-jfP%}gזܦ^|D e!]^PlfcGzHPM+NF&0( ].!2lBӑv WGec`нSa:lPe!ZkZ*p붫6&(HrS6m`F/.̣&qT! 3iE]GH N@cup"1pVrZ^[B!B")ZFPYH 56p}XAW?4iL*GcA&0&.V^-'|633~-Ji#3%CwW bojT|ޖ>_b1`Yڢ#CL(e8v+3dIqiC /0nHPwCsGld.nNh'1H_>e1ۜFbDjJ'd]Y)W΅MS!myqcWrf)eRE+Kb xY4hHQFeҼ- "Yh?xFe `nlB\.|b*,zPRכp]tvTNKr.Qvz9䗽5B)$ϿabP!.-٪äL<*qm\Lv i]I!@ wsXOĠ3EÜc_7Jیdz߭vV_V_Ӓ#8Qwa9}Dy 'C%gJ$y@ Ե3ZOqJF <\24NIe&HE#yҵ7?XNn>9MDTRVeK@G53]L ei]2D|4߭.t7Yp_q|dy &Y%Fs苟y+r{4/Rb4GC9| I3o0xY0QY1D4y48؍,`4١3\H1鈋Ta#p5a, QuNDvd8((7vc8zOK^g74*IY 7 ~jO+&  ! kp︤Zy̞1N( )dr[vNn1D) J󲺻toscit>By Ew x.xsf1:榥0cѬߠL}yF~Ӭ\R}lcá|0"ңr<^"5Pڳ%\TAYOHKvRQ93̤ IȺ$.~͋TE/xA!dS Iu?"/@2)h&T!É%fQcG= I"QDiq/UL8mڂiNy:yySN?4gSmFi&, VpB T\~+’;-`qu3Z޾wSԙXो2FMJz)HL=,q&[]6=Z5B]O˰c쇶iSč$+^ ifқZmp#~0|"w\܈w%%Uz4Ww'`D?DLc P`pi-H+'*!m kHP<` F3ʓ(qQ̈xPB !%*젭U7а -߲҈n) 'zLTJΟ $98p9#$Jr8TU41(+*:1102# MCNP?-SH SWaOB!5%נ-݂ia-)d霍P#Z<2"tTLQpMDHC%t"{l*l_ڌ߄Z2War' Yr$ebuƍq(ȏ3H(CI~W0"TUXCK\M ƞt)4RSLU,Nµ :B"# K d,[(JKԩ";&28VŹg_PҊQ[R_Ek/}c*e3#Z;ճhb)D6ҽKpid|}0BN+ 3ф4,/}Ao?wDC.cwlGN0.Oc DƟ$`TIKRJ484:?f&'@M*7ip26Ee^) 42$O OwQedH6ixqөN=&)*$nJ鈔?- th< f/p #r$oKhL- )Ht ~W,u%P Fbؓ #{r ɬjgidz2>Q6J!f(㧋~se֗#b!ʖ]r90iNr3X I:aYEѐ3- (=1P4'n)Ԧp2Ōi${ ivP֍G5DyE&j9DȄچL0Pƴ#"TPYNyp٘%E!,EFШZd\΋41qr'QS12BJf,}(>$2>!dTfӮ"hY%mBڌ}lC>7=Ed ^0v;ɇ T 7(8fTVv v{jBA3L=1(kxDAe-mOĨ,їPV.'l@}i+A rM׼&f,b)*0Ufه} x'i7R%a1!c rJn1bD7I(k$<)e8{,Q"kƷ;zK瑋j @~,ZvEX_v̾TT=(D@j<7Rk Th*ɀ묝ܢ ʄح5@ dCp`J!ÒH,B2؎ &'3̝d|fJfV4Zl$.d({[OƉUc7lN@u:e\P-ޱS˻Mmq 5Eй MK (PىC?FͼYFkCME Ș:kn׺n)4v`tҢyڈBU=\ERWRS ~D Av|8hIErh{6=cmm('vIqv=U(x+_'d%?b& +'}#ɂd Xmr7krAc(h obڼĶ?KK(S-UWBϣ :buf*"=Ft7K$9Y> K4Hh:jheٝa6f#Y!/YWʊQԈm7ыwQT  NE"ᕫ 1'OPL1oc"'2I!3{Y$l)ԉ0~-a)u|JSGel_DSֲ\:gE$?7,Ni#kyNr0D&̉,)/ xL̉NFzL;*tJB+7KbD&-2@*`pF䨦g  %=,l68`\X/iҡ6-wBw힚pOb0'cVf&D0{VZ@0<\D srO(fY)4'Fgu%p7̖b d.&,";KMVL(DD.Nj/e3ktK"BAS- XnSYqQ^[3h$s|opfM4Į̀JNpX靬(-C* o- É6I ۲z2ObPP#0lldA"N 7&QBpK2N#J)`N(! D&hFi-::`ќ *('uNĐ(LK20mB0xQF b#7hlFdٮ7cP MZ8f,o3"R-h #{3/E0ci#Iq> #0s0*=pLJI@G"QPbæ.,r2`Ad#12&f"cS#b)6ĵ~,lM,8THЉ^Qb.1S&F:kF$(obMS0rⷐIi3;IJFr,F 2<*3d6? q9F@NE=UJA)+.-2m'j$~bD! xr ِA=p# k4?c~fK$+6+c6d&i; 0/.BA7)0&|l0%$qކ(t6OH̄2a2NN㔮&)& j3SHCtsX|%LYG̓d-?Qr Z"z@@&'U(Cz8:; d'b0! f 9_r]9:L=S@hԳm镔Z gCgnr~tF 5 Se4eWbJ(BPF6Bo5) eDOVšzIю DB4j%63̜8D?Za!62Zbvb/t`WFIC|낡MރoJ(Kqw/lDu Q4%/mqq (LVkj@RvscilG0y~mH# =UvS7&H6u%8zi+Eog2w‚4 Af%r®hhyObf0J!J8-3;sS|]cDs53"kK"<~u~1R+~ТN7Jyv5ozȊ-H%3e/SV%16{K]/'EU gH'rĪsGtK:N:J*x 'TeWj;W~xu-آ*0OQF@h㉨zť{6%UmRF=cXnb9:`TksՈi#jXlJ0h(j5aބ0$q$6N?dWfC6gb I97X7oR7Ŧ`čr4 S\Tt!6k;LLjY`hGdXX}E}ėuemCv@W4žDĬrX7xmUgO$I8o^Ģ܃| SXPQa /6DV G?3?njӅ#=cPMos+fEByY4sT΂l(T{S.剢Vt.o#Щ&&|yd'I9,-m;G&=N\zi3lŬ{컍'7@- zu;j#ձŃܾ}PX}*whp@U[)JB:WDiGa=_u7#lWS{09 X[$9 OhIwg#ȷ8-HfMb"-4溜愢7U+$=<Wza#}oLSƱ7ts,~ SnȂ'}`Ϛf*[ C)m"?~( 2$eIh⃥j[l+lRe&\\NdB!Ԓ:[[*Yq=^V~#}ώk,bP#0 .̐@#X!qFPPAGKȒFLvTʙ'k3HG)UTQFHԧQ{8bvV$~FDU(VZ>)PGDYajyQmT:gtYɣk q9%>*TY٠VY5ycA-FHAG(&ZaV[mV ֺڹ@;`z jbvoy7pBJ'/Acu5#'˭mn1됨AENEʷlSn1vUיhPiJ[z)yU> $>јM+>-|J?jfºKG'#)b'?M VfQJL\f3ʋdBlԜh#IqQ.R3Qg`%f`\X|-U/|[X~m]oceUexQ6Gp&[rYru9J?q/1_c-&ˇ .5yRX| cTVm5 *2iMv2F>R}7!d3ar:k3mGS™Up+v"SH)(4aUX$4Kjg_ \ c̬"y&BDg)`*fxwgذQo}%lbNsrfCwQ􌜒|PP`db\<]Ez<'r5Np FayT BhɠyuG8@KGOq4k)eī%g|0lj>L?!=o+Jy&*ҐcFl"ӄ_PiVy1XMʦ"˔Gn4ڜb) dD_J= +oO*r?T)Z3E(N"c%7z>}lAO=x&& IzV Wki)F I '$u4K2|&)Iuƀ=%(ԓBd@qHR^2O7̑ѭ{՜U&s4*P2fզi!'tW]r/E; JX J'l:聫/7"s k=vUAXI) ct#9u鼪AE(sƸM$K=,}LiSqЦe ؾ&lRpw#n :OGJ 7,y:*k63,+ {UZn %2 1%;o65lO!3'`iRq:.lr;AczNΘ6b;,zfrTHu4x֥x}c^Nq2redf'CM/oM^6F\i\5r}s2;KdxE% TTch,(3͔2\*:q {IlM2Ny zOZYtݝ@T8!ue_LDz 2#IdRzC{ s kIܞvy(a "33&AW*ӈ tZ%$a䖿hl&)v:2:TNX^>$A ͉uvO\H,щq5 BeVgfuo1Ljc㧇xW~@ӕayx/$6 oeӛ\`5lVqSUenHF0yQ*lyXyxo[P`os6_c:s3Bh!zfk Iq v+rdAKujrtJw"st/ Ηr$e :fsuVDebbds) @<?t2zf"gwN8SVKOsMnDwizwG4,KR_)((؁UP+#`kunvtzBEbhG$Ahi^_Dv;O8w+tDGqCl n|V}+4Dž@Oe|NjY |(kڀ0ȖE!tĘRHg:^ЇU_UeA\((elN8;p9CV>>uCnoD`YÇ?@H(bUbvnǒ)X6SF(Ë1V{掽+4}tE0|jsBs9X6[!C/fxucll̒*WfdwdY'w+I{:i0zQ3hw~*5Qif1YAJo,%Wv;Y&2VI(7899{xiDriGCXC16H3s#:Rځ"؍ȕgD6\Nx1PbHa=NeGH%W`pYIe6sN"ɐ_)'IWPק;(g+J!'vӟ㩞 xɞzgaDBcɝ: uE*d#z8*y$1Ug<рO;dXȜknQf81ѓ?]rk Og)Zӹ0-UWr8% VF0C>WE.CgV$ PS JhzP J9bj]eYezi4mZ$rk8h I"d(*]ՃY3M[4N5-Ŕgi'1( wre(_fGF UG㋩qaqu{J~濨/ Fx "\BRwJ{;f{2U&e 6kЋf5fJڭ(IB̼_ ˻"˰jLkLRw,!{aک븒KpZ*wJ:L1&qikPt&:Ņ]{LN ̷/LToߺ cܾ `' % mdyVU #zX4\3$,.uL{&,%wȀ͔{i/&sf2AAHfeWTAnylʿUԞ ^^oŸ+jϧ{Tg,d" Ir{5lmf׌(ΌQXQܴۛ&ӕ+Wl%\ѽ` l \2j-ē뭑șX.anS:Ro9)KCoMKI |{V樓\((W L|nAEӐ%}إv]84 %/! )1x.OSЊНƚ E"ē+8sU][U\Ƽ%gm}=_mχ$b{r%lڬKC2zكixm|M֛a/MÑ+yEfɽg_hf|]v ]h[̱ ೭HՍb;IKV' ["*͚ͥJ+Q=;-ٔM#s\${Y^V䦝ّtKhnB`v?ۄ)wt#C,WfZyy0ΡiKOr܋npξ ]Kݡڍ ZޡpNބ;? #)VQ.9U />*PȤMS ӫ>bz?1 bǍ.g]}n޺ 칎f=n0@1[Z7Û7pʔ*~Vv٥,&)__@aN2-7mE~έm[.ߢ}WuWq{k2>X}heˆYC_)]s$%qnyEǵ |@ F6_aOE Fꘛ)qVν՟I=H^x1%@ؕdcn2o9-ٮͭ9XIm7c^ܫ}΂랶&B"#/,& uih)Ș"ک' c>4x`qo,o!_JXKޟrrfě-Fv@1""ܱP`†!Nd!EwhXcF!@!HǍ(; hI/S(fL ]Z9rӞMP6 E•)ALrG7e:e"$CW7Z %VAdȺuةeP{.ܷۗ_\aoeK-ĵvF;ə/q;>Ӻ?tHB?P;!mK%\ʮ J$LeJT%48N4U; &JFS|M{mc{~}*xCRh 뀐2(fu 6q+t]o7sd[ $&=Jj贷kڿPdT/YR4,Ƚ# {K,R̊xu5*t;>8,G5W$Q˘E 3? /co3$+IRu0@Nf8=M;dKt!vɩaRV8pwYFUPI8lt9ɐ2iB4¾ ZIOyX. L\:+yq7!㤔?hJq5'7qtZ8'.} h: U, >bGM&DzŽNA_pK]]!я.aQQݣ@æqy"QvAU|Hz?ζMy[ FP(KT2 6؁mR1w(crWB1 7rʬn~X1F^d>%ofc/qr8JiPˆ( A㪶"wݴ8)=H?RS~r1UwXUPhqW[ƌCSUBx/K,jJTbtu}ٶؕsjWk% Gv6ay.( 2rq1!grPL(ʍWa8;|L E"u?bV>>solhGfdIӔX]Ti/bO8RPHXY{es_2櫖 DoU|gw%VyJOTc;M pME%C.}h靖ݺW Yp1b@vڌ]YF DC(QB̧‹.+ƃuo럿>е:@ "CxQ@gϛkj fNʨ&f&%[>|ce4%V&7|; yʙr! Z*80;r 98ұ Ik8$s_ 'G{AKH9|zպ;"X'Q:)ܠ$ɲò5;,S +:뵡~%y11( #AC\9Z񉥙6(Q$<$* [#? D ,R%Y.; dI@4r4R++Tw*纪XRyBO ü{"vc4Rv<a46ۉ5 x YO0P(/ɍc=P) (;-LGt<dmk60ȭ \( "IY[rMj0*,T#Δ)v*ĠImTĶ0N;A@_ZNAtAdC03H4J<ӪA7JA%) ̒zAIA.YKr PSG/3:|/׫·l4yҍ, }:VP+F,=DUAd\|3RiL!1 )F IYZMbܴMDZϠ f%)f!KkDHd2%LS9yO#O(1~MI:ld51<3G;SX؜l Me>yLV Pk[$,?R=H*+3WMөAܥUˊ}iA #e*$dM4IHi/@6WRRTBE,a5 Ȳ+I ʆ&60M[ٵE[lS85WT61TUK>qQ;K ̰Փ5ռME]})3Qً]H`$13; a!CaD4-t0ŖD|*g=90Z[JhiE |[ԼN WZMu]}Wؠ +_ƻ_R im; P9' LS6%D 欇J a<Yg]P%݃W[ ˬWW}ݜ5ut}+~D4 p=MLR3J&VZ^3,%13\؄s7ீaX%(\@uIU1T^]i̵5hnl.58ح~ XenFei&$d-)L͵234:@ j.gmkf63of5`.H4,gQsU^זzFWeS~vkcl`_6][6ݰvlKKapODbix`a><][ o~.qWumj M@%$(( oB8i@(O ^GWB򧆼!ne%D)NaK]^(M |1k;F 58:>2H) .f!Sm tt F7Nn$N^gK^]kNPsNOmO_폚Ri *Ƙsm,Yu#Z_B8h#rf^oVr$'E߁ed_G`sH@l+VᙕgCoxL Sw[[FrnG&AwyOJՍWtE?tFqd): o⺄_>ipO&I0% 1yKSޗOrBM&vzI<c/>371alc8Oz2E7Guz9;tzw{QpE}Ux'xD l'[Mx?m{P72Rx!n_#x&~[p!^˷_?EmUggo:+QϢZ}rq<o}gvWSq'qÊ׮W/O~7~G=M6pCvv^CْQp'YnG-LW?νDf#GwyXG*D *j P 2tp ‰µP&(;<G;P@!9rdB((ȀDLF>QgN< S(NDM494iNHM|*5*UVpjRk֩WB5u,TbmZٰn횶ںg;l}Mx€ FL0čc],C/[ΌyΜ?{Ct(z[CV6\TS}*Yޏ};.y8p⿏ /̗;O$N˭N+\gw~s[䧖4{#>\9~^> GH)I26Q@aQ=e^OIU~EVL}8}^x譸V/r甌.[y#W}[=cbB6e@Yh1MBILhFn$ ԥ-(HEF7&wE#9vֹv B__bWhWިfU[h"JFaz]zڷ"5dJL(HZZp@!3Y& !`$Pkv(VFڨm{ףȮhZghۚ݌roIg+>nˑZ j%CXd\DM{SsJo ]K\1sZEĂaޅ,QXib0yu`FdpieHtf3dGo}qt_ў6ǧA}px75>6mظFB`ʚ3e,S$'elw`Im2o`$mLB1ScMNKG;NW҅\majUf^UX*`ȣ N8U$yRp] [ȍY-Ɯ=V.zǿ}X&}7W? $=2<1#&[(6ҊhE&i62ac(4*͆:ԁ7 :U.|ۼ95t;Vo\K^@M1w]<(N4ZP1'^2[te'?+|og`8}mXd :T&oW5Q zk9Ay[|YAdmU~2.h/GE *ܛY$;+u&w~TS(~5_1[ʃnPˬc34UrW̱`,]%{EOyL%Y|B,X l@:=4sh&,ˈ(Iȯ16ȤfK"VeN'G[#ÚϲuհNe\R^vJ" !9@6nn[پ'yTс^3ӕem9rLe]wǤ\?3:+7rkf8]3ŶI1!{oSgQF#uӅh.QJ+`DC< vOj:nAAcn(&pb0VB:Rr$NWɗ#"=qbZ( 5'ɛWd%$ < cESY;t.El;҉u=gfys_ Rk+5W7) V|?aeqG {7mbkQ0d_ӧ0!xY[Hd>h.o[ o{Zw4TWf#O\l`}9,ktHn*v &w ?7w+oBIMeO\ -ZDV ݊ =QY`)e%QT_yS̡:_aќIUߙUapԄ|Dꀝ[Eݒ!ZPe=A5U0eHp ͉[ZI X]WL٦`ꈙd@>-_@r!灛 tq^DIH m%rI=̓ø܇ ˀ Jء b,v8<6"&()5_/IIa3Fia`qW_5j W7a[z⏰5]V?*Zϕ">. =#=1bmp $ϔdުT`5vAcgQK0*ȍ]\ ̌"(K> bmEl5x! cO ײ/5yJ>c)!TAdF%_xԙc Mb:VUt!VUFYYWaqd&a,΢wثBTѸIHA_CF"Ribdbާ ш,`gh eGJ &]H/MO;d9_6DL!_,ezR.T^`\x) qڵRNfg9mDE'll[q[YGcϭ$J΍X8Ł&Ib:&$-RT.$cCNș YM& X&#ifg.I]( 9 ],({JRGhhhi i"i*2i:BiJRiZbijriz闂i阒i院i隲iiiiij jC֨hÍ>j:jh^*Bbj8R)B*v**>*jvr..jJz(~ҪRk+"+":+F)^kR+k*kfV*J6(ZkNkjkR2jjj+ lr2,n깖Jl뼪kvfJk:zln*jƢ+ĂlĶlknl*r˶,F+*Ϧbl+>lf*,Jm^-r+ll:k&m^lvkԮ >kغk˶,޲+V,rmЮi,Ⱥm"-f֪­nj,ꤦɂn~.*.j.j֊j몭䚮l,z*o"o*2o:BoJo!!,@  " $$/%@%GFGGGGDGYHbH_MQS!LOIIITHHTHHTHHTGGTFFQEENDDJDDID:KF'RG$TG$TG$TG$TF$SB&P6&O%%P$$T$"T$$T$'T$+T%'R2/DS@J\CMkHTkHTkHTkHTkHTkHTkHTkHTkHTkHTkHTkHTkHTrHTwHTHTHTHTHTHTHTHTMTUT`TiTkTkTkTkTlTlTnTTTTTTTTTTTTTTTTTTTTTRG90x,u,s.o0k6j>jHkxTfvT]rTSnQNlOLlNKlOKlRRkUdkUkkUkkUllUllUllUkkUkkUkkWkk_jmfkmtimfjaf_c\abcggkkkkkkkkkbl]pagkkkklmpuг׳׳׳״״״ӷмδ״״״ششش۪تتتتتتتتتتتتH*Ta:(hCE3J8FBR4$ɓ&G yҢEa GX SPϐ=8j"F(Yn"aSB:1hVbXmBEeW*hXnŪ떥+S}+-%{SA :` ǎ#+|˘3k̹gGC7d& S.3cDŽ鲵ڸc7l*mjs K`Cb1[Đ .g{ +_| %asnx[p_ '  h  6ك1B"r7My4ǚJ'4$lbl}QH7y%]$/l!duDy[ \aWIV)]Zh_='j(]n)`di&yY-L㦛ʨٙɷAQi||ZY,kz(KF='|l45icFmK[dwݑjYTʝwal]K:7je~q9 6F7.i2M3ThugE`)C,ը@R%Ƌ"K 9;ke%=\)V$⚋Wps[a5vwd[&Uo^7[Ut햜pbBQ&2LSg!4s! 0.aFӭeT|FpqKϦh(SLfnZ;+7^+ݳbvjxzíqR{t~Ul 6H "#xoLBgyjPR3,<z_<`Dd0WRR {쯛T%Ibcc{:Eh*ӔI :.eW ť])d*SOxfǽ;`qn2nKuJ}ΧtϫQa[w*KbTH%Ho͊X@$;QBU kYM֚)-VCBPZy_N7dCWCn X49,x ֗P,)޹@v-meIP <9A@X∓EhZ,1iH4bQK=ayA"IJZ,,#79Hj _,EI=)(41CgTLSg" &w+ \aNP4Ό&4+AMBIm#¾AčhE)ؼZ֨ƒ,s?lf٬(\ Ե=ؔZO|&~1yPa>e<yH""Xd_V\hȸr*R"('-i*Җ%#kW &t*f`wĨR/01<cɦ6u\"Y(7LTc준׌)r(NG+hbaO'^=FJPۉ6w6dXaA0h<jsefzmddCS/,T;YI`2-[8o9l8[>Ip1B+E0ZԀq E%'҆T~ kNEl3{#sˢ#MZcu,:/Dh%_3IVJU睮ДpP«NZ *q`ʨ(~H#C^bsD*<_*?/"5^^@LUTN6JJ]\S=T,MK@lLfzXȇ-Ff6=}8Vpղ^S?ki [a71rO54eI^ߓD$= [x^jT6,nZ5mkB0~o-۳GϡP^||̲ՇZL~sn8Fv' t'R I;!*Z (O HMd9" N}AQY Ȼ`ytie*NiF,]TEu z{+9OiDp9`2Z {VQ,&)=>X!Ys*cg4Y=Z o9{K\ןI7K?ays lrnK  ( Ch s>@HJgzEW^~1(S9/fuVGchVG=K|Rva# Ls1gpQS]=r#?$ TjdIjd^1K#jkSF'G&(J3^/#@ jau=20 lP @ 3}Xn0h#ljbpVp!(w'fg5,h&A|p TPu&qf#>*N4b'DZK5ԷLRqTxZ`C}Mq?(]7z<$rd'~[r/WJ?&09}x   p3fJA0Pa Y%gD|b1/@qoR*Q r#b!Mc'x?Uꄑߗi)-eciXzen@b0E`1! @ gv#v X{q  Qoer(~٘Hv ye&fVn zl3 yp-hzcwirvb%1"QFODEIL*]4VhEIQG#QY)l! UhAv'H"@w@1a؛0OhiY "zJ~h%t :o!BUf6j^UUN9e ڹn: 8tYBCjC(#~Fv-vWËd8B5~Xq궥IqU3)i}f 47 Җ% *DT@+2)dVtvS2LyZܨLg}*q4mOcWZp"YTLjZ%4["K;J`n P3wYB<(%nD"jbkӐ0mTk(ziY_'%R/*9^3/Bb/zK9xv]i&2:O152!X `ڮ! p3˖8(p@Et52+ d[ QY$5ugY%(PVDY·'d$"Pe&-!=vW{!#d;}yh#,!8 Saz::TT%EjH6i՝U\0Q%BB&1H |a: J |%9~%zG%/YYb:XJ~3H#6_2W2l蹫u:_V&(2x6f\h!cGɵQXBkm DDluF7Oz{[KWdd&8]˕<2/ܐ@IeNbAb+t&kBeV,[QQā Jf|!9RͲ(p*[2%I^&' E!09s`Ƙ>0~b6ԅLˈ˚[rT I sܷ [KWo1!ds 1JaÈIr)[M~v@QbwR(oC;8x'}+.GLhԒNݡuvS*(_j xM[>H}DTD d|E!<==]#A"6i:qrvg!>(dZkZ'c1BcEawJQ<Ųy|#u2;>P 0EzgVw .7m1x(J)U"u'JZՄ{6\F.Qʃ@|$G1~)0M qዳH]Y dצ^^v'LݹBN%aR OW= 9ےl9Hq1Se;dV1՜gQ )_V=] F7kCɒ07M<%O>9U5Kl[;MlQhZQ#Pᖑ?k%\V[@D}ָʋ5Ϝ~"5F"MgcZȸA$+qNG7}nYBN6'`6Fh{+ r+ve+c5{b'x|nͿ}K&n9E2HjEF429i!6iJ0eɾv|w3W$Mc8t/;M1a`bAH=Ά߾2V3`;84U`[Qz7eTiuRN?}x̅ǢR&E1p_d.7{A&ʟԅ!hQߤ4{5N#c:s =&Ӻu1(@I ȧ DEYP ȯ1\cN渎Q*_|6Sb5d|)% /MW$AfE1aUI#R؁o_U9S+v}Ҍy\lJYs#((WBd~  kL,`m:1}Qوu %.'h<Ҷo!)M=5KEy( kNm+{m47@H9MHE)-]".{+c_&}D}S<M/@Rʰ*Rb!GSiˋ`bC&&n Ճ/`FkđY1 Ub[LjC$f4,ѯU+80L#G 7! PBH.g083!2 ))ea8,&ڸ$r:bR5<-3 bj6V] A7s z?a+p** 3%J7D#)HVc5S<#S?mQWbucrRr!MףBX@5p#OfaeeD[fFIdB%, =S%;U 4$/dChFPNPA`gH__Fڏy}l&U*i[ϧZeͣI ?y |&*Z1UcQڋybo8+-)-|PGTWN+;^?͗dA >: WK՘Fe fGݏhLd8oVzWs < 0gs 1 DXuh+^..(L+S\A6*%D69 ΄r -%K&Mh@[O A0P R7'']#@LbdnjAb Q5'p "0/EA8 Fm`1/B]5KSj"LYС=Z@,/Ku2EB2"a~ٺuˀZIeӟtT48͚dX&1nw1IP2"Qx d,֧(jK{*BU ,0. " d1n6# H|){SѪ_˝w2 F4 (Ad-R/lQ0Υ/=nFc 8W hbC8f6m"Dg_$X03n:$A΃G%l' Z8CM;, $JUDp_)˺ITE/wfq# cl5 ?h7{c+~2@ @I ȗAPkS Lr8Aj!pS #0 R(R|ޚjف-%TA)$X|-QZ^\\^%[r1] :LC*;.k ! B2<@)F[CcرI*3>t;5"ʼn*1AK CÚ.0>R+ɽIܔ Z/9xJHj d. 9:E?y9YZ#.{a\D3mwpq|#_o ǡ@(E9%{ tBu|20\/cD-"o-u жtD' G H {##r/r8 EV|/+c8rwxk--:}ö*,$V@\<)).2M{K@L M42.yITc8K̫"2H2 H _pM#͓ (Ҩm9[ SK8}Ģ4Bi2-z G P ~GDtjZݭJB 2ғd%U ?Ҧeyjҵxe| .c@J7Em8ҩ AH9'AxR.3 1$K Z"aZ#<;h/Xy8TCJ9P;J n0Dk"UI+!*"+9\ZS=)r ʟ?s̶O&-rqW"S00eUem}n1 pODz&U|L̆GkLrF ]z`Y\Yt$Ŋ ы.K⋡EX*lT/ YК5$ Y$Js-Pb֦ )ZD* a*KGܩ{븧Q˯2DŒ۸jʇ`Et S2Apˇcl(:(-=\01$M<)3Y!*b8K]Џal%[Wɑ12THx3e( '0-.Vv VɒԶ؄I,[sMYOG/Oj]G,Riϱ*8ʋ)u1OOeqyM鏧nѨm p 34FCԢ} `;0j0R9$oa9d[Ԉ/52V؎S;M DbCtSfZUdMApFO`{˵;__RlԫRE<ZB ":8WBn&c.#1X>iU A(a9ZzK7eV C7HO b~JȤD;YV\ެ3PQ7Ƙ4B>(f.OgH K(dY Q_0aB_řD(A,99Bh59}+\֚.OǕ ՟smCaɫ#DVL)1m"["e[#=bSb%vZWlX)XME%щp! :8  d2:όy[mL-y>i揤VګIU6eil8 h*qAJNã~ʨ73o@!OHvVPdl3H l9\FD'Ue2 ̏V a’h/*TB[8$"3eDpxA&z% 5T ^ GtZK".%9zIH,⊵3\h#3e*[IDRƋMQ#ﵭ#O;>!i L=KQ/iW,hPK0=qGPXzwi"Sc?3ʏ*<44êl+_g8@2>D#c[FD q|l( Ռ/zv19BHqƚyijS/?yĖ'1 p.c0lP )H:@@DO˫ F2`q5J^%*8U|o>|]4|M_ߔTlG֛FoMï^^])ǭ_ ͉.kYE_[X ܲ!A2΢}&Q&٤ y+Jz'Audۺk bBJ1YX1;JA' +T|Ǭ5jY;emy[QW2%U(K.벤9sA_\^eafruecOZ%Qxo@Vy=փ^e(ۂ)V7XWbCC+HY]#)ƖFrQSL1KPV9WSglݶaݦ%,zLDL+~K 7D`%_i%J5/ـ]rHŊ^TЅX|-v@RU tY@5פ4fAaBׅꖆUYRB9c]Q60i[zg>[1Zod]8`a>zybK6tVIVvGdkH/vu!d&m%.nɮ7|JZuZP{;j H! DiV͕&E=v-uXH1MwT1"%[[-AwjA`pL%9+;*(1GJYSPy$ա-!=R%F$,] wf!5Tj%TT'*ܠʓTEfLVT̚LC T;dMо&ZV|RKAr/bp>+E.!ƃIyt#gMn(`&)2+AĊoDLg!Z#QCdS,[mf.KY.39J!&~tJQږX޵yd*WZ6c;=$sUb }ZkKU*#db`V!Wj1F1t"-F'*{ 6;5yB=@u{b4c"K"TU#3'yJ$b;iۺz㵐o?P^붮tM x/li0%{yOڳ|ˌˇ, 7p'`ߙ>)n`i\Ts~JT$GG<Ym+`?cE+$PDRdٽ]E8<E> Dх W m4SI `FSO E@@10QRU~E ash]QPM-EVE498hhaJr\ Y 0Lixʽԏ%bO&OÄ$ %.E_h }فHZ&tKi_E99\|AT-ERHU՞0VFj9g1GNWE DfcuyF6Gl ZT`'ئLYc5 Qڌ!)vDQ4HbS$I1EH< P`!IMP!EXb`8(nȄMI>ѨLdJI\DYǹxNJ5F4Bi%PM0:wQś^Ƭ$` O M>b,_lO%&Q$E-ҟAJKCBQԍ/JPHLŦ۾\H3kWZMONm #c D Od8% V9f>,C1&EMn `Lc9:a ,ĀQI`~h^QDנːDYȅ6;(yhIȝDE_qXO Q >V8؃/<ϴ]<6=;n[ |"GY0GHld N\ePžcfb?&P1 iLG  υT0 c5`PNMͼ0Hl\SȘǠe8T"O0-$J%Nv_,hcZ%-*LX%+BGcH9]g.]XҤШKEi<(GDԉ{a:zvTؽK) wTx .Z_Txx@,d,ׯ4awpFV̫#& vl$_~UNrh}$=˭d;hĚUG`HVl桓a9%#"A1fUa*>(kDDŽ-Y'ޏ~O`+p4\,GCNZ hRΟyb[6&\HdPb ,ٖflAfv,g^8 ¤*wťč݆e !BOYxyD߉e]Fd?M Y, 1]|0,@pɪz`d`fMzTJ|ڦcɩDʠ$k :#cifRX*V"B"2nfPB.,1 J ?}_Z^le˼q wg%Şխ]@"tFDhn.*x`%FQ@0A.PՎɱB(qÁU+V/rXF6`|q:/{:U$e~)ReRoLO|ޒ 4g՞q'HCa_ (.mh/ڪjztF,:=! O0P6ŬiY U갴$RLw&V.Rh<ǓxɈq Gi_G"ƞ0vDɑym">ڮR,1o5<ɰ^9̯̅~5nih>v'n=]Q6x@ʰ[vnZLD.IxdHg>p~VM8 ! ں''}LJ@K1QaYtLlQVࠩi耠)Dg1v fC%lZ oYDvl0kJhFܥHbeƾ~wGi,r)G׮hC>> -TGPD14OhP,x!o,m*}9Riu $[^ gb90>r>DAoR+OAK0K‰7Wuxna52*T6{m Hi]dNwdw'O\J"30G Tޡgi$jvS~˾`6OIȇgZ垈+h5c,s,t[tJJ7gVx ~C[y,YyOOu~,uֈ"UU느TCYL' Dx*_[fޘWiFrqėaOcS_xڦ ZQ!OE.6'[ h{cvY<UE1!J_/$j)Qt%ʷWlw]|! Xi Jim.Lt6sI{+60a'tհ.xL7&P+݈rSN* i#UkV:n,UiKJ8 ZV@m`_#rg^M\W8YU-_x.s#m|$1bo#ֲUPI-+ECr0yR` 95x]tC65=+Fj6@.iS^3#P7~\]G֌A+Rr?wst#sYq{\VOey:+M`=pᆽ~spmm-NYǤ|E_ki*^t֡5YQKkZPN:yak:3hJC4hW%z^0rϊ猡ᤎUJ`-jR-8aoğ9q 깳{K@F1.!{\dy.UpxQo"3'qC8G̽}1]Pi*z +آU~7؈l(5U>Ҽkb,DڟL* y7_%-3o yww'NLϥOռT'ma0#щ-@J`r;6P-YmjCE- ڠFA~Y1dI&9 Byʒ*[t鱇|y3_|eThѡ=ϟB9/Y[6|Ys *{pA,g}Êlך5.ڳ`h o.Ipr;넪x'ԦK22䥇}ma!V%Lg- s *XPil-v q[}141L2Ν7Q8ƚ-B zץcn=F_><ͧG>T >X֬)t=(D$ZK;@VZ/Tk>Zm5J60K(@tO+;f 09` Ki ҏ">-,5Yr0"YICi)Cr4Ѱ>\.ːl,&Rq͝~*lbNlhrK""aۈ;Lp)1Ð D48;-)SP9(WUMb‚T ׾|m0BNkh\劳RdS_ݳ&6e [n-Tڏ=v4Q]GTlj{F3m[1PAY1K\HApz kCA]Wcv50"VMho1GrL9qRYٗ),Ba 碸`yXbzHhh77ʯ8ܜH ~#H<)pQ9N_&AcϦ}-{& e.3^V@QAGUq$ *Vy`nG]Jb ;Y x&fMM\ A8)N0d r'J^[7].+Rbp*c"AFO= |ar菇? M1x4<4v[* ht4b|n" XsKP'h-# #@G+# l`(P e\lt<*C"0b!G\H$7\YDP$b{B|1` b">L) hf0N[Xq4䢋m_XL*3BP -8ifӎd$ NJAaD5k*X }c9(%C +J3W>{I,淾1Fp7tLqZ)3 _Pǰ -8VnYX!dtQ֭z󚫪_Ȱ')R )83rDX\ kBPs#Q3H K ,[O r1PP/XSRs]0MAF68ŠhNZN8LuQGe#xVN@*GA L*ʴ0(Nh23Tix(d#xaA>\j*f6mҤfs,v93I *uTV$)-[ruHX0M&6<FDPUuQ>+M7[Q0@!ʞ|T3&U3#%YGU 6"eƅl]qtRep@8g}؍g`$~)  EtM 5BnAx@d`N]ъǘ[\&dLJZ78^ N`T4q9pCBhY"-.ZiH<-`F?= BA60cWJ^$Ŋn˕4 #ispu9ɷ2X ydH5~M#UMU@~ɡv-r^'^J\M]i3vieDE6RWk!ݰRnnb_dJ#L`eL2|c'8B(T _|m'soki7ܲ$yd-y:ߪfo8`]ZkB3{2F$zHw}i!˱N930oHٸp8+%?9.A:ތu:?_GÖ=}0Id-2O4@u6TdPԬMDn.24,l-8U(>ŧ4b ' ,eS&kjiJv*2mL~d}"6#K(c#AO"B@“J `1J\-kp2ņ֮m/C(l'm(v؎Q 2T4E& $oLX0P c hdAxO#P¥`BmǨ 0%,e)8̹=~AplI0DEF!Q#/:LFh % IM& ?++~kFCC6gOEAU>BCZjM bm*-c0/زj$)&*skfP,-oq0M'Mxw~ۚ.r'M&QL&(FwVRh oIUnj+ O3Jd:!}'!5r]<8eK$x'@*#576"c:/~D^V)Vg ːRF| :vH$&2E4f/2]((Ac:L /\K4)[<PdG#"*lqkr1Ag'2LF-pRt@S Nj1z?!RM /1s:pKz"oFZW EuD-EϔjF k~*=1Fa5fZD`a6a- *[lJ3db2r'A ʵbJRK$MV&3hsK `Uh`.7%+JӼkV^?Q 2z4jT86 :N,'v-wRpbL_jhR\ :rN ÇtrUXs5E?iKW$ 2"ԣo4cw} Ѫg93w#B.,zˀpJc-L'Ʈb.f6+̺ʣ ՅJ*dub TH<:=00Ço&F6(gce)-f4o)Z6ty-"wqhZ)J E9 n{X#pTCғ 8̠IBr tfQ*+pW|c6"9^bW4c,#H̩;%fX)_ OSBp?BxJ}X( "/NAhb<"<)FwP+wn6IS"Onggz٩ۜ7SEX/ڡLW\ !:/ۗ1?L F7+֒:I]6*,J3'o-!9^8dodhZ& -﷯|ier1:9M3{UO/nwW6jrH5_ͪ4٤xo&aТ434a͚z:e@m9X.*S"j1C v O<Ȋ\Z1a!cB R ;q`u66=%,m'>p\p T厕 ~"6MIg^t#hQ|'۪d,uh;]P@ܻ}.u K54TǮGd)'ή'jڿO\qל)O]Sk*lFxռ053}}m"̺˗8"||>!q~t=qBG%ݥe"#X=pVYD܅ix OK2 ,$1m^=K .z݈AfS@Dl>2ߊ }2ӹo'^k!Š}9uBNeo M`a/: rژEYnqD݁Fm©P[rwϑGQZO%+Y]#e *\il^xC J8p"]C~F퓻ױݗù'*rB p0!… 2|0"ĉHb3VPЖİ+_c{.˘)kuqa7 1ȓ)a-^>˖S]Ju/AYEKZWX <Kl[F Wj\/^^*֔%ʆ ><5ѢExaV[@~1!%\j 3`ԧ_TgPUo([6n׍8qޅ ,,4)]Zz=r}Dz,>qWmP [da=[Z(.r ނRuG`|ɲhi!Q^/ nVP%qF"ĕEYcg1(cEC9vFTP؏4UL/V,ٔtE#W_KŅTZ^yXԒh rfuvriniUSu]e=coVP`' :dc(ye5IPx.DqO,t5GVk*jc)gn#:,rENZ;FZȹQ(9lو'ҝVKnwğ/FUbw!Fh{[%u[G†s;-Tz ? O,q7{+5S]Xg(B<*P#DMm%K)|Vfo<EUL,2Z&m Z"I&xV7$H7!h9Yb c=pj*Agr7±f $KU# Av6ދg)qQp\}y+G6לx{{ wp $G}p 1<*26|_ c"_DTLB=ɶ|WsQ+61C 5.~Tj8Bz#FC2BH%ÞbDu vik^K3TÔ%K)n\qۥv jW"i?m$|#Q%)Y"RpD<9hSm)Qmpv0'΄ssd\T)AJFwԉHБ '!'h:,Sdcو{](d/P.xmY nozs9 HFnƛ.1k8GW-rMk0㇜dK(*D4( !ODWkcgB fjTs)CzS蚈QDƊ "u"RtVҮKɒĒZiKmXo2UEʃ˻ Pz!d%tno-:rIx,DOgs&J&%8r"=I~eL`Gx˱ÂKwj܂ F6,6"P-I5qmȝ{1F 7mY^¾/NR$=Y$_2,ORƧy}z\w ɜ0n2=-i(a z:&cTw^ ekH#(`=}BYO*+}v>W;34@Lk7RϼDu"C +-nqW5fw%sz/?#TPZ{6@'u2Q%{Iw H3:#x,:)q;%o/肌!Q̓pH"z]r$M]rDKvro@Fshjŷ(C`VNƅN7!S}tՇ.8vkH!FCx(lfv2NG_vRr0o[)5efpdw]T`T`BϕxV?9evfy>oTF/yy3UHS!s9(eXu{5AhLkRiK{rphn\HJf;>DktPGZCa:_s|}@&ClȎ~a:4DGQ YtvVķMESY-w׈9[xh @U$)&VVf3JibwxHAjuN5jeZw«0Z8sm Fj;Vj#"vOCa5'_0#fMǭ 3HDr׸ot6G\ƧܤwJ{FFU8zH9ML浾-!eNI;^xzhJs;Ahh-Wzͩ0jBO󙣤3A)BkJڷ*`t[V;d`y:WWHkAP{Ȱ{F9JhCLYUZ_YƱ[4ʳs躮+Bzvd')[(k6`HIJۻ:2CԱm8;pj=Z~鴏حHbPۧ=T*; MZum[5%PeU{sPWz跩;i9|*Q5<ɸ9d5 ě KĻ¨<+l{ҫ䔣; HV Y<C 6D)\u[ Sawx S xK[>ǫz+'J&ˣ(^XX:jjL{Kr W;te7>kdž Lr H;vIܴp3숪ij,rrJf wo0;{@ż`ZV"EGq|;LVM^ɼvi=Bκ=Y7*gЫϽ(kV}I=N*- ],K%yX҄NM{yڴ^Md!rWβ$m6}Iv>dR8k.6{I(:W5k91%סKD}\I?N0\MG^sC} Ox.7(ܸ?V^cۊ$@NY[;[ s)ړ>df-惚~ND:#2+GqxG fm茾տq-Unf;hWO< -!X]嵎ٷL(ÍmQt'ധ6-_+Njs8J&^łH"p"†Q"HANX0!ʼn4jLGA~GC* UdeK/eƤ9fM7e&tO_AYr8Qy^販ҍP|ժTX=Rݙt$W$ŶJ,ԐVp垝[7nԃynԨWPw_xocȏ%+DW!l-G5oTPBXP_W|qKM6uX1߅{/gܹUџK :<jM'_޼7=%.-"XU24+ͫ)'I4(_е - _"Â%Ada*+?b⨿CFl(A-bq*r §&*nJOVnOMnkh̸ɨ,3; .1(;IΏ*;IOԨ YC|I5Fc, ꘟEN:ʲŧ,Д; [NctVk|0Jʪ̴Sy#1Y]MP_B_.c"6"% [d *AtLwZIY6h30R_Lo}o'אַ.-ir:$݌I2"XMXidyv2d;V )!WʺkW6 C(R0v|٤$*Zu7om맄7d*Tׂj Yv^ ޠd^M>/RWCxcm<^˸#ZUcloocEK@/!Mau?3!;nNtR`& 9^U[`Z#5=j+"M|xqz6j!h;ƕ͍V{N.W~3:xC搆7- Z:ԁ7Dl,Uf$_:}8$)t ⠴LMQweZccb狈K]p.@ e%a 7ؤB&R39sr;k6]|1Gf‹\0! JjZ4E*P9e6,jMclDK^b(jwZ1sֲFi!N|qEMimFBa#9YFTJܽP1oKjݸ|k @#lB_BQ]u!TY]8PCT e0T,#7=%aϋ#Ց4"됖;dIJ-.DǦOR^lb(CVrQiyW~KPV=qKC1P[j0!hNp^`tFYCd-udXZWz[L:Spš_ӔNdO"*_MwMgz8:f,+!n%N},(¦'ƴ,ubdy:VkT)Yع{Ј'Cz--G#ygkR1mH%,w A3a)Uz<){ZwkM-:8r",k_۰`*?N 5N-P4]IXVm!\vX8icvRlMw(WAQ]L\׹$y率X&Ӡ Pi` Ks9;ىotG*( .~b͗f'C!޽ FlӣH^ @~T[X!:d^Qu$DPCje6=s0Q|*dNš4F} s%˳ZړuLrVe)4;j,Ӕc.sd<5wGR ۈݶ^IϋUOy53Opzю|=_FpubHv^Uح Ԧj^WK徚%aqOC|3@9"uuu}g(ŧ%\Ġ[WG Tl@:O6ֲf.f5yg;SRx *ҡҚwA‹$*cșs E9_*=!+S8W28˻˪sۼcC++%x[x&u,94AdQ"YW3C'r5 o I-9[+ѧ+*Ib>1CCyr,!;D-C;+ C*2sBLDDb.s2zD棸lq6/ș!R8 pI= ;aA+[0D{ZCD%M<)HKI C?ԽQk=j߳j 9HkJ:ˌʨ ^JC1Dc|/ZAJL Axع!l&Bԡ$OFW İpt x9;D$ [6%Ӱ/~DF[-"򾖋IIB\jƮ5}C KaDA:̱|;܌I$MJ&bwSH4m@J3!T3iT q$4]<% 9AF ʴAxOO-À'NKPEF]45EP}Ěl!Jɭ,Iˊ6J1t3[-{2#5YȡHژМ`{1:Ԉd,PgCB?#;bsiS\ ǀQlB=,JII;"hJ#HCO֠r%a\TEmlI:Ƒ =˵³D0!j նZ/+U̚n: u9/Q)@\8]i/Q$`e1H1zH18$(I:bJ"FQ`s1<Y3-$DÐܠGUClW8xM0c1I}3b j!+ﰌs*!SY<9%d'TDOeDYGUhX5$@',a:lT<jЇuЙ-؛Yl4Ă1WUSth*` Ret}ܲG}c}dCm7jZ~[ybXl '% iɨnך:\I,ۺWE \1M׸#mS%Ўc Jl6Ued<Bk\aWfWvԼ9 `ZeL&X6s8Ӹ8TTTڋbAdYch>^;)^!YZFTRըxC(1c-46CgUgEvm;f::_l d;L^Eh1SN>tW}.`]\:UH\"& ^!{ ">԰He֕\^͈XM@9Skٕ#Fj|vۆ?ݶ:Ј]D&E,d Q M8Nirr5hg5^k5N~{^%Up5W2AFDod[#liBlŎdi`KHte+lEifᱼe[>^4Gڄf>P&^lj̋x;'fӣ;^iד q5_tVݳ.9w&ny僑kiF^|,i k++AnGoťh|Lh`j䠙N8UɘEäѾ^ ӎe.ډa4ȸ e^jij9f݌=4}sz#a_-rEY0fcnzn8k+G8~k.GE^(RPK"%\ 7U6.l<S6Cel6ef>pJp䕴H0\5Y4ULgJ3an&p<7'_E펝zr.unCiwُ←Ëj:CM&PC͉oH|y׭^׹oy`{({s~ ̪Z˾ܤ͖qfWtKS=w ~ >ݳtKY_x"qQnj}V6n,X0y(n*r(G.G R1$w:8o","9Wyl>dc~sssƆ{`MPltT9:x6 B}6aMٓ%(SUw״gfb}5UyGwjvMhCOk *WHl wfF0-]c]!ä|XD':ys}}wW=֛?JnPӳtJJ  n(EJ[Qa JXXC6lhpÒ'LIOʖ([nx2˚4oΞ1q3(ѡFkqmm`Xk F ") MYC阬;o* "[lU`jVj0Q)LtQy*_I\a[\tJqfyhjf/|t&7nOfJpڈfw prA=+x*5v޾˵nm_XZ r֥Ui7rkѶ nK"zwH&9IRkq6J'd38B8/G.$VLJYp{ˊW**\?ylE%qDh̳;*۶{#&vsN83\$'wФgj#zyj=ޓOR~o󛯳EZ}gx/uxoqko)-7,Qܺ|)1%~ 8" B`v4M U k̄j*i;C( /f@\3}vYq%8ʛrАiZ|Q Ȕ쥯V¢ԪfF)j2n"XF!uMlsܣȨt$A @-[ WGn>'x rk>dh#qql)iSf0aǤ$)CR AǾ]9|_^Tԭ*{Ԙ 1n˚D"yY…y#xM5cw>ZRbLXs3|'0wYƬ`"_O󏔼A.dP `:Y$w $U1Ɋ"a"HIғtY$%KrR}]1q!aĉF1﶐/CtEeѐ穁Ҽ(bugZUkrr/+r:mjMV5S,9dJj P+2A 6Dz[C!yMRk&2yUHɣqLPϒ2Q*WR~%l)hiΉ%SY<U0[w*N! .3̓ eM.sovSuXeyURmҋ`~c-h{=xV3%:piZҗ~bȞBeы($u LR] iZ&D)Mbx.E!ݨؾjSvKӥqqL6MsFI5TGji"xjf/eSRTb)Jy-h|Ҍru/F[] %Gߌ,ıҮf%؅D`,(ĥXo-.(Z`QrQ7t$-i$MZC֝>+ˤ,iy<- ]S]-l;W.y=z:Kax)şLfT6J]mzu,N&f3UgM.k [[#Ei|c`n/d]]ӽ3=>֧vd8׬Y ~׎0jmIp?wI[yN9lqO7_pij܅$1Q@u^iEA7yɑɥܶ]XP^ P͕X \TrE) ANЌAyXƷIvW K]Lץ]Y׶]We')MLޱʕ{QmU,^QTGM`z\e\V2^IYEpЩ&vV&ⵖ a!K.JT-SFy!eɽ/um! $#_]Y)-ŭRxӨ=FJW8΢|F} XH( `͕l4D!a_$FڅY#!nɍe@Q ɠ=F$#TؠͽOѠKUJXq2Z/&OSMQa*,cPVRUw9ǭ6!%H!+bT*M6E F^*"^,]T-6!)VZQDAn]%BVeIǩb~&>Ϊ)_VeYJ}dN+4rU:"lӴe[.5JM̱eOF2&P:cՉUY¼aA7_q8nfigsQG%f G*DcDQ> ,y@-dF[dp`y -dc&eFjoT=EΈ\^id  ƠqsQwJ=eZIyKbLj N]>#V# (m߉ኲ]Q`(omIt{VFGaV2VX*''ibSFd #e,mN]!zB^^b{R"T'&^R'`'~i9 &c`Β4c fldh:h.slɞ@Rw~䂩f>Դ(2fQL"xUh zӽq6I/QX󩪮drsҪXjjk k"k*2k:BkJRkZbkjrkz뷂k븒k빢k뺲kkkkkl l"l*>48>,:4*JJlZb,Fl~l nlƒ,l&+*Ŧ,ʬl~,,lrv,lΎlm*-lnl>FmNm-Ӿ,kvFmٚƦRŢ-B֊"-*mj,l>mĺl b-JmȎm,-βR.jn:蒮B.VznVnZ*n:-J~nҮ/kݒ.nm &.嚮6.mئm R / Z/2-՚ήoo//noƭ׎ήl>pr/j/b˲n ;- - g"p,z^ _-V1q+3q;CqKSq[;q@!!,@G$TG$TG$TG$T%$T$$T$$T$$T$$T$'T$+T%1T>GTDGTGGTGGTGGTGGTGGTGGTEENCCIAAE==?779224'(( "!$"%#$#$$$$$)#7#C$F$G$F%D(?08<4B1F4I8L 0`+8č cA˘3k̙3T" i4ӨkT׮I^M{좸."Ϻ~675 yK=<ׯ{ Uf~cv{o3#K퍵UΚ8߀H&8 u`gX1X򠃈m4E.tTj!j)։&Rk,-El0!S‰Z'Y7yVjuUHW0\n(ZTVUEszuda^Jad[ ٙl&aYY4cȹSCp)ڡ& U|q%&)in`Zm6ZQg]MP.bvmG]XY[YaʛT^}jw*\Z.hm.{mrqf?PXEF8{Smn`hK*ΔRRdp# *uH0Iʙb[V~KUAV/c]wWqL]U^RIOVts_~uɑ-vqhZ;o1DÙX( E=XhQCehq۟(n'vpTTkkx;|z/oZw]+ŗ 2j_m Frgz cfؙrH؉]PqH;HUY)L)J91O"Lc' NIkMRמXlW/$Y(eE^b>52OQbܠ8"mIR*Sj[HS$!b mzQ〇{ZIGC gYspxo'IDG>MZL˃4:p@G?Bfx&t "b/#Y]20E7 3;u*hk_Ǽ9h# fk4F{D9*zfMLqqғ):Im}S|]f){e ٙOCm";Skr/ģܑ=HR }&kƓƧΦqE]-̤lK!i8v#KU&Ky,@v.y/QuI%-1In1UT=Ug;6 ~4SJ=S5w2#yjpJ6Blcf2`  "0؀z$flWDM?F"TOfD8X5e` I֐np NnQ7Mf)uSBx_ڦbb~6rr#p2PwJp[Cђ5'Q5"R~%p6EdUF~ GQC'7+7rb'0: X (e ?3Vzea_#ւ.gf]t/p$k$^5enEC 3G"q0I1%"5(#{ArL$xK=NWMujp6`ivWTwbK jUfC3Ff\"p"e0 xo$²c#bTMҗdC=҉0Sd|XfC8q+Ǥ<|giA 򷄶pdjO׍hupFQVrxS ݨnH 8XݲDPWae@ze)AЀ'2 y xC@sH C- iSA*a4uA(Yv $6ӗ;2?2k*jcLNT֋.d$T5>h56;de[XUjjrkQxbAew 8nIZ̀u4oFԗf1~Na 7O k/ATX}. f @o #LděEpp՚W~Ԕ}UD)oeZyU~rr"DK(X]@3p9s8_V1:(ϑ%ܥ';Mb*/( y\*2 },z1Q,۩k2gRS;OiJPIE^w4 t4Ssx?SAATP>]gUaUEaF)'cIae8.$1ZH8DA:茚LԽ-oǥXƥ At= pM*:{uwb trTV|ehO=We(#p:3QUjrbqR:bEY ܀Jd˩49ºF/3;*3d~:!kvL{,ô_A #a$:k 0 9k!Qj" C˓uk)*lk++Jw0k "' F0:x"\F}i,BEk`js(W3YՋDH#˽ք,[L@gL%Aq1Twפ,tLb%[*~Do%z,T-(ǵT9#b8o'u\zY[a zKJm|d). 6-368^#l!o:ϲcD*!a [%R8"*BSMA4s ѽ8Qxh@A0mp  Җ\ nWc C&lߔFGF1Ebb$ČKu8n7?i}qoge-7{"!bWgkPxo^%WͿA-|k\ }nf:^ef4s.vs+!1i睫&tes"0p<%ӆH)]P#N4J2oW6^IrH`ot@VWߕmȽM͓g'J؂bqb46|BAW]>kAgN#fVrdP,r5B/@򻭂2o7ͤ2j2+ Ӑ0 #53Nʩ90GoٓLMyDķش\a˭!GPbNֶHf5($R+`HRJl zL)S.WP9.TwxϜ D6 s^OHZ(Ow}BP G3)Zƙ`yx "YBR , 9 @x9Kc 0~ YJf hm9,Ȋj,8v n=!'5S4Ћuɲw`NEC,4$W< %lj3͏"uz HHJʼncc Ab5Q "R=,"l4tˇ Kb_:Dpq'Ñu\,kG=ՊLH^J;ġZ؜2T'O mɐ Ȓ3Y5)$\-U `PMpɴHs8H  d( DtTfT]G`xYi(˪Bt| 4" ]_ePK4tP7қ!SJ;)9C6USg}ӳ-R4=+?%b-uL0K߀b0˜-SҌz"H/ f( C ĩmaЋFDS-YRZ4%`ս.1)FLRL-]&[x06%0ޡ& <2)L4BS'MX&TXf*8l 44uМTP 2 n2,٘EuHcf쥍IUhR\R \s>  vnҘLH]Dz12רZ6`\JJb6؁q$*._ٍ8[MqJ^bcq' F]#5f`U}ӂ yz6"J` 1fHPKO``h-̌-u40zNM*,>)Ub C 6@EL&&Hr[qrBe6' c13i`А0_uBP3C4aPũ«/5v~eJJ[ H\?03,$I9Q*`/VM aL2 Qx6,aPe쉶H:`Ў{V$[ a _뉑x+JMBmIk$JF*fyTlS'G5䨶ZL鋐0ҦRFKSAD!&"S㭔 {T}P NԸWq "R!DW+yP{~NqhK:Q5ldCF13yLRI J0r;鯦sB2 V¡vo,F5ۻ[mbWuln+v,] (O"VP%R {) zz >ZϿܤ Ҕ74rStQ]Vsd,!,\R&|e1BIi kL?S A(hdf}!wLbGs?l8d>H,)ƨqn Rh~0K8oxÅ11fx!×KR_}) ȒBMzf-hN%'  ئ,> WO $_0VS8\Tf4^jeaɉJbC\"L>d xk (6 GD ,{*$2Qِ(o{΅osf֘}Ȕ#fy9r[>fѢ5rfۻ~HodȔ>^f'#D FpJS7%SΠ;q45gM`y}yBg6fӑU*J*XbkjYeۚ4JD-^y_ AF#]ăɌZXw'-T]iپ5#6Ctբex('Ab, UFZc\ Ci,-籊%-&<\G.!l|Te*E]T9D`UW\(E^mZmNb}F!<g%_ge""pL$=XtXJ+wSU(FkPf=zؓ|!:! 敒 DTN1NylgQY)Fn1cN)C])i̼ytaXl E&'&^9dU>eNyhB0ߎunST=W!W"}zczZt%6;!֝Glުl>PR̠Z Q7B(Ws Z`>3A(eSUcevR r{ :ޝ6hj)g~7p|}BWM@+U|z9^nsU,_@R8:VWCEЊ3bii^t8^ou%<4EDL^%dPO6VbU;JUq)V1sl F@h֕]t-L덷]vyY[^^3#|k' ^O`)8^-Aj]"ȡӶc?;K:ze,_&ƩoIek5!0uDx1UEx gAMfi*۾"D{W[3z'hqNHq 0\k6>;S[p_pr0R@DY=r p'fg/zQu OxS ~c HD2i"$jiB^B2QBԓ '`gf6U'-B"ܨb 0$v/Q;UHc$#͋o ɌJ )sDTǒ4dq.E:!RtFJū *Cnc'$!Uq*!B"< y]7Y(] 94,bژ)uRp;ܓLbUopsN j=P:Rl~v6`@r3p A3 NW!RlҳCڒtmKq{|b*hFFS>2JP%X-7F#-roݛ5 *,}t7E * XK{zo|UEMsG~0bG8%S YsIh\54΋`|H7yOÕjO$rN{J~ `ڲ{[\vKz Gk'o@/! ss92vLTYہmn"h6DjWTʍdA R!HRE冤F*u(z^빌DO!a ]vNRu'8TʘI0z|OGRLWS :Og6}m>B}Ì#ĝ|MMJș|24=2X3Fȁ t2i!g e+$,Y%b:Wac]cxYN4y~':EV{ ؠ19f{$Mc4RT|t%ˎ`̌p.Wzƃ<bY,Vi|fs7Mu5y%` $]j%h nJ&cg(텯9lW[w >}0\'X#aIFJMA,ƸplϪԖе SeQ>B8 4*F׌RAd`'iJuEeR<Ĺ /h6yC ]NtGƥcN^Η-4+rY$+C=j=yՕt͆pg-n:KFa^ZP|󯶢 ;Y@,d Ku%aPVnexԯg/@4XD[Dv{xI-W 5Y:\f'.}"[3@f$xr b+V| "¢~G@oa="7~䞯EI# \Q_G̳Նj\߳=D[E6F]NflThܠ9B74h[иE4Yױ7jbLޏe{a(/V6ţ9Mp]-.\>r!vBl T vi;,w|Io/=; Qޕt4_v5D 97LMvGJmzhw+OC@9&ZCL#X t>]'jsoN7A#iQ5*Qyjyr*)|_Fp}I[`! 5`5 QU=1֫E*7SW0۹jK6r&-b_L%JoFekF[wMTuC yGێcn{k&hPhy^>qb|wnpԏy9}Sq {]r\F|U frWvoTd0bď^AFt!fF8Ŋ,.R]6j_P,4_|٪M0㎉>f8߸ynfifϛ?=s{$(aGW 7C#=g)Sgfg85`#lok@65H#OéfLIݜvkZ$f!}l_ZZ٪ + )\1d 6*.Köp k*D Gp)BbQuYq3nQkQǛBΤQz$;*rCR +HK"#HBIL YzG4ӧub3'5uBs;ˑV==ϾRK 2` ZNtH+M OA Pd .f`FU9}vR3Ǡ1`d{/BE)fAK ZY`lKz3&^oAsz=H]]]ص@{SW>[ f`k"*BK=LOKcO7c &<OAds^91[S*.m/ 4#=-1bb ȩW8 %uR𐣹2+4+%QKT4 [lT&\s}h]<6u}* ~%u; L96/ð/IqZtdI&5%1 3 l? YУ?"y 6@_ AR1 $` ը&ikkʚOHo3Г6Kt"1u!AeDZ^s xRծmDJ(,;sR<86lan}"s^>W!̌s3>iiNo cuBNy֠ *!˃m٪3șqH1$Fwɲ{U>]櫖;@طcf(J2ţ^BcS tGGM!kǞ @E@̂àv4t$8 Ҵ\L2!5lc&O%5A1$ܦTro){21䉤#h+?ReƄ%E #q7K7{!hS#A6L—9b L0C7!sќ&y3HE U_%'sI+n\ pU!Ґ9fWJkGk(u%#ۘw%?E ƆK.$1*)%~YA -S&wr30G(MHg4HvN AGŊDTAΩT!Èv0;HQ&k+i??&.Q-vSZ.ֲM1@JZ]+cjbIk\lvK?PWҰQU}mޓ;2H(z 5n JʨbUzq4ɔ\}#/q%=y/|jT&<33K81JŴ&:쪖/ 0^ 聓y33UGh%tѝkP*LI[I8.g}P51T'eІ*Y)8㑛050 fQvsJ V..;ݯ }I>2 ]Sd}nԞ~̫g> 3k(LcmGҶ2^Y/j{|ZiƮ eScliG uv.c۳X Eȏ7:_6 H7jfnf̦EW6mktȵޭKhxM&6+>*jTKHɓF+j4DЅl8w\@ڬgtjuyG/Szv(vQ6Ȋ7naRbAԯe<sNfv֐buO[vj8>8Z#}&4iȳM*l4́#OAGb],+"-K ?.SG!ȮB3HTEMC ]x1bZlA(UwejRV*2'2t"$H-ɛf(2T?U,4I T83]xJ}Rx\ň8:Q3sBD*t<%8hAV]_U`#DF́D?(j75>9> @!>E(FI+'gZ [:~- (UHbk,S8#rA;%ͮ,m'L Xʲ݈Rtn-u'DLk=tme}Wbb"HFDZo0Y`yg1ע1]YbWxaT5dzUg'tz%3Ӱ-BjlmhLw_(0r?⣎ ip;vgc?v Q^WBZE;g| 8CS<$`7,KaYƴ;"MC7tU;̰Zjr. Xuxpo!duwmEk}뷸<U;4*VUMn_EkBp$8 {i) ߬4uO)؍rӭjɰK, ?WMI.J.5ZT 4X|tA Qhr)I)3֡Uk/a IOӁ'Z] ɘpr2T=bm#.qtbbu/ptauoELbM5Aꛕfk%-k54 kΟ5٦Dʐ#ǡAg,݂Qֲv}2o˒wYK)ku /n(WT)8{Rw[7Lv <=fa, P7vY5P1܃h v7IQBf&9*.8p$gp$"bYCZ!y [V5)tGHzg[&z7.V\gY|#[Pb{y?&e*;1KS)zhrK8LV%khrr;<%3$> /}MIB;"W=J`:'(\nN׬h\[L[Bt gIA<よ,! cd/ /N&68 "[0X\"z%ۈt>xn;"C+Χ%qyгK;?F?/cR7izC)6X1pI*;/ y߂:l&"q,V8vnZ$}8O,ذG*솸.#N}mwWHfUmGmJ^yZF|U2I^ˈX#>" JNJ'5\G17GHNp_̱]d#.)܉=* a=Nv[ *ێW\ؕ9ZUe'b=|[0 @|GLJI]O]=bW:Al%2G̊wsi 3L U:sFYfTq9$*6bu_|xgݻǛmŋH#,v=?ozt^j]j8kk=Yd`p5!m-ta}W ׅ3dN6UGWQI-nz A!ᵓ57DEW`}$Y$KN9YI!b&b%MɕG,b3(Rf"NfDݩ{Ifb!g[FvDY^i飒:J)gFZ) 39f|nS^uDuBM)W5!TWH .u2tsЭfjpS4Kq|zirl6`e{ cuuZ3rn!^w`ZWI#J}sв=tlUO@mURN!sCsϩ( 3 \vl&@2c@9$ǮGckZzԉ.oHSjS\2?-RMu70z@#?ۼiպѮ7eP+s&ZQ$H'ICpcrisծ6/~$Lw(~_0gEi6c\|0H ﰄ[SL`R>IQ_ {aL^ 6Ȣ!]kN}sh:/%-9I &\vE2iFT?!>ȨW$DPbFOYL, 5qIOn犇Y?]2Ӯiikl7("p} /QGiFz#oR<0G@ID ^[&;̏^B c ]EN/&쨡\DOv iIūʖR-'t~:}(TP88D5_dFBM&#s4UŤqzY_M8S+]l)R(dQtbv kI=5&'Z[ Cv]NYUIZҌhO}g3JFEvXY;Yvc2 g|dgFvD]896MdGC*j}d]6wU-$NrE szR/O3~Aqa-N: چu0:Dr*d3}OIe:M2-n BkM 'Z"FjyX5eɨws=d ; c!aF㒑 O !P P핷 ݆i~eUtNkz);ꔉ/^*CŮ2;nvT$ߨqlsMNөoo^k]9z3Ju9N)2YݮEMGuʜn;*^G׉ʯ6| QDv=;ԴsW7yݥvc沔9HRY{*֫ &+0RQK]le cU5>G|7y @U-\VeJH;-h!J5zImjzAxGE;[T+Y#tXYZ~Vc9O?Ȱ2?@9bY!YnK_:wflBɗܲn6W}#J*=eq?3\5"8q ]55F}ʑUq~%WvDn'vXy`$Mm?&N+;"hrf'Q$zu5q$x;l#gO*\q{@QOH$?%P<\;D%{$Q]M<AO&(})R;DOeP&eTKf7?hGvg(e\uvyqlVps)_f0.aUK$g30T&$]цVDqw q]yt}|z'Wutbv%lgQ.(PЧuPF3uq|&he@#mzWWXW=V)T`hdIw9DK_ÜhɔH)0her7'e` C! Fny#X!+ʥ:4%y5ygWwX J ^ƠZ}$$z>"XPDj3%z-څF`'ʔ>DuQiR㚢꫖~Ha5ڎ?JDFwyڣi 4dy\WiGTe䠞Nvq#=})4`9X}G=|W٥ojirڟg9:}19z6q$UVZ7DrpDZeGeE+IvJ4[P9 Ilds#W(+|b00h Ja/)Qu`+Jh9:|Y/.Z:;wzYSSPf^:yZyjd vuܧ˸]j4THsOH!ɱĖ(z({Zv ř^E(R3;Hk:}Jg'y'ع-m{b uα;לO?a˳S[o)Bɛ:d+Z:jǧX J JXzD"9':qb KyKaw;z;b0:z `QBy{GY.J+jlW]~TAWƜl m"W:ji=\72VZ!'lBU8!C0dLw7ze# pKN󓳘[,4"(CPcܿsU\p穝m|(Zϥ6Vڍ\P*yȠR{'*H *f2̬Fz'9G,c24РllE ɶiЂT=ǴL?k\<<*gi_qj [0q s\|Lgӆ8}ښ̈́\n ξ΢,ʭlIs4̟-k8QHAiDJl,G雰VEr\R\XUg+> ,gil9}˗L| 7<ٛ7͐ WW-, ϧ]_2QT ݁mTݙ4;t$ɨ=iQzcQCa&}xK!3 /aknQ|M:~CX,!%a,$wE,oR8ždy]B=%oy,͹^Js>msymY}/ 8s^9v"Q0'뿣zPZ+m FNw2=Y;93~MF]9Z5xÃbp1f34-iYHH;~K?zvb2Q/-==NY6.%1vo-sGa ہ X$ 9?X1 Zb+̋|'8:.hvyj-1}Ӵ~@,kO(a60O_o/P(Tn/uR)qƭNDҥC/eƤpe~ᄑF%O?#8"#`yRA04l{ߎ teׯ>[ $ǪWR>Lhsۚq1B|*Tz:|^`ć'ƑYV9;*W>~ŬR3g*jlY:4RkA?]{m۹mSgL#XȊM^ndGt[N8-wJyǧ؞{9R5Y_k}W 5$l@Iƒc5B˹ j J4j˼#0 `0;Nl񺵚SHǹFb7zACb&"*L1 «Α2 bꨢL6 5jEi[["S23)k駪¬LP3P k?,('$ T(bD/7q4 TTSOQtUP9k5UXYUUv*?-p$-+HC2˿t 4<}"' ᓉEl]oGmvzg >A#lW@ۤ${ @:ךy!qNQZYj8 Z`W*=ʠ ?;9؂z bsM׼ˣ&QՍgSځR1\ Pzݑ%wo[i6 G6'̳ k;V:m*jא[@s$7v IC.Њ6q+2fzs8ۆ\E\f]xyU=u\^[]yL 6Q?NkԮxTe٢$9y\9kF&j[ߓaS*U/9)GYSTӗMqC&Lt(K#ZkU2*EpV F+xP!>kpB}vWOjRyB50.-')K ‘!]j]XF/[kWB04M<@I-Τi+xOÑ~ҽ"5p|Ld&5FiImhn <(7&%g½ V#e`b%ndJYFHmy"&&MPniKWFd~~([0K!, g+ۉгLLx0DDB.PS92%p"xzJRY( dI<Tt4cz<A4yUFFa2QNUDEj[{?925FKg:Ԥ8Rb)HPS[|z@.Ч#3;I_C;T+R5i-zfԪU U?[f1DzGsI(8Tdz#"*BEIfw%@ΘVEߜedn=l]ZYЃl 5y!~lf(MotEޏ"D3'V9f$*men(Cu!$!$P.uC `&t%ח%yɛT_3 I X@殖6ݸ`]ٽ uԙeQZCt`!Qg#F)b '%-)M_"XȦ\Ԇ[ARkb7|^a x Yx~a\`PLa=3۳$m}Z>X hQN^/ޔ𬚋?W߅Sn  :.HBH-$/-=ͦGi> R24n{xNe!#eo6G4&㤺n;ҩ=g'H^ 4D9 O2#X4)ݺ"/epgn^oyy/p;aOK_EC}N&5i#=TLyJcJA,4G>خƖ=}`S)B@G<:L[vtwuBOyt8kd7`HĴ[DRz04z[d ?fpc} $y@Xh:[=$Lɫ ؗ+S#@эJo 7 8X3 -))|#:yaA%j$/J/ [(l 1)޻B+B, )Z[*9QW\b4[э",=;+B؏H&`w8;ƻT6't栦3:?[`+*D<3N,fR V+" IG{ɱ 2JA{=X+A_EL  x2p, !(d=KQ{<(WL'H %HЁPY&mR{ؐ1$@æCc:aF0 zӻKh"DdIKҔɗtIT2KKN (];/6癱El<ϔ*Dϧd-S¥A / }Os:=51$3TLY]K0liWǼ ,2` FSt3, OJ@mϯQ@0;J$ sDŐ) 7,Vi!&߼(-@Pd1A5ݴVĔCӨQ|e VE9QS+EO2Nz}W yG9}EU94(Ab,mҔ$ K)$43235PFeTeG`XBHb- PMY}>6+\QÓAJ J,a[;Mgؚ5(Y&Iцh;lZf}R'R&uȀdMP i:GW 8'E s}DW13D<Ԡ}[ KS4S[}SΤSDL;*M5sQ.L1/'暯֌܋D% MيM L-LG?e/X=TtxW-AX5rX͎oM"=]w}?"#-JDord MC6h=#Ol<݊J ]]3L0\u-dz5|[q ;9\z/W<G7 \˽`%=ͦI JUYO=af]aHS=Tn=?qr5SM0'Nὖ*-ӽ"b%کILŬmHP i{EVxY4=][ .Sum[JmN9U`Z4.v7F(u/=94`B L ˰I4aS=LKv>ercXaڝ]WY^kעd-ء}; 4_f^#M@_6N % j^*DѦeo&d_._͘{vrUzMch(O[8x.qTX5ҝ,GPZ8K畝dO~e,66c渝Veʠ X1^Kڎb +}l2!p!2:N6H) %dXIf^<4CۨJ3[rk\tۀ9=KD>V瓋kYL>mM.x gҊm.bӔ 1=ЕӆV]M\]gN>\(k4kkKߓ^km&`= dmhShF +cbUmT)aķPVe5Vm_v: ag5jg<M$J~FKp`g$T9(f~Q\GhB%T]"[]HnpWN~prn$hȫ^זfKuKjn mJWX ^!$}aZ`=nn`rLTr-2S^\q2or.9Cy4k^@Vո.ldVճMs>s/pZoN.7~cHd6S҆6Wh& ;ߑny-u?)_đ&D ;5=M^r{; fKcoYondWrhjNrvUq WY ) Q-cromkdztJzF]K:s }ݔ<|Wk[ttB7|ybΖ;`SS$1:y2a#1u'1o!;{;vp`+R+n 9֝cz;И{;Y?k;W0}}i.ٻ 'Z`[dU()_IUIPq8TPKbOJ)aNEX\fI #-XTMhJA`(aq]`;*i],-9}SJYe}&^k6zYjbf'^Hjfkء4[nw כ q'vLuf EO&bU\N:ihb gqrv ꧚hkg`WVd^n1)YB9 fJkaCjٺcT,B刞2eQ(R4'UU]u嫏TpCrrX#5~"P*Y, PF[+;^*XBv7ڗK%>0 K-L6i/WU-ƏF!eCNƙZ`*)u>Ŝ:CZ3s)M QBt)˼3Xz_Vu>A=䐃1Gҫ[ UQ1ws7`r -%9:[R?#>͵C`:>cET^ :aTjH髏zж>jk;ggHmqh2L8xh=߾EY լD)cs&;7wPi^cλaXy# `9cZISQZI9pU%Jg* $!A'-*E#$A}hV د/KFnyR c+B&Nm|'hП DY>Fb͠RhB*&&m2$GCmzEhF9QZU$LɳޱRC-$iisL(HV`Dr$o^]V_+-'Ee52bMlN0e#ZZسv)hx"`䳪kh{3)4U:Qt*2gk2}K]M2V-;^kθ[tksms.o.|<гȪmo_[o~J aׇucjsQ飠7F7xh w ڭ԰1l# 9T@SpgGlN1MZ+:3vl]a8`5e<7Ix:4rB:M.W>ɗ0X+Y8"(}Z#@7LrRWi䭇ϡ%YMrbEFcpnc{={OEb}4RM=;{a6:>0gi[uZ|ʑBlϘ^S^8 $? ^4}HI7Y@\Y>QP̕yY߄zZ~Q՘]VK`Ԟq U 'qڅ]u܎`Yv](۹.!fnʝI!Tɘ>]M[XPAR1XO V!\s\QWʱ!ᄌa䗌2TqQע4׋LYءdN闦[X"r4 W!ԑI] [qrt$F 锲D1v@T"^!%I2&UI 22Sɚ<X 7ֈcN5H4Ρc $J4J_Pa`=~Z c>>c??d@ @dAA"dB*B2dC:CBdDJDRdEZEbdFjFrdGzGdHHdIIdJJdKKdLLdMMdNNdOOeP PeQQ"eR*R2%DS#TSC?VTRTUcVvTZ%Xze P%WjeY&YZ@B?VZ6\e]%XFe^F]eWb%^%_]`j_%b&^*UrY>bJfd%ecAff%g$e#fhFfigVi*&Vdffk2&md6&bnlfo[cJ%pޥa~jc'`ʥh&h&iƦg"'k%t&r%lZf^bZe[6^ne:g\s'g '`f'x&rnemz'xfw.wFR|qf{vt[ʦ{'{|&n֧ogW2n_q~%h|~.eަp(wNh~usw(dfah~2mQh('thm`2g{e(d &\.'Vfxz)_v6^iQv'Ti:蛪}֥ivfhF'"j"j*2j:BjJd@!!,@   #$%$#*$B$H%K'L-K=XG`GXGHGHHGHFHFHEHFLQhYe"n&v*1AQTTTTTTTUUUV\arreor^msZlwWlyUlzUlyUloUklUklUkkUkkUlkUlkUlkUkUkUkUkUkUkUjUcUZUUUNUJUHUGUGUvGUlGUlGUlGUkGUkGUkHUkHUkIUaUWRbVJeVIiUIeUIXUIMTHITGHUGHUGHUGHTGHTGHT;HT/HT+HT*CN,@I1;@6>ByQW^fgkjpkmklkkkglbmfkklllm{ǼӶ״״״״״ֹµ̸׵ܱݮ߬٪تتتتتتتتުݪت٪ݬض״״״״ԴH*TȦ!l:8ME!bܨc! 3 Irɒ(AhQeE0A䨲CnԩLƉ%ѣŒ!A|x(ljP1ŪOjq+Jj([dvdLjM6åEٔɋϿRvJ8ÅfqFwKq˘3k̹gyC7R Ȳˡ-qƌ-u۶s{~W&j!ƲYp!. P]޾kUЏ=yVUn{mf~{t΅v} Xjy!xh B ~'!VنM: JUM TFEQ/$l3Vf#O.MъL  rWSCb-HWZ^]\$Voe֗W՘/cer"lmt^K;䙧0uvV&$(Kh [i`݈clJ SF{>!gKfġZjvmݬ`=Ry EZ~9H˱)`Y,h"h-V!*`ha;D@.#L"͔qMP+Fik.(JlpRSI[qZ}UW)qb}U]p3j+]&%<喫Te43`»DEsDF팸!WQd(v^o#6:\ohkLj*dw\wʚ]}x+=|_z#c\%텦,` ;F0N:xtJH]'_1ECIdhJ^ 6'H|IatwWc"+WyӔC|$stLsE-.ӕ#ʽ}Ka0/bT(V$?"K2J% Z.pU9S4fcuP³wYΈ'H>>0máWNHE$ILhk¨`IrT, wCh6'2fK $9lfO ݾ<xYʽ,LI Q#j%u>yIՐMp[2h `{AL"'u!XxW#|Ec6uDo;KH $ DLgvf$l$GQ2 gpg E7!)dYk3f ws#CCam!-JfQ"WYq3rv%J5>dOvebU%3D;4GKUTaQ%(SJ3f{[%3>bhp9Q|f|\v4d1} p*@ևH1WQ 1+&D02-eC_3ef86qQeZwQnX fI,s3-37g tC7k5%sIb3wIOaSN9u-.usy0E6-|6!)uV Y*@}4C8}*  @'0YA0`"2"U&3{vW& UU`}U X%1wS9~%sl5$X_0Z볍SL8nl6tI3l$VamwnF'!Rn[= &`G59$P7hd2qک}҉5ff(PQ~p3s*):'u#'50Ca fQ zC`0Dh{&jt-?ɢ#syEhK8r2NE-QWN:px79\sQ䟸Ftd.u `K)1KC1i1jw%d"D*qjjwگe@jC0bAY=zxkevtKcS`@y3#i:4yTmw`K_x$z=F4$[zʴ"|46$xǭLȧuA7x sIUPX&XEx`ᆚbj!2pڵ*B""*81\gsa!)R(z;YYh (ŠpC:W֬ʁJ]7!>y?CJ GaA_Y>=H)\Y"$pR>?S"w[>4ڻ;1%=7& \D#1bnQg\gKԦ]cn"sNTAyKY% ѦHSc'@hǠC8;Kf(d~)qpegJ&%TÚ BD\P36a|+\%ߒp&bPo4W**E:6|s$:baS%vz[q(x_!k%oX:)4)vkt<g#s3Zk0@I\y% &K>&37{i:+8nJ4[3j#V0G9C'ӤrC$п}&ܴ]#"WzNWA/hɌi/9C,BsRa~5М@ V39x$1(+#!BèL,Ꞔn3Ʋl+M uHlī^u2;x$GzU<溭˭'5Gњ1))41/GF|lZe/t["f\>ēL3Jy礒(%ȑ$1 JHm1,5lWEk Sh?8xmTFI6WXmL)v7} x[{uZPk1^,~.T|] wnQh7^st aRR6i ^\ bKs/[(**EmV9r:Ɍ.'rC91E@\Ju,uV^Μ`'SŖJjG50nlhAA163X=#k =eN"h{cz[{wȚwKYzFgg&b/_+ /ĄJt\ʋ $`$S`&.YG}ڔ\؞IL/ψ&h׷sQF-F Fa^ )aL R fKh*t أ!ڇ9%BOg tT jQ~uMCv~I%&Ŧf\hҏAח&+º?0V+RX2T~ƘaڙCƘ)"~@lD;RMV DPbBـX#lxd@H%MDRJ;vFU̘ZҤC~吞R j֎3'T=BK~]evVO@uJV 6ӐnEl aL5LʓgYka6^9z~ U[ ճ1Â|K9:OS2(G}#[xɓ>s(i2,f\OW]]uFF#lrĘdƋ7:28S̑K*=b-) Pfk2B\=0P@,,*bjJ=8 ?50XPvBqRw f'Zgdm},cIg60b}hK rDb8nDD,`Z@q6,;\=8uvS!lvg!蔈Bdb@E\̴] R7IQUbgJ Jm[L!%!^2eFgb˰[Yp؛1J[i^۵y~MbҲ- D/YEh΄Nhbč葹qOʮ #L@ÙԘ#Im5Ʉr=ah6IxtաvapŠ Na v(&ciJ:%L+68x;*X2Qgbd4HTiDdUd2&BPcm2et*+`RBbx`M!|leXWѯjNt6IB{.w0 2]N3];"O:"0BO MQ0ӝϧEDWR8ёRf.J8(gxds)\$L`@)&WccUTpw"Gb)6=v:/0nE]U #wJ9VZ6 .Լv5ĝ2=1j%8٧P~ߨ+JrY"@!"ĸ<8~P85c5LJ^C<!1=s A4c@zȋ-piEq Aao~XA=d [0 2:6dCgED{ fҲ̦b[܄IZLM Nӂzܿ`{HAuبkH#wc+lHqd[4H[ Fy}S"]H@7 Q\-eD|k!ꠙ`&kH6к*c/驭|g̦Sάl'Hⷔ2=ҭEҔes37&D|1ZE.yM<#J+Ť oʫda"։DDC$32/P튊nk*&J;)K,˲K#3i;Sһ$C

X&6/fQyP"X ZTׁ,U5 R>CJ&*LM{;AF**>eU >>h!&[UV O]5}е?Z HQ>ˁcVk[ش݋#]k*fj4( 8Pi]6B ,H-(Ki\?OoI/U1[; u^;rD M)٭BIeEI#ED$H;V]5ۣsuj =C<,C8D2P  !%**r7uSNX EԪ@ hV IKĻХQ aϺ>jC,وDL1,*ۚK±F5}#&ŏHar% ;Zm.5]q#Gɵl#8RO0Γu㬁BV]+^Qdx؊MYe2H\_􆼰.o7+' IvR:A *1J.#+Xn5s֍S6U ^,+jPjsܮ|Y_gnNA<K$E}op3k\*SHL @O*:z*"@BDȺB5q<P<1+ 5U66BOHC:Ŝ,#K}y HiZqܱ%u,R,X&zkdoV6jKvfC%GR&pI0qU87ι$uI&aY_x`n@lXgtX5e6R yA]r lޑPI|}* M;!_tN[켼έ\C9'ճ AumkcZS,]0}8E0H\`5S鸍9 g=iᗘ }+ģ,`R_x4㮮 "l\BK dؓmQ1H]̨,C_j-&y%K 8yrxJL _tot 62U'`bOϸe256^#OJ F?e{5'jjOfzT@۱sRVNqHdnRoRVد,Q9N;%<< Q iE/VVe Қ :O2io蘩 ]U+ac h@bZ:̙C|.d1 E1b Mi+&d rqHM莬UwK9Z `qműP4"t@Ҹ:gqx ?n(Z6o9# ֻ"H F-yP|ʍ>YCa`-M8AzF' #Yœ ʢoJTӾ۳r1& "s[DBUN/,c{:[/`hs M<>-#';[h4KCӒjVFACz:9={KWAg=`*Z|}1טq݁zO>r4e `ppKwO]w=KEO냲(:(yR|2-O) >%P-IM``hߵd kl!CLȆ"F0lVEHlDbiR$$0`jjx aC 'A"5whƠJ`)ŏ^"֬ZnQGKb&,-{p| 54:m)Pn?KJJn|0RO@ș*1{e J_y $.ZWX3́7 N&!mf= L؛V4jw6f"!Z4B$DHarZ"(ůMpa \×'GlAPrx#}:NDj)0$騊RJtaMf!+fljDt&;32ULfHGJ>+Zrḳ.2V&^yILlmNւu;m [0K Ї$(mBB` ( 1Tv6*5ǓU\3}ɩ4쀄,U# 1QyH(Suߦ%Pbg1$-($ 3XҒEUC>D$Φa=10vZӌMVJD I32$&DTMDAGL|iTFh$N)F*D ڙt;+ȵwșbQv%e(%zKfD%0h0rGy\pzڌZPd{O0*AzL w(zዖ2r(Z ʦ(d&?YJWj6u1RXZC*,]\y,zxVUlfe :G쑽{sߎAIl4 c$k[ز 4+2833I1J(Sū 3n Lyj+?f x{żfM[EI,*6Y"  W11!y '[(akLZ%<&X=lu7A L 4K22,>#Lf?{b8EBJZ1lNh~S`wi/9W59GZ5tC= $AI o]JN Y 5Md¥HRSȉ_F,v1ؒ\(;p-%C`UT\U^ A n^GދJeŎN]eZ4%ېtȒGgy 01\As `(A=܅- r_ AvI,;q kgd%\bNfCPbyQP;\-<(bޕ: av+}GAXWl餫x.~Y>aa?e& |R yKZåMU `@( aG@XGY ɾ5]؊!]kb[:$!̣&b%  =5 0|ɋPi%kۈg $[ԸB\BE6"__t SIf'NP M5BD|RUd4WKD\XatZ!>2Fh~:uDGfXsTmZq,*+ bŒyH(jl4)N=6EpE/jʵF0fEVsxfyDָF pd) f:'x5asT#dFZ!9*I-TzXKZAXO`٦f#`:NR*'zLaj 5䐠DZ5*ae:{0M[׻Eɒ5<|\qqA]b R ekp]fvfry1F Ćy֏>YD +D_;b^Rb_i|ajfrWr1Gl\NjfiPqLfE{}jj] մU'E[!&) i$갰7pݪiVк)OǬeZ\in 0ՌmX NJ  v֥_]W쪊`X$5EE ୬v[b<@ شPNp TB!fmЄ$B0ࠆǷjeCAU (nÉ5Y$IEenxέ-!RqEruī0WXzoa )[qI&DzDbڶ#D DTت3L%۫MF҈E\JGg$LF hvzhzv0D>e<Ϛ [_dl#b#9ؘd >:Xk؃ ܨn2tUˀU+}0#rG! :LU^!✩ h$֛Or1G=F/\DF* 2 `M (=O* φF2 Jč Mr$""vF;mGj~J2Toij+ap* GRjj{:z&Zh<ӈgB-@h#@~=p {RMHC =\1 P+<_I3bu (ߝI刜;]Q᝾`HabLC;5tKCѐ*/ !R]WDRmrCpT(B0`NK3Z'DjiNq}Vj¦ rኦ,d;5JhN-q~U/>NɣYҦW3GsPrBR!fqp4_BXs6u5Mn7 rj 9r93pIڂ|2L~/b@5 k(\vN_֓x+EDKRBUBlAr8: Z a7glm17KDDl r>R`Eu$*$u(L<7ogTQx BB43b-hkEcGW/pVF2zP@̲`'4'365x8Q ܕUmJ))ΙcH#dA\z [v$C]׊4rQhu+FQ: ZLjs@idR@%oMcXNwa2ֳI?]=u}V{a|m&D߅<Ǻħb?ec/B +kL%8 :Z~iĂzٕD*BT:6+v֯_3p4kϚ8If\Uwh 9(JMq0Bo>Օ1T"ͽ@6\b%N[OQSt׾yFs+6%?Cnj -BN^Ю_{7k=@fH&[CA8BF8QbE-f8*`:UC 0ɀHP< Mlj̉N PO8>D 1¦.X&C0&&&a«[ٜ:Żknᾕ\uxoeUZ*jB[r  ^N8ϑ 6EX"U@Y6ɧ褺%²¨b\= J)J]p]4S(j ,3,ސ!~cfUqs-cX<ŴgH'TEj&(eKImʠl7Jv%,֞몋@ `*1=6_B S{L &*6FTKUFmJ~XWիH$`r:1`9jcBan(^ȴ8`ci# $%`(xK  Or4adI&0DĖjAEGDŨc*Qyd< Y 獿-bJaV-<nKJ&-\RzEajUveH *{F<ȭ1:?Ϟ| 4'[ۦa#ċ uB`  E]22^wG=+w6=Y+`Տx-.YFS=҅IaS' N;ѤUq|G!r0&MDjgZA&Wr@wEh1)ScBz՝ZfewYcCSh YئafrGIW9A8xC13iM&8a-$9t51:[4fˌmjB8+hH &]qXU!UG 2XM5bl|xǠշ>22zJJ~<$ov~_Xer=o]d-(Z\`&Nؕ^"ሺ iV "$lJ'(MjiH9YCIvA +'P(eVQ0MFfF0r}%clJe31k͜-ӟY5ፃ$/VlɄ2O Y)OY-B, )f|$7hS'IiФPdYq,$ K͟z \bwp=*l*" @Ξ@XD{_/Ec "U&56KNG*UgqaDh0,o$'L`!ZFjjp.扃Lʤ fKh.ZČ..`ų,%׶#VgQrLVt,t\EĂhر‚㑂>1Bh#v $ ~lb.op,rǬbE(R]@K2A"UN)Rd4l^.g_xn P>jBˉ.(>QjKi".SjQmƎ4EҒq.>6В1rd/JP$)W&-.ͧ-Fq+/o(( *ӍtZgK:(E~wȨ Аt "l-zyheo$n5C`UT5d$31LLW' nN~#kq)Et+n* rTQ|,:"!L2r'-)^#@A;bBhK;h<3];* 'FQ [ևf::,.3]BɕD5K}o ڤ 'AGc15=b<8NTjv, )l oh%*!w(Rt(!RQi'de2PVVJXdr.& 5dxHHt,"a:5PB#8OCyt(Mi;hr}%ui9ݵJw)3"Uy IUpz6?dvNA͔,i%'.xH)X ^#b]LKJ9P}VVqX+[O.V;QO=d6*{Ylo(ebx/H3X1\JE!w7e!Jh@okUoa;l@—vNBj# x$=gX"`YF[)Z^. D$nV#v ZL3KRoCc|X/m1Hq/c2P{%R2OQt !II'A %.3j&U 'MGw-6d/,:j23fÒ pqs;.!YkDehB5Uo^t="H(vC CZ3st1΁օU5Gr6#N pthUb:2r!nab(,x<7NwlLM)*!v E[9MBr$_eKdF\VB,G&dSٔdpyb3w-bpV'k]m,۟ƻTgtϛrQ+Z9V'daYr%]ߩDoʱgV(^`K=eEE,\YT?,0\oRħlN.y}Bb +Km#*Si努ć-S-J55xu.!lwƉr֊8Twx46E~[׵7>r'a&ǦyS\{2ÞBcئ{?]]vo?'> %? Wށ$b,8A;fD)"l2ZQcŐ 9$yQʒ+ORc˖#GF)!9#N)ϋld *`s TɮKƔ'f8Tı>,5Եj۲e;yHf[| =Lkd(F `*F^`1z_ @;ؓgA},-ɻAkb9Ӿܼw 㪮q],mT郫~ :Q~֙ ۙf]֫*t],r2m$F5|lG|쥇JW ]w2TTQ-eeQffƭxp\2ņBhREȣkwS}G$ޭSH&R %R~W5dL !6`P]Eb =dw?YԕOwJT;$WZu^Yug|e-L޸sY60jQN*RZxHxnĵ***Aw%W*j򄫘EgzU`U5"L+AAr$;ܼ`lz~SMe` G `Jw 2\p%Y典evm-/*JBP%L,Qñ9L@9):y>*DzaVa IqV w6iƄW2T.Zɨ<)t[1$B*XDl6YmCPDSh?vM@MmvpnoHpܩvȆYRU+uXwL ܙ"sUe`9ʾ5#OeJ&Jn-}&g7lѝʻ"K{~!.wu44S>%/0R EY؂ε9lYc֛VsX1dښ.L斊l$ZCVv56"TΡeQ ]m;zQr!z 7~unN(| U.pMʭ.Ґe #OՌ+˝-,`hnYNYVЂHk&K:IatxYeۍ(_xBw1Px-{0yCR@#6@VIaJ (E|ʴR0qHIXȤEk4 )0?-T"4.//1V8d{$5MD}1DRO3UoUY 5HC1!#7Bp&RtmA[B&!XRP|CۉA&9畾xrȳYӝÐ`6SqSA(#lR/m.=8aPdi`Җ¬lAđ}N)SrFRAaQwwOt? b/ #K r.$+A0eV+MH22RE*PPl*b\a8zWz3`yUe I=Y,MwCg=nl*pqa<6dvgTDIt uR9iE) h6"g[=DA^ ZH" LӾp<\?3~C(CuZ |\wnPKk0eVo'c&l&/r]d&&[RҪ!ON VZ)( >Ժ+j]P1XI4ѪX(/6bx7t\MJȧiӥoRZs$&i-ؚAxH>խjT^4g^AD8\AjSؤ,}-qAAXAu>V? LXI)(Wud蝄,/3BF~[Q(Q_%`L(7K>boJwE)CaخoBbj64Qc= j( hk49򆻬m#uk*ē]& m#e$"nLd~m]%^8#%)E̐ՀnZڴfwU+5x*be|O CjWP3k\,3U5|WB(tix\,,,ВfdYF];qىcOg[ƱCj@طBfշx8{ckkfXh}eTVXWנ 0&7Vaj{qGf2%_$R||;dInC=xƝf9:SM +g;Î'ZaSйi+JraգX*5q(V(;"*\Y # Qб^]#ӺޥG[Y~u {{_vk[[e nOmSۢ &tw"povRsr]SvoQxnieD>%'8eLwECS HfZ3(u[M.qwqfqk/Md<7;{a!'7!7~3^Vw| Eiϗb k?8ErVE',5`T @b݇Bz+wWGR_pyW7u c⦆guxAsfywexxv~a?ulՈ)X4k6@fhAuwqs*M(yczv~h8n(6EW@էi͢eC&`/Q،7}~rvՈBOG%qJ9GYRpWGw~~qm#ȶwl*&cAT(oc3MqQ"C4i(wg=Gf& \S35`Tݶj'q1Zkqt"8jy!d9ą {eG(F#|Q :"g21a|\!H<7`BLT2R@N7DHy)'8w*cFfF 78|v7W+^ըӘlBD u(wG+_~=.IWxG:ZHy6ؓDCFZhYfd6ae9Q tj;htFsTh꫸ᚎ iBE9RpyzI_m8!)GwlH_ZNlp >^U@ :J]7qPp&)z1/*j uyHV4tW/*Js=ElRN T}"5;-k*A֖i+dQ6J*Hs~ c;U8%]e :fm{Xo Tqn vxd][LV&UwJ*&ڸN?6JKthk"& 8wر7Ȳ:*:BɸnZ뇻ZUz+v{2JdXcwo6T tj=[0cJR$ mTW$JQ뺎+#%tݚWgvt7` ue1{f9c{aPZi{*tXkq{kޖdł~bk+TJ$s冧C'q v*E&\隟7AܭJE Dh뺿OK&#)0Xq'yL"ɷB, ,3Mۮx4L"L\M{fLKl):a5(Yd, ՓNY 6뷩Mj[zܴMDSglK{T33|u~{|lU(3e̠l7VlZ\v=*1E)!ŴzW5&DH̴k@90;;W -lz <c%dX^7Rp}9<];YF!ù+ӽ A`{S &bD-qw:mrvn୉u=j>du5e޴{B'=GVkk)NpJ|z>Cζ8in.71BrdxN43wlU(1 ׉`mN[מta:C٪](ಖ#8&a8ۘͺ~Ϡ2bXVNVbF@/zLt jqPwShSoI[F̞d#FۣzK^t͹;Ʉ$s-mFƶw069+w'L A5OY!/n!}}m=#L4-N+R2rx3^KW{Y|c/bCW=0nh$vMq3Ӝ㑲G> $FA !!#aXE5fcG Q$ȏ)-.Tْ XpkgZ(ў.D) ԨϠN}bU5VU93&ʕkvlׯgvۈ2ת[Wݻx0`!ĦHk_fV kHU/YsfГ1_Lz4ҧS>-ڵjԘ_f][s*0<{ P1_:d>wΙj)а?;i^V*P5 E79!B j bA#0$ K;20ɖ1D;ԲlđN(BީNUjꩣIjjHvRrb0'RItsk'K`$/,SE0`L k8_:l0\Ji<6<6BŻBEC6E ]Px)G2-.Mۑv:R}ʩ:\e'L4QY1ko$[5fm>-`_h@EJj͒,: (.:bq=$O 4q7][\XE^^7RUL R܋ wK [`#xb͊'Bun *?lCVo5FcQ^9e %Βm^LNCkB=ߔ7N&8ʖ_[{$͚OPoN؎xvk?T3l 5 Z5!7Nh qiBѣʹLΨ᪮Kv᝜b ^[T}ߞ4C"W/Һmn4%j|p- nkR<=$ MC₝I~KՌr]=3t~TA?LXժJS?N9TܤZt HJhmʇȼ~ZgZv1̡q |`<(Հt˄p )Ē N %}Zw/r?`;)iF2Lg;%H/qs7`(,5H`KYJr%i;1L wdHț%ŭˈg"sNrD2^F[t$Hv^&nt: dtp"ܛnM)KBbyW@Fy*:Ȕ-s J( oÈ|߶B6^0 `׊?OSEtL 1BPr9AffuTre6K"}X4.Bbn@jR0+0x yM։ |r0a[ҷ1IAhVȊv'T 8uh)^X,@#DhSՈFͳF 0Vœ|2Jt{7-tI|/>HuLLNLF%PGa4S8#HTVu}-s +3缜wm5ٝN`)+T^>q؂*P=* 4:bS$p[ɲ,I;,;̄@HzҸ~-N W{b*JIF3d'GJLa (VdA8=- V>3nPdc/:C@ M$f[R췄wkRnsжx`ʧ:c4p;owC7n9_hmR@u)i<nΈejxܐJIV (2ٿv*$E+˓Ř)Nb0ٔxKe8.xBM9+mP9b8&MIfPT׋zSn'}[9R;w?t5\ IWoSML.mi?l}D`eOkLo)B3ZС;(*zU=;agRpީEbe0!L)/lk-M&ݲBhGTkyg]N$,ߗX).ʇܒK[]/lӝ)H8Tg[ ҷ,@v3r>:k*bUI3y0@*ڋ{7ar@8!@#=y/ѱ8Iݸ[=ea8rk⽚K0k*03,)YJ I "C0d:iV'K i 0;\g9+tS*2*i?d?El&\DG,, H( 9@ ;rDN;O<_ ;Q*)M2C MEMB\eLX&냈aEeQk ј]P@9˩QՙEhŋMц#Ѹ sշzfXf#^eI,Z<7mR"DŚ,ťF% s4ӿ.; #\1¬ mZ[X9m1J L A *X-+T0hV7QVlÎTԸ-]᳣Bݿ쐞3R!ٱqRLy_mY,ien#TUtR*irZ%@Ѧ&:l0ژn\Uk%ʔԩ%)-.=twX4ׄS$*COf )FB>$`J߇`\)  u4>]v|_̢EaV\a2BypYKH[JR=P5+c=VEնK_\ڇ<#\R=Eߵ7!]׍]0 ˽(]]̽1WµSσJ#\D4(& \-9ӎ`=7uV5]]d՝BLKu-;m凰yJ%Ֆ41 [TM@5 &V"eE),`ճuV=_nn6߿cTm#165 FX =S簲,{J`.[R 2iT*GՒaHv [Q6($q[ PctQ;ksfP(yPy H>e9 Va=;cE-! W67@fҏBs " 2&d;Δ{V\i9]\ 4ZcXڴvɲ c&ᙆkg YKݯ5mnw5 ǀ}cX3ب?-L4"d7llgC0̶7]7ŠN ֽTS D[* i)9'҆> F߆q:Ft'4ޔdl2i  ]kvjnf]fo6cofhyNˆ1gQW9=D|6t$:[>R'Ҧ&h̶pX:'Hh 6ݒ5׍qPuqai7iqi.a:i]^rvn\=`HN@巏H^!KIJ=[`c\dA?F$:MJ.FeO7iv. lqQG@6PDhf N6~NeJYZG]mȈNUݝ-V1xJ՚+Tu֦ގ.vKgT(N1jt!6wow6/xeoowf&` 9bT?x4][69q܎us6zrѳi_ok# 5K#eJn .4V6(KX'snX 爈ݕwkraw޽7ۻ{4m׭8ī8ShX8 /*H}t|eM _C"uJ JMyu|{y6l\qmNxiu6]Xm-/{D|w۪Ogܿ_^I_N~`u#@ZnO/v5cn>/RL6{"~|w7_~|` @"paƒ$M PV3 BTŽMzTXreG-9|)3&͙6l2FChI$K7'ӥH.Mz%Q Bg =w~ ֧XNLZAb՚5čb 䆄YU0a"C X%)7Rcʒ#*,(pҤ fLGӮ >{Ѣ;7oEp(l7׭2eEZ.]8 fIb'=3y~|Ŵ'dO~쵯=$hiHy{߬G[mFi"_*8{fDQ8aD9ig%Q9dҙ"4ahS*KOѨ3(PDA`hFX;IVDN*|zSwY7~YVxbeVه&dcYҘfbnf 1Xo]{ؠ (ڒ~2f藆)"yݕH4x6WV.^8Rrm]%W_䅁$^Zrى*E20d5;ghr+G 2sA2y,Be~Xkl:ש%Zг=ϷR[|bɻ>MKq IбYyqpIh-gx8߽ O#S::Tu5OMOC;!dce`1m_N"`SH מNA j"ү:ȚV9c t>4w@7_nGQC/~;s}uU1.;ydwR-38GJA.%(n]u.p+s9 ahVF%B׺5{X.i ^eJ@\a]j.2"3jg0X':VSkt9Ӣ 8/3&,!63-mjLtR-p)w7;JK&󣛼G(9΂zaR }Mrl#HΕMwhCg|Ntä>Tc!tR᯦h {t֩InZÜpD9`j=/9=UhȌRUB-u\9X}R0uk _gN9);';Nv`! 9; ^/u퍟|R='72=!C#M1%&BMRZ-"GMEɰu0:^!uYDZ=I$Z4`QGSc⬚ ZiIyz,a6(!eM$U5έQl$⨿-rG<.WC&79$!!FFՑ|K*JRҪ & Lp|SHNXg>֨d^);Ht!8WTx[|0/?ej?dy#bQ j4a^Y&q+#nVR+s9.)9ҍD@s]$`?ﺵU.y &]&mC-6| .dM5%LIC.GJaj`5Sp3uzڝB^ͮѣrlu;E0rm-#羵NRM*W9fKn s*Jנ3HGYAǘ”͢Fl`XĒɋ%a|JRlSasUi70q;[beׄѢ%Ɩ o$T[9?0}Խ+g*"*A7%/_32.W^u MBza0~)Oǝ5*%x n\yV:m*zFTox|!ޜpQR#^ HP|U:ޤn4b;=b#'9op R|׀*؍%7GV,NLtwͤ^>2Yr=jsMzlUg[v@373gd`3w,'=m]RƒKA..q~Eg%uڢHN^Z|Su p{SݘXS;>ujuLmZzbpx ,l/ku4& tG^J{@_=so4}0m{/鄝QtT7L@Wkx7mUgZ킓xsGL8(7/;YCY}qa`Kͫ]h JQ`D\\_ D9Ĝy"eY4]G B`oRp1ܵ)Pߩ̳0) %ŦHMœݨ]RA)WY6 }jan_ 8=iǵJ^ʬӰ^UIɜL5Aꁠ\ȼ^moA$6] 8{]yMҷ U_ JrQ_Uր_, S\ "VbUXM\qlU]ɖ p{ "o IEvGmc ϡcUPP"i acqcou c5%]FGQ%JN]؈ x! ^+د  55";)+SH\dI~$dd^$3bE5dżZW$ ![m{%FIZx7E# mJai#i!"["SҲ@O"%e?䆵v^XUUIbpե, [`le S^- u WJmZF d>c? ^aeN2#qayP Hf)ɔ`drAK};=IdAJ!EEf9UaMfz O{d4F4^e)e.pGA2"`ʦIu ('^ jK4[#j^ h G(R%)hx6ɁnO0 eFRXv^FR6_IJ䄐dHUU%^p_"aOᘋgւjpX܍fmg RjZbjjrjz꧂jꨒjꩢjꪲjjjjjk k"k*2k:BkJRkZbkjrkz뷂k븒k빮j:+k:`*뻺k+kkk,lv*f*,:Bl+R,JlN^F,zlf쿎,Vlʚl˲lƾ,ȦȆ*ެά,,kmк,*>-Ҷ,ʎ:-b*ΪlnĆ-nl,,-ɖm.mRl",Zl2-ln,mώBmm-ۖ:n".κ-*l&n6nN-f-גnVj㊭ή2nZvnӚlRnJR/. oخmBmz"Ē/l.پ.vm^-J+֭خn*pF.n-ᆮ,pk0^vpp p p !!,@"7U!0U")U#$U#$U#$U$$U$$U&$UD$UG$UG$UG$UG$UG$UGGUGGUGGTHHTIITHHTGGTEEM??C::<--. !!####$%%-%@$F$G$H$I%N-\<eEgHcHRHHHHHHHGHGHGHGHFG@G?G>HMG _GGkGTkGTkGTkGTkHUkHUkHUkHUkIUcRWTbWKiVIkUHkUHkUHlTImOJoENt:R{2[2a|:fpJgoLklTklTklTklTkkTkkUllUllUmmXmm\|mZlVlUlUkUjU]UXU[U\URUMUJUNU]UxUUUUUUUUUUUTTTTTR>|6y2u6tEqTpunsllglfkhklklkjie[cWdSiToW|^acfjkklmþ̾Ը״״״մ޿ڲتتتتتتݪ٪تתԪƪٵششششش9H*T(Ꮖ:FBE!bܘc5 -)2ȓ SVd?h̹ϠC8%((ͺ4ꖯƆR۰s['?Pذᆡ]s+׃.:\=W^޽+YzԪك~WiW:_R~41a hthE6HqdTG(HSlRI."ӌB=vC$P]$Uk5FZݥXcWWh%HJE]d9Kuũ(َbihBlnF92m֚ҡJhCxnш#L$L}}s$^3ZpҴE{_j.qwKzRժVN"ũvp DJJXQlRlf[j]a .㘣L|XgcJ''b?PomLoJ$p$W~@1VWDžk]ԮU]_=YY")IqJVL%E`/Ǭ_ʛb|8߬9}3Chx@F 5kj* ([mJϵZo.rܩW;"U]7sqjw5ʭzڝ%g knb l]Nmh9D\[86K81EIy[ILḼf3/H\CY."]ӗL|~SbldO7atL 'JخM1 4uMYRei5fըH%DJ'#O -: PTќ~(嘥9`o>x0 dk߯>TΈ e) t %L1TVÇS c璘!83-X8ʑ"G^Hgyf#RSG ˎ*l`k8俀$=$V5Ó}"@'v&2=cIRsK)ϴ5&6Ѩr\ 2DwE'#w 6Cd#\}]xZ]-BI/})523(UJ)`͹>)*&R5lP@6i2̮)'f3(SNۇ}x*U"G- "cy 䵆5ՋsE*R$T|-3+Aj7"#G~}q/{Vd@Eh}78U8p'ý9?sdJ)9-qOWoֵjteYч d0|4'c!R}p6ě`SʃĨs"?zTW/Va.#tѭYو7BɲWL4w[4қ#=~**0x ,A >›~P(C Ҳr V2VksA3֚Ogn`P KoUj`\;ZD:ӕ%Z1?Jm'".ۦ7F'CBS+t.{9|qLf בV21iqv:i,ғWo9Jov6d|sVXHqթqfn\S \ÀgN9U'&3ok؀ܒ!8m8 a~In1 wj22p1wzdV/ѠkPu WZv 劺pvXkI:Hʚ+)b5I2bHcSꣁr?UYԢ,JTejة":!ȇ2^zC4ڤqOEU[k SvSbA5_}5]>7[#CۓϑGkՓ[ 83l$l={nҪPt4^Ңŧu[k `L!VC@>2ECS Fۣ {ثT9"cB7k6lM|mP FII0vPV,lAi&LRQ} c?:#~zwZ{# 97,d0kcq+}8] fj9g!\5_cj;/s $gH|b xDo+ak6Gp4&Ffju;#6N\78VZ =!Ųq /3 >MA^ݷl4_kab>jT45Bm$/jc##6`[`TLTiQ'F;'h(y@;}2Y)7oC˟`SPd~QeZfAqH|Mian{[I,$bC#Y{)O}*''uH6q[wZh-ɢyw]b4+b7G55'²->Uu5A 2 n<ӑT⚙G7\s+݃ [uFU`.0XJ{+^>ɕ4ύ"dI`đnIFKcAӍIeb$V5a۩Ap,s`jWe,:Ut(vY` PY~W]'})*DB~q#PtׁSE lXιΠS#~ڔΩכ2St. Obנs\\dp'y~t0) &k.7`/2*\a\AISgwu+-wY+?aV1v(y"6!a>5^{b7AUw^/D/kb >5m#6Cս8%|k@_F5#\*vᚶ&ˆR+ }g\9C+M\OK5ҥ+EC5O9p}gn](/_#Tƭ $\%C_xoskO+T.[^n8=w 0PgR)&=ӎcX/Wu? ^k$oC%029v?p V92 #z ' fGW9'!X D>tQA[*dHXCqH#$HHRJ-]3&I$OIANj'd}o2>i!?@6jgK2>R1k`ʓ;g|sB Tަ(eWaW-.(|"AԿI+?F/,证}Z&5.Э!0ı"ѶOQ ˿:ïJ(rQT֐1 2q؉[3BR@$kZblK:,* L$-H /\#HO8i NJG/% y/d@q.H Z&s(Tf7ѳ E[+4,ᨢ* ʴp{~79 T8[ILOR*?೽_~+әx,k']BY~(߮c<%P]GoPܭRB qťv1Qj.*s )Q2vJ#whzQ 4%Im|YɁeMo3Nϛ2̮HQ%!l%;흊G} }1eL;>%@zED2MF(ebXe8yPBE_we|EE@/\;}J͵ړ7Om9ϡBNB 8O<"2lZSP2(aͰVj0Tbc+~!NVP?0z,.؇Qa#` ɠ6z4X`̧@@7 䁑Ȝ/щ ZPbs~Q@P0ryzx Ϙ48?+YCJ싏kr2J:J0Jֹs{ sHk3*c;o{D75ޚ222wXEz7sk`w7ɒDt<+E4Cjs+p?Qygi  ވDIr+"w%H0Ɓ#9(L|cۙᚳI,@i`78N X_#i{eêr*B+4\?} Sq+907 WIxk۷ @ Dvs3[{& yB`@)m9hZ%|і7hDI G.țz7.O\`qK4˺L n˽2#o+EghLC>-i9TrR;`ȳ2,ȃiȈvb&I)|I4;D bO'zso;Ϫ8OtXIw ޘ 8٠?`QI;∷z |ɠH‚>ˍX )L υ ;AsB0[ PB$LV5pIPV' PxQ/J̷@N/d7㰠 )9;)|C̼n;n;0cKT|35 З8m9 PslL1@62e}(2Mkk%&?RȀxS:> [%)QEirҢ--i@%: 2U5e<{U A'87-TUPC-a;::VqSo@9O?hTȰ( -/= .@N+K5WAډB"p3PF[1dqX X #׏#""@H 8$Q+" (lL[5(ӮKӽ 40K0. h ?xAS'6VÂ' i>؋0B,{GLJ}]@O8_ͷ xL]2z lvF˩-S c eIKEr 9s dZ)AWVÉׯ`Q<P/ [@"Ɠ)k T*^u9(YzyW7& @. zR3TM_z^ŗhY}P|/L퉲!,a IUS4WF\eQYx{sWz,_P8X V AN-3E>=ξg ڮJ/v~XFv]A̽t26c,0EtՀѩQ #8.9=/@X! 7jhaFGr(dÉP %[ aiɢK'>&[m[c ;obڗMX&j›)-:VtMSX-hW^=Be;Wݶƥ{Ǟ$hba<=2vX3WJ]qԩ/OFs$EiItD Qn}xknik76؏ WtlȒ36rwܞ]'Tq,U;C0k `tFք>CRCPܰMX E{5w q^Yx!<ֆu8]^ ˉPn6Xu1ZU1'[D CTdxySB evu$b^bzTSPTk=7Z@ZG4ٜљPyOED,ƕmiyPMXPز^UTVJXԀةM'`Fjig5PVeҔUmkka%렊:;(n%SU ZWQ,%N% kQD؝{nD.^M㛘~M䥘fH$wOrWw$e'MJ~CJ `Lٕ-iգ,;zq4[T D"%$勑x,${ZِBnBbHPHװwmlni7ޓu^5Wwv{u[wm`XoCb8EjD|4[2GXQRdbiDm,`Z沩W ~,ywc4<3.xYvޟZDto;1h1^n:W&\ps=w#Qy<4 k; b6'I;,4³!YLZl^F[d 9h?J#Ҡ&n/.'NCxզ4$DLQiI"*ѦR⽐*-eZd|u MjmV ~HLCClGQ-8x;n;Ff [ڒEOfT&AY:lգN: UCu"^$6Ux I#CAnɑǻ% y3_cBȉGCj|} Lr5us)>kς2~ x>6] rɀ OvihZGiJ[0 LB(33@_GB%d(_TM EP@%zSWnfjk" ةFK/|˅¦("&hg5dS\=ńEfV MMNk0g,QYWYfbD3mWxX7FYrrEtȢl"Zr=fY 8yϓY5nvV'-eA$&H)2>7.n"c"'gOc-4_E94ӆ^1LI2FR!6:d!K<[_6% E- &,С,DIcx8iybcTq;GvwBڑg;RIfTiveLNʔC׆e,bYhsW[6x/uo@IŭX˨nu m嬜\'Jѐ~fц.prc2',Gϭwd>3BΫEhIFМ!uIU5/΢I9_.v6,'@CDgŭz|*=x˅ %?Kշ4)Y*h{(7er'9&`_4Z+ ZIQD.HBl\A T΄ɮlK^h-gPB7XU{4j3%{f/+o_'GRk/fL Fp9t=p2myi-E8a2Q ԋxiWUZi/TGO ,t_}ԗq>)U HRX WݥG E ɱz4^9^ K8Б ZPTMo X\Ax53D'՘E ZQTYUY"1þx=XUXe@`M AǰkMu_lz0_ܱ,ǹL Myml3qOTK RoHt\]I~PEЕ(G䋲$$uy}ZQIE͚F5aG ɕ5Gl! ;]D`Cȝ>E7x9G%E3!蟦`MMnDhJ4[B;BAmJZ[؞!@Hi I՚깡!9T̒rOН fhEjI"kY  V;\"]0H˄fX˕Kqa U"UǬIΙB <,Q$$ydE< Aح&Rه} T.D1`3W&OQQYZsIV6LäyTjd !g@J ; N,nqdf51 4GQs ' dl~Gbƌ֕愛Zu*1pGx- dI>0~IGVdoΧT8} zRD&% keEA/Hиf }%]"r9@@AoZ~]xpI I4a{$)qYUXRYZЏ'J5--RV?qha![Pd 0܄H }&%\EşʉPTR ơU>^7;rU;2nj1Y^ߵĐ)IL[ Dtc^M"K&0c暚[VdJ.Ud҉Jj&_hO\SbMFqLP`Ӥe& e'n=t1싻ZRIȉH~'u M]oDzc_2`2bSXc)<דcd*ӎ4*BO_- < /a̪/]z/Aa9ΖD*pN-NFfAPPd҈uB:ҢJE_C%xJ-T!Rj0E:֏ڪI^8el3lsI@qA&vMqm-,HOha4R̘P#z ɺNY9w Y/(X}{[vjqi9zC ޖƫWT=rc[ $A{ Eʲ-g[-- nDmZB.jVY`U7>Qcs5 G6[rfsrJZJ3 ilQQ9hó "Tu?AeTG=OBP94p7jW~Gẍ́RuA`<}7ʚ.JoȤYxX3%Nơg$qg$ 6Iq:;5E t1n83_LW)DXoyxz`dF-M6)e8]#8:r0hu8i,F VֶaQ{^bK AMDrL*t" 7Gfv p³#(2nKw[b*T4NX홅kecuJ?7?mAbmҏX'hDTwۋ)ҐQ J+-!ܼ CEj6;j4:3} EY,Q-wŒ 6Sѓӈj?ٌPckhOc@t-lw1'(`Dך왟NEO2D[-gH4IBs<{9 ħ !q٧ʄSOg#*L; k,[E(k.9RdI'Mr%Ȗ&u̖L2U̒C  A1MBE`H|Z(`CrNK66Sm U[4xmMM~%>**nXL%vTܺ+2iuZ`M]US6X̀ )OwARqOxaZw^^ B,( GK,C${"=26^Fw4ʦcN(M\e ؟Trą| 3X~oVT,^+4iMpIΧSjW9${2GY i":":t̪`ŞؿkM< :/WVq鏾Zxu[u͕GyISȖL.Wn}@2Ue&ұe-7>Z /F oRB,ȋ# %X0mp3x*kTV\ YN9P#"FlэctK`í1=E&Ѩ i wIC@vG]KD{ό~Gk1H Q⤚Myж؍+*4\U(T4jt4w{Mȡ\%E$)Eq`"d3DH˒Y5UNk G!No#X¶osPs٣'")A&PyUvujg]ycK(Rš Ӌ)P+!S[xC|Bǫ,r 8iILV҇M+ XR{|DuERmph@HH!,\/jK*ZÿԶִIQv )ZN.lg Qٹ9jRT6Ac"*/<8Txt/|Gso H쎡t 8gUÊho:rG=ѳ s(B|5zJOoҗ ,,!;6!?3K`^c|HH˂Z$&K:2៤C[s9}rxFB6@d'J,ռk҆OT"m#Hb-&X$z"nT/ .%߀0pSCnȁT6Jod"kL:#”D,L j 6Îp vޤ ɪ qڂ?P6Iha~Ae~4/ JR&0N/&4"^$X-tbskBdnR7(dJ\A,0%h"`N')x%E{JPȮkNg@e#z1ċb ME81 v1jquppe ,atMks5P+ZjzGf/ $͏en$jO.*( ;.kGfKLp&XF j"BŒOɔ,}e /'Hn'EܚD#}BR")ղhQbi#q̎mQRV ǐ/|*L\1ґea6B28(q..Qjjp޴ S3,P$E VObb!V͏/lA 2ҪfF粎$MS%)$l8m)ب6)''h+=)Ve)E>?Pk_)D0W/,$Tn%6ER-1),.S8/ے~c#Am69@.1i>Qz*~O,asZTbj#<'Fb"!6r?BOIi%_7` ,H'Hnf-9/DfHa\k'D)?r ҦN"0@="<(%,2R-ۂ2 -">vAݬ*1j.1O/c u tT1,2dvgÎ812+2iO}G35 ݔ@.F}$8FT4B-$#hH4MtDB8+(KT'Ar9\{52DxDH>(.4P@L3QjY)1FLDy/DQSo2Bg6s49T5nV .(Vd7 DSkYЈq ٔߘVU<+e@!t_ߴ~LwSI$T:N>*e?&XǹHAlV7[ʜlזJK4f`"MɞAV'lAi4o<)U4$bEtp@mZRp)tU,2IiVa2(Zc8Ͻ(uY1h[rE6MDd#-v[9D+H܁Q hS0Y2Тvhs .OyǸind;lLD$/CҶ#b&0p\&I[C#|%# 6t8uo~1޶J|eL0]~eB"cΪ@WqEv+v1bv.$wj`a.a=䯚aq4ng7K5_ 51w4BWGtvAw^BJrVGXbrd wCE,b-sZN)#l;{C"<W7%"{Ͼ/}lP Mր_|G]TCEDK9bBY3~Gnf6ko͉UgM  `M&o#.ʤM_i)#FֺbCz@Dwst 5g1,%0&,6b51򺨺,Ҋh;X(VD1ڍ#AyŠTdNR1NSe0w,{ $P[_R-"^RTY;;Y.mTX1x.RF(BƱ,dz cML CwV;S;S2֒9t#XxPe՛M`a# z1⌝:u=JMT2VO}v-cՙkU<إ7E]h{;.}]ZG!(jzľ6"` km757yc NSF+͂yi$|C*?ԄmPiկ-B;M\=y1z%hut |~]6١:IHMEhӋ^ kZԪŜ7+̣Pb?{wJ wyκǦE&>PV1p"Qj{3: ߼gy!̄>̳TSŃKI$FfY}+d%|5RϧJuߢ,J'΂5c2ÖCv1:qh/]yXǍ$w?o-֢mˋ)0nMX¸biug;2bT'f<5\cBq`[ĉ+Rh1#ƍY|v,՚-:pƕ*[|>w *8R(~\sVA(XR"F% NJj5욐jגM'B:w]s\aB;7/޽z70` 05 c 3g>|;͜Uk04UVf5lٱ_Zbۺ yQa``ҙwumԥktY)FQ(t|5g}L;Zi#p!hn7 Z H&!$anA[fPkaEM aSZ%qE$FǐqM3O>$YN%LHbZ6 NYBf(QN@i!N5rfri5N݉zf{'ZbK9ffef&"^eqeGݱq17٣1:o;"jqd_r܏fkYwkDV_lEC'z̢\U^|׉UZ W6"D sV o7H&ء[ ſ b*/B>yƘ7=)eGoQH>V@ "Bt u*CLYi%薷 9HzL!3 VFg4VJD%;_b hXouקt-|YFY2ãa|yyGvnja#tz.яIGm"&ܯy_iw9v]ur1ms[uz֫o:NI l5]?3N?+; u@ڟIߥ4 ;2KCNjx(qE'I ]u.m48(Q Gb:BT@FL%Uo_9Nȁkhǀp/4V(\ʉ`+а"25NH!N=w2ZZk@Tp=RԘ&Jm}9gD*-\"OҥȝrQ3KJY;5 D-}ZK#X.AD)1] WCkhPcj/ּ\b.K-RcVÐim.F!:S ɝcf245=`X;rEDOוX %%} l7MUY:Fс?¶,J{>X/q~WC‚x>ɂ*ZҎ;in{㴰OD+$!o鍒GgדXPŃL@-Z>RTroӔԍy[) &飯5+Z9&nf`[jl~ ,AWpJTHJ2ED4_ [jOAj p:EGJqE*[T*'sJfk}ld>Ռ nm' WJGMEz*rrq[B1oyӊ1TG:s&xR5imr 얍<-*5en хֵxXO;a JWnh n9(5$'#gKS0; 'ecCYTX:! Lo9]߂h.gm=ccfή 5M Oe1?wEq@KNūYE=̴a[EfRK67Y"H#=tC Y'ɟyzUZĪ܀Jd *Pհ:̱{OiK| qG0r44Ʌ"|wspS{m֝CuBJJ=$Zl`X&JkQ7V=ABYB˾6̵m]OcZb/GE3DdC6cw1$k kp q1wdr d3倓 X;%=$jHE0(f3_uѦq4kRLjZB8{hxa"YqM+C۱YkWtAhctW}6axam6dA6Ni3~#jjqc~%FQtqG6fu]& Bcvr$; falɤKpF>'12#"x7x1w3ӂOE&V>_Q=Fz'Jzbu]󃀆B%w+AgW(ا66<`Ӹ+Vio}D'jgbIHWa6l~vU/NT"l2ZdTfsHB!"Ir^64ؐǐS/&}fqX@H#TwEhv]2۔}a ,$3M68+hh}(t)(5P@懀(xxqi4$'v:%tc:Q2%٘Q|!)N&^p,%;QQ\G?Wzvzw~;9n#26`5w:sֆ{AASYWICPI{"Oiv;YSj_deŏYTHq)T 2n~mwpUbT:WGQP n/#TPHa )$I]QgF왓 y,U.)'r)4;Kԋ5vwGN1C6n8s5t'r?͗@"Sttk`=~8me:R+vD_jq B&q xwxhc<'yCpVnT&gDAI@E~"/; _p)mҢ䡚ij=bHX<] i5a֩hjhPőP_i$fȫ,idW(8;U5Y b~~hchl'Pm JH vg2>aqx%Dǁ絯q&oFeA,I.A8om  /YV.}7nvkixtBڝHIOxDzt|'!7-\u2JY%;"*<bjR&N[ U~AnY!Tp %RuuWeHph=l+@FHH{Vzz*zƺ"{~:ɘ͚JD؛)wO.OJpE~j_!:@ \7FjQ;8z筪l1۴\fJY{# ErBۨ5)k+{oꏯ_؋+Ǵ.pU\!~;ƢLke'ԚKsm;7x$Ao&lK4ΫL \k yE\'KTz!*4L<{¸h;<Jl7ɿqNG)4s$*+N";-̥z;EUGNĪ; hϲVè IhSSܛjv\Tܼ$wxSŊZ!.VOBi lmUŦ*%+ȸiˮ<1%Uي!ݵ;oȦ,\Rnn~m޻KEi{ !}k"`Ei@V-:zn:mS Ő}S+= mraB<Ku)ފ{,^CMOTBSѰ~CKKĶI'~o-9׻{b ]6ؤyh/h9t3YC.He-WL*~f̓;C㠤3h&YGx#D9==aAް:qKlWʣ]ܬ ^Ti_Cmw-nK0$y>Cw^|nw&s~"6~;[[ܞ5bkͩ3N9=\DX];K}~2)"ǣʲGss+?3C8%B鹎'5Ytݨ =(Zr&HvK7v}c#:]3ʠx2^aGyO쾁譝|{cpσ=,ޡlPܦO9Կ GDܙ #O/-P9C1P~YJHsѹm hbAڭx3ut3l]YZSҼh,hΙd]&!2{fj?j?y~>Ѯ_}L؛zۮM7 PH0c8I %2"D5JX5;^aɑKTK/eƤ9LMHO$zRGǎ5ֱOBu ժRla*U렭a=RFa:6dM9s 5`)%Ù>$s(I)[ c"O\y)oӳg>5c[=0ױ æ}5CYo?&Xqr<-яI4zJ_{VXG{wռ'yh*ϧ?}{AP 鐇 pA=J $Vi 1pC 0'2 +/"*E BR򪫱Kx/DZz,DFXDC\,9[:QD,Ӳ,I098+,322۬l42G44ߴSE<[\r3PBMOm87*C͐,)r:[h :8.;ÊSS55}18CTOZ#V9MÒ8J4+MܤoVGDvEc=@ / Tw#D0@A—F0CT7]vMVBbVžF0{,*Hv 2Ǫ UR8]s߽@)z["܌8#S0"yMvPxkf{qyO3(4_v$;~zR}>QL~>YMزA]n [ڔc-~'Y40H Bzi[$ +)1oVNR]$I=p [^"Cv}iSYik]!W _X!А ]j"%Dbn*ج7Y<]˄qdzJveOayg{m3ƻ Cc1Z)x}vp")JtfĮS_T8)XS輡&\ZIϵ~9,\L {zcz5Ubx!C5G*?pD-#lQcXz@=2>øUD?Xj8 ŲLӤ&+@<:1|?45<k1DҊk[CiKl?/2Z*)ۨ)X2ժ2*#v+\ !dA5b ^5N;GKY43dEs3)i?Z\Y8Gs6;6So!&H, h rEoA>%s7 4Iʼnr3/%(ACA6+<8 984d9Lʎó )-B6)B6"lwȀ0BDxS OI>ᘷG 5KtC{Â0;UD,{l1u!a}i1#A ه)<.,ӻ⋤XQtMDلPȁ+U,ȐK]TDŶH3 )L\?$X9o\HQ%`FeH\*7X\ LSiїA^)5Ð|z7\'MtI(A)7N+}AɟҞl 4)3 qIĸAJ4;2"O=0,G:C!1$?THDRKL4QQNkLH-HG{<}ļ]PԊX] ՎT++1&! [/wH @xJ AJ7t.ؤ>iY "-+26<$W̼8CN,8'.Qw啷h+00l@CFU FzӬl!Z"QY!)$Ѡg?tT=P$ Y!G:d S+K} P=$Q\>-YWME;<º,LʴѸHLhBKWD3m eRqcu;R#3DG oI* NuR|Qz'I—7˸.4S ,p֎(DK U"%dxPDTE'@5k}-U]]WZKe<&IMP4@YSŴUa_ѤS?"=B*d]ݻaKQVbPmf4iee&P}ˮscL-vaa ,02س!}E)AJ|׀Vm_}_P 6:{YGVd4UF.hvh$K.`ƕ}#QfɠQep; Љu& .ޤaOau eGnaI]h99cUbif橆fvb]lH-,;Ŷ1ga ^;DBKX1eT0еzaO-E3}^"Y`EDd0H!i29\SNmHV֖ R^T&hiJe<0a>m1/metTBe#֕K+ HY#f.bjnLjL ULIfk~mlFռgf{LV^gv5unǰųdŽoU>ʴI3`o̞>Fg~gW8 S©ENF辅 af?kkΖ &=m47 i]SimЋ4o~1UN6W;sLPVaࡶ>ؠ)8yn jj)=]jjl?;i:gѫo^k>t둨^"]?o}?xxnq&t YNߙb}(^opmntohP!a%ozUS\;יy^gqiJ~7d/KS ^9 Lϖ*j6TGF`7$ҋNsP4o7w n77Lz'kvbW$7ku+tӗ%3ޏ'6Su [=.2F{4e\qNb]ewԽz)}˸:pkWg?TsP{8:zGq3H P ,pB:l ^4 A#Ǎ5 )A@(IJX,[yH($,90gM6uiȠw]zuOO-gEI17Ƅ /J-RX,46">g9ҭSJCQdAB?iz뙺4dV cLXy1]J~2(  >aeWtbxZuem%AtHUEVRiœAHek7c>(]+Y2Sg$jѵU_=VM[VuwQUe|mg6Y ]ҁ&,F&`r%CWczie(ډ~cPH|5Tl [MJdoUJisNs% UV(|ZU{ $J&I8,T72lANAmN;-~n YMHzkn+_V*"b5U^ pcYHўajq&`Jug 'zr.0FJ ZۋrPrX4Gkaa37/J]5jdau_GXт,u`dz>mtq ­`B#۷n2)j(s[ܸSJdT^>Ln.yVM0yJ{W ( ƺmמwi{'쪍6,Nݖ7w<7xo{-9Tx8+JTzY{Ю]i7o?`M-s_PҞ X=Ao"%Z`Q֥ftEYpjۗ8/{,`"$J(*[sXH&10f&3Ѕ-!b2HMP-CͻT.@I0YCrÖ8+͊Dxp@A[ը2j0)R#%jG9hBk_ŹR0#QdSTJ*ˆg_ЦN3Li*Ryd>DBAb.#bpeg\%C}a4! -I'cA_R(:ms f>=4IJ醨E+7 ZM2U9kY;M+D'Ⱦh}\%esS#(WV ~eio"0LwMPMS)u)tve V e ɍEzj)ordyFnݴ-@Knuvlr~3,<|ʹ{g.wZ;-9wґ:ի.ĸהpK?:bo@`Ntl#xIծ*{k]zxgk^Ric".[fVh`ɜX1I =)01WBRiC{;¸+-T2w3Go7缽]\e?Lw,}*ЏOsWpޥvh{?xcOIH&ǜa-_R00]P65obݶ\`mYA`Z^Y-q9N[x@m amިOѓ۴e] umF]!aSA__=!T0}=^Ӳ=S5сˀazȈRq^~ߠή^š͡"ݻ@HW`ΞqZrx54Y`5I}\p9 ^&Z1\'Jڡ]("%$e^5QSD2q=*DT~\!F$`22"Ѕ-` ^ꙛ4&Zy49"U!aZ `quҬ`AouEb 䄜]= ` jb'Fx7v*#z]D|WѢE!![)QSۀmE(ޱ@ՙ!cdIY+jڔ1EއMdQB nU*߾%r4Q"!T>%=|y ce!UY%e enՓ%<"M)K:`-ҔruِtI߆7 'UFc*c3""iO6^_E#Ql&}fYPq a8FrUtI4fmF-‘Z'E(@>]Z2n-p*CejT#5UQLNp` UEGȭg)fL1K*Յd¨aQUGZ=`CTm]bz bQ%R,e&r,GT:~[UM0Xr":Fy"':p~eAh%hZ\OՅ9F^ۏbF՟qT\d)I%&={D},\~K bf$S"TKژ Qze@[c\Fm&5OJ(qfM<'DHX+Ȱh(qP@)kF{4m!sr͹5)nvz`1ṸEvQeujb·A3.K+Kz^,X in V]&KG@빢k뺲kkkkkl l"l*2l:BlJRlZbljrlzǂlȊȒlɚɢlʪʲl˺lll8,8mm6Қ@&JNо+ޫ֮^΂-Ԋ6Ϛϒ*mіmԦmѮm֭ݞmN--Ϋn&...BJ.."Nmnrnކ-₮.rm϶.-b->6.F.nf.vmbj-zm&붭6.Ҋ6*/2,njr-ݞo~單o˲-b/oڮӮ.ڬB6pR/~.r.- no /jn0 0o~&o/nقv-._o:m1[0 ǬS/Z-^o kñqqqr !!,@lGTkGTkGTkGTiHTJITHHTHGTHGTHGTGGTFFQCCH@CG?CH=DL7FQ4GT8GT>GTCGTGGTGCTG3TG%TG$TG$TG$TG$TG$TG$TG$TF%RA(J<)F-+A*)F''L$$T$$T$$T$$T$$T##T##T<   ""% #%$$'$B$G$H$H$K'[9iElIkJSIHHHHHHGHEHDHEHFHHKIV LgJo>HlOHlTHkTIkTMkUXjVeiWkkUkkUkkUkkUkkUkkUkkUlkUpgU]UVUSUQUPUWU^UhUkUkUkUlUlUoUUUTTTTTTTTTTTTTTTTTTTTTL?4|.y,u-r3rFq_o}xkxfqfmjnkokmkkgkkih[gUiYja|fgfgjklmxøηյ״״״״״ԸªϪ׬ְֳ֯׫تتتتتڪݪ۪۷絵Ǵִ״״׵H*Thᔆ:&jqD ׈ $ɑ%S\2,aƌ#Ǖ/(a&i&Dt8FNeFTME %"mKMm8O8XhI%2|hZ^5֓f+AV\`)Z[Ypɭ蘏dcl*⛜?t cFџ=0k¶[z"DcnFz WQftr\rJ|Gy]j9gyhSއE{1Q|֖f&livz>K!&@I?4& bU6h&&V잙'n 1T/J$#KJɔ]Xa1Iem%znE,IW4WɗTP%ȑ0('2Gi|)3fn/5OB!nehzkk!(KV裏DqeyP0Y$||hnrn?͝}]J兒_.9klJF;G8f>4 .t3eBdDbO.Q" 'HL pb 0-/]VIm&9t["#~t `#W?:ח,ad=ϝ |gzRvfG6 R SqȨMEIl,GAPJUw2)1KR pAZ>U5!<8jqCX@\P׵-Jsh Is6t^Zb S 3bJ)t;PxD8Aa4;)9Bү`DyYLF'R;2!Bz)' "äK/YGH1w6%"jE C6B>mo"66ȡf(T,L׼&Nd. čEf2@nTI5q+7ǩW. Mt5TZS NL>$g17\،} RKI-1*eHG&uܰ8+uK;IӸ<شl|X#,%ZQ@04Ť&AONoGiDPmǫv;3EFCȇCsQfH$ CTa_Csc`m7qCbX4S ,L`0}Ng-4&8}:뜠sd׌>g;␙Ϟ(D9Ư b?=}*k;ur3D$ iHHPR*{r^EO%5'EHaz+S7&RaFLoH^i7l<sK&f;fm*UVMEu 2 +[ʸٔeq̒4a|n Xr<>mx MO]sT"Vnh,ckXlbo Kjw م\Z;D$:NV+Day'?3No^m bb '25/b&x.(~90>G(#rcF"VpMcZsr{+F_dxCSE|a-)%`H3fy3 A4$l(R81n4ad&ˢވl؜m2æ7xz'^/UVMf唠mNwP2~߭ ֶTzAb>t6pV|E65hDGME[ڞS^qceH=yHlO4NG>=ZJxMi(Bb8B:JK_q}w%A)DnFJIBʫBhOt %&S2O쪲y >N19U#zU,AE m9k%>̃;b0v y=3` [gN!t&ׂ⣷ D$FuOD^ph\(TCd9Yț'} z :_jnj*0#x?LUeU&PwsLVeiqurroyxG@}QtaBw,H5f"DC1Grć{k T=62 Uk_a<#UjF(S;H;a%>c1æіUINUw Fmٖ?V>i1 hbbEStX+{{4o&V[|.Rr  qo5fffwh*' WT$uq7fH+q2w_nL[{~UBG=ih\".skYأ I;y18$i0nW=wTgu)*I]^(ĂE6\lű-ؠ!b#i7DY`C `S7ZH%J 6V a)J2Jw2 "m裪H<z<x W7A$*F:tG]G`W^z%xDris25$\S7׍YEH:-?8>CL&-rvj2`E@h9ڣib<\D(]dz:A1<$;&-[8AypgH*_wι P| d@z=J[XM]Ei'h& >svGѪv(Zk_,R b3Sz k 9j{P3F6FtDCy8y:KG5TWT&2]}s+*R'{n~4Pv˧)ދ{?N\xb0AǑ\AI6[@5AuF[Ph\C!Pzd"*qP%6ש)P;'SEO䝜 ˜Nj'Zlh;AFv&S |/T=>y C­r) @L<11|e7|@ %ūiͫ f#x)XA5[Lx#&b$03hx U{ >- )$ؤ̴9LJ; KCI}k ` @O pL6aP16]7њ9d*C]cCʨȬWNƜ5:rs\Ռ'@pQrf,%Rz*'|[/(› ^9h6za@B2 a)ZgJZ_7qv1b4x,HtJիvލ23VAAL3WF(Sdc^4VW)*ef?K^zW}HK!4`*DZ8eNte+7V(=|NḿCbd)^s%o =85zɬs9rmCQs[48l/:H:V%!IK˦aU/Ѷ@C|$GTfyFcچI6*7jug?//T#Ş;v$?3SQEXVy%XRFPQ|%+^ Ca p}qp;mN!BaN4@=D,D~Rb~} T _qPDOBU|HLc0'tCWwI_ѠUW=(%kZt4gjдI-)ii.^pEI,3ilx 0p)2Nqriő2h7a'ں1|F)_H>2F.8u2grn5RQL7Bc4J#F &V9tJM^PPG?75$G4ɲi!}ODDP'8>XEU~b (m_IUP-"No=)en˵霾L04*vpby/j>N][#^$O"avFZY2A5k)BvQr,̆\[SŲ51"5J*՗v4/'|j"ey P+XA -R Ň>*24Ňy~`HrH&^\2$̌טhReK2c0%H,[~ h(ȟ2EQ Ɏ5jçpf  WĈbˎEK-.|^M+1.ƽAn `… >,@4!dʄANl3fz$P͚Ms6PNlٸm0Tn< h"QoVDXo)C={L— #q$|ixk^E|/iө0kO=[n  !0*j -hK0Ws9\n3Æd!qi`1x)E! I)X8xm'#K>Phж5R|+*2L6HÊSJcDC5,s88)z0\πb(r;5)BA,-632\<ΠfEiH¬dK.Ē!؄aMM ا[  B䍻|[T5Ʋ!SfSFCJ/|3H!⊧XD[<HC6J%x TAd 勏R?Ok8 Fw\0KĪЌQ3 =e{U6WJA ,B!,AVF}F dym G]6Gڤ}cvt5# O& eƥ5\ZCp<2PR7Jh^]Iw-صĒ,aC b. +GBiE.#!\yEDg*ЈװQFćR.).b1^ -5EQIa =#=Ha&!#4 !D9Dfj̦Qme˝R$J9(P1dؠ'՝b@Qses#`` ~iO5# [ 0f6h3__ ^.mrSS$7۸P(5~F8,@@oJ+QbLrҔ(ttd8-]f%̋[#Y3w$ښٌ;f2C>NЋ({[Y ӓ`zT1vaiC "4y0h1x}xM>]|I,oഥPjЙ%Ԥ9%35h.,VG%k:r; ΓCD8#}m lHe 9ᨻ[Đ2r7PE L=%XBH`'-7}u\l0s1B3F1 [>"?˫OkC˃<ϧMs2JtUp{xtQVlh$s;.9IAZHtmaFVI$Dp}L A ck0{ȲMHNBnMR8Tsts ^.7dلУQ|'xۄ|< A8ibȇ! 888Mc pX' ! (ZQDZa~6 Xؑp0Rl"J哪^pMAere>_FĐ 'RـfG4e5H(!(bؐ(QˆbD?MP<Bm:1[1 2"0Jc_t9$ Z,hBL I VY1*yx%BSL}iTF0cӼ$HګLҳƽEU3>H[)ﳊ'QNG>][P(q)Uk5P{ j<j ݌ebĹ ntLMSS 55^R6pNl[5=l**U[G/P/W9-a*/ݨø{6G_A ҟY҉P[ȃ`#.:71 Hf.+  ÌJ1٢3Mm+ oR}IlW􆱼Zt据ݛ๠=iVӍ]9KNjX*vvn*bNU!l!J!/-P" P^&8>o܏ #'a4vVFh?j癡Pdj~⑰;:f$FpAkք"F\kpeT+y*N PypyTl fl(f0e:uҧpJm'ѤC*"Ԋ Rj AQ'4|BN,kD9y-O[n]{ <+b3^1ljTβ>EÁ 2h\5fheN7صB}X6ނ\:āeW.mށR~Z㚦)1m:@1sD?y2hjwߒ#C M$1dX`DA6°~P`v5]!N4|yJhyd) I7"tm=NVVm a8UI]=1g|PI;[;=GymT8UB.EF=$Mvoy^p$` =PHQ0$.#QWY&Q kNXC@[5)Ih9B:c `d5KPSNgYDSɬYY>&IεpTKw- ^:2$X^[,h4/y|֡eq2 r$T`͓%jHd267Wyf,P|#C01WdOH%\A᦭q^ԓĦQl.:q$8d (ZRR7YS*8%#"( e+<:s4-)BձdԬ O6)EH/!&DȒJ26;+̊KVfn&Cnq[Z_S.T+,BZWw2rD5^0ŘweW&"z6l۞ԇ 1]?IT(mJ 9:{J6=Hʴw#3aC35(eB)Y GV՞*D9vm/ \}WDǣHJ)qfou:ӉlEW-B-G\Jj@e4&S/xsz_A2Wk{`Ct*57>!O;6|vHrCvD2ʱWԸ6՜ZyOOלb$(Vd%٦\(q J W9YEx9TXe(JWtJH|ۨS|FB.NyDiFSċ&ULRPE .ESt|:DLLU_%!Z5NyHwѕ9\uўID`ДItѡ|uK0=CqF 9oXZ9m ѬWǻDj]˒Ԍ~pW=P8Gu$KyT'Z̀^1ZǙ[\E/ K /M*LPYb]ڵ_KL5RwqM`Gܵ"؞ޒ8*-t IEԎHl.aو l{ AvۊU!M x: DxkԠDFP>bd\ ҺY(&pi2U)؟@CtFCP^~EHP@]8`jUFKOᣈu C dPePEeݤI>N5JVbq[}_/ZHm`a ;YHMħEf4:ڇ Y &~ *E}pKee,iIe6 [lÌ$[= 6=Le&!L dA*:9HB FŮ9#H} I"zJڡyD۸` s[**RJC.4DKG@ȇNFjKˢΔ=L9ǨL)ep%gj'*Q %Xp|dAlp`LK`8#tm!MBY` m cNW 5bݼPCfp$0WxwZcfGJt % ɄDJ5Ď[ i9eof#~O`Ed2Mqd%DZ9tq Ӓ@wv[o'qEg^Q͏>ٽ綐e8Q1) TLL:dSKԊEXcY )g &v_9|+mGh0^Fu؛٨l}_)/ŢF `׏3&/굁F,XL EXͽzoHwL[J,Ǻ^dJ `Ic=A'Zǧ jΩNĦwMMZ`XbR_盖& i]M}^QQYzmfZ(CoLOo!q] `?iLląOڡz ~N.v5ٚ+ $AΡX5 LЫb=^f)WmD 6^[ jV)P,aWS*> .QKIԭ .J J䔔``,(nGEcޠζ/u>+=$yP*Q*>]tF8GelX(PZ8V-.Ɯԙ%L1]MI-Ff!Ql" GǛ'{-_4˚!k@nR5 vZ+P&fzk" ~pNLFOnf2ND%4dVbEcmlpbK[N},'fWjfSؚ#ӈ`lRN$S6mOH;lfCjW`*'oojYr*ScT*NPD8p .Ў2Ҟ ^#-oĨC5S4~T0 y ͰnT0#]TZ,YJg~k<s_j^E)XKBN&35lH03_)N+ .~t. Fxr6nl F,M+LӀ^/aQFpd4RwfQINCJuBVDF|',Eĭ(I NIeJ Wj\&57U"8l>r(Ű/cCDfv%,G||eszcvu=˳g/T(ТuIEa5-/ZD+ڬF ֖¢k, }#DHbRgׁzu "{[|'$q~}Oh*us: "l(s U/*)އpdJ7*P\e1{ؐJFFBfw9izw&[ЦCKkL{ii਍v'.c#NО#EX z]g+d3B/OEQglSOdXO498^66- 2A@[e-ڸ߸8>W E{Q{fg2DZ-:B6zU;߯I 6P&N|:l->ߵ,s4H G~|йplnambhchW}R_]WdI7'G̶/s4@8 4h0!ÄaE1",(Ѐ{>~ dȒ'MDp^RS6O&|&q+|)uQM]:u3'XCjWezNL\Te[oI+56mԺw _}ԛ/a9HXqcƈTlee.ťL?k9hiҧFZ֯U6놲7zI2oK )$9'"獙yfJon<Ϛ/8E٬3w& ذ;.%< cѧo>x T{#Nr:fciUweC3t] W:36ijY-Vb(>H~vӛnwu~wUJ0H.b:[!)ҮM2i@9KX`I4Sacg toqJri-I!hNS"NAOHɱFc!_ѱ6Tp2~uMRNTS\( 7 »r"%aP*$(ږ䢎,K`ڥt>w3gq-ckzvENH9юzL y]щ)Ȳ'YYs슮ŧs˼'J ,PϔnP-y`èQ_u=WX@B5,˘ݬLm$͇g G_Xh c-]q*P3ED`W\K>8i8xRP|CVZe56\~_RW~webhگ\ԠV=CqG)eqf.N` :kZ:{аȧ0'yFCJۮy+roX$d=Ɩ:%Jqe!10GLbB[满yǛ&qjtZRVZIJ֮<ϗwg?.sÆGJ,K} 곍F!jr#*t'ȇD@֊pA~z8xĨ{ 8HZL@lQ=(HmqH]\wddM-2U ;F9G5bKXzlUėOHf,fFhUǬ7n7dQM]0r ^Mv`p2o3,q3Õ44,p\L@X֏3LЈä -F%P|ZԊ?rF;ىMhdLr)*dfY:~NHLl QP\+/~JR0l@PϋL"B-hj ٜjΨ L(4 @3܄5cԯ6&w.c\R$-x-.w̙t˚9blNu2M`+g <d 3`L>ψn4O1ʐ&W8"S4flH**v.MCH%RME>piw o9DNH.G $RQCly0,pa'JH-(@,rh i, GGP_" 4&ZD)_TIO JD8N)F >•`)\ o%g/r$`^a4bqBJ#d-gq M|c ")'K.fd-+iqʦQAj)}Q*M">Rb͚HnrȃOi8Egj ,o])5f&{FX|p9&$_M"ڭ7ZMlwVow" ̄ G" #'p@0?>× YN w#v/?3 ~LT4b&Cz(NX.?Vt⠜"m4WÏ/ÖQ 8EbR8S.A'Wb.A-$ʺ+oB"%aLC=!N"Q(]/F8i$'4r gVc.OCrAo"6 H6"CTi4r$dod^gƌt8DM~oQ)+!!Q ?""y&+\0{pS/q-j&|8Uΐj9`hT/$kĊx"-ZŊʰ-Ґr*U)/>o+ ln^!M^096Y@r-$Q`4B;2#crB 1Q %ECC&aL paĈ58 qqt7B)NK<$˜ 1nIkHm( Hzp>(#9N0: ^Eq:5 hPqnvKF $N3l`*"hf n-z{bBC""b[zhmd*&.X/޵?˨ R:(6 2\AgIc3 36gie3FT=qoiO4'de@a3| $b8EUFKiLGȒ*Ty.W4tζ,\cQߑA_Su7peelt&IWpm6.!^mL'L0;AΌ;S"06$҉rV*QB"C7PB&$ LrsH9PXǿM(q7YxKʒ|F+!g89^PL (r7gOZug?gP2Fz48Dm8^WۺX/0ZR1G#SYXKnXs'd"`$x<"\[6g' @' eMqUS ՉI< waVWR!h&QhŁ4ZJ~l%&Uu!m[n憋md1eS^V'6LL3zWcXm)gnKUwD۴pO}lM;1vxllItF-yG &"j!6d5H1E8LeUKtxYwoMh@RXnVTq $u$'&X.=C (CDi^gcԹ62u|Eɏb$Dt|/r_e_!XY=3&鐑pb m㝇,։ o7mZt]08&p6Z`Up05vpd`cQxX" R$hfuSB+!4#^ 8Ih2U!&5,DJ+yŚDPI=K!GZSWeWUHZ)X)E!~yH[ʜy#=%L~A0W4!>؃M i^jiqm|dJ6tN|nEFo=}z&.M)^:|2\FږF!Mif}=꧖f#uib⋄)#ּ/UoB&[rȀPsprbnd&H *u!I5f(VVUW: 92H,р 3Atj0yљ]$v.M'6xb"(%c6)RK5KՒIV[˭nw5hF͠@yEQNKͮަwVm; ĺFbgvW-t~i|N;pXSZcvRe&J>22mF1È.1ڻ{І+e4$xGnW;Cby2tlU \yѦ. 9ŒSM'8_0-5d% ԡ5(DZY訪Q jGw b8xf3JT3n4b4ERJⲱakv!.в# S3n%eҖVpALהAP^pѨ+6P~kBCJDP@+% 7SH&$H;I$1b-X9 J䣓H;z,bA܌FjH/z܉|WƂ^EŤ gq+V)͉d>' ڧUC0SC mVdBl%Z =Y޲\޴gƒAk2w6̝lG<: DStZ udYN-Kb=iH10K#a+Oz*4v/, RA20]E7!IZ= +F34%Y"*32 (m#ͨ<1H ZǤ=;EL1(Q&*`urDMeSkMDTejd$2$Sb>UM#! Po&2t[8 &"R6neg)|SrTHvR$;ըTB0& '.kJ\DȭB9*JF2G54u4JȲ @%ck.1။"neXz5ޑu5n[G~~T7<2G9F#` C 㻐7w0~բዤ⧉Urf&s../L)w懮IpΕԇl&H^ՋLX$<5FDVsD/T_oqݤmjY?i?U;Ymf]]76.p`Nte֎ʢLOф~Fm2]*-k;WIJ1 fg;PWblSģtkE]]y|UE9zUJ-;M{Gׂ{x|~3iver!Wq6ar*NZfEOt$OYp~R.RTu]7"i"W~qQ(`ubwQT*ahmW#|H2hAlS x7c]%MZbT(!{F0EA.W0Dhb`N2wWi"#46Rrq,Ubi)CgHXkɘ[HXw.*f}[8}heOz"(~hlۘl%҆Xt!#.n}Ww7s]'f[eG.(FHG}H}8C qV( )h%MeiqwyVS`cW{9 r=!,2d286!d8˴ݑi.Ipq1*DaRbdX8OmuS(O j8kO 3GdjwIQI(t%wXQZv?*c#lP`Yr.K/ D|ÈpN:P.<87hYw^N~cB9wxɘ{ib`$;ӈPH~ـ.6Fn֏tu?sJJ㌷nE$;'HЎ&ZwxY`trdy^1&(y o2.E^$wg(e)BلLȄhEgل*'_К2r;yYj7B$(`8m剈Vh[KyTt!t&*8ʦE6vtZ{Aa)E)0_)EH<:2#3hyGy94QZRčTI5*jHDZ4{IUà5,xp*M5)})}{0rckS9h*h!C:#:^tvjr NEggi֨Xzk6FiYDpqzUkjMHSgkaBΩU~EyĬu9p\ɕuʐBzؠyzUPP.ךPY:y#'XZN~oJo kHjtQȗ; 8y< uj:EL {}bHð[7MzKC (qDL:IJLm>؇/U@<َf}M3ڲlM ˃ʈyfI\ xtlۂJ S\FA-> nmm;q]h}|ȝД.Â*ŌC"OݝPK.z[ >4~i2ڎ!mW]ɳ>ӍXZ wv]WOq9  <}й~kbT4UܝKQAnE7뛐%&Cg'<56_WʞWZ1;>}ed$RpbIڱ)Q0Q'zjkE*T>\7 >ث ]sy 'n4Cs&Iuo  2H?$&B>LAf (@8"9R`IGLr$]dY$͛6WsC-ZhP8ҩH'ޔZU6ڕ+Ckp⃫Y\iņW`p);Wܻtv7_K-ao͒}UV.ƟLׄJlK:N͊R8ڬZдӧ fm[N={m֫;Cu ϫ<2 J+go>] ΗOw\*5ҳ3Ň'{@/˃7O^oqQ^e> ?ynDA"'&1" yR >#4" )ɚ\I'\JI)P.H,,X2.JC/ 1.N,㣱Ȃ0&>(k앴0,`s3,24utѓj6P6Ե:*0ʪ>Yr7-\7IcuUVRVKunXÅVZ5ѬXlB4=KB`a%\tU׀sF-ȡVm$Hb*"-' DM*d4RY(8V&#Ty4ߺ.<L.i.4vW4oa¹1?jѤzDž!NJ[/B,*NYCP*W76:u9<1ktY]'%/QFǨ,dTg< 2z^OwE2'>֕<bH8eP7pEL83%+*aW T5"a:"&{Lt>ĥ꣎h@ H&}RjTqNU4Lke"uPNeьb^$nvځB1RDTgF+6Sˆmٰe+e:NkB }}cfP STdH.S*yw`?TEБEa•b"%Uڳtu*zƘW Bt/ު.6k+`,|We0KNR:WmMov3Q9!|4fym^buNVtܺ V|LJ \hCe;/(Hԭ ۉ!,fBhleᡛ`YhRǪ|LƢקVޞug&IQ*ޣnqWjUO3x3tf%JE4y3ZM*YMjT$. jj|v1հ6 Rz( lٴ˙ݛy o\1=m-h\RDVT>w[xu4i!Hv7$´(5^VKecH@z!x#@S$ujVT+d8j@JZz$_ui5ݱ,U1T1"!bZ"p[2ߴՋދ-cҪa'WVoim]Hm3^p.w$3sӟӪsӐq* 'pܒ7z#! >s @.0bH @bjS8=; : H7wùz;99J@I—[B=*Amyc1:E:B|f>:,i,f2ɍ"b ҊwCrS1wyӶ9<ú32);;skDYDr"2$.CS\ŭ )y Jз05/a<03sS=$9aɌK7Tq˙&ԴG+G;;׊`D +jFi[?u!B0C&J2]T|BȹҕTl3-ȶCH,Ĥ{r*ϴAbVpM$á "sωrM ֛ژ,' 꼘Od}W}TuVփ5i .e (PFd"SÊ{\2I ?&yQO}IAK٩TcW:3>@$x՗ \Y-L-謹-DS*RI,7{ & [SĤ؞p3&@%1ks>,RTBM,O,Z=1X}uINm`;˗, RvsȰĚYҽ{8Y%pP<K8FpE%\2TSe[\̡\̣UBOBdD}]b{̕  [lCؑCSLly%욙2oイ%z$_RDQY%\֧׊Q5`xߊH-%1߭~ cBsL1ʙ6SГ=KKPk᩵wyL*$Z%Z'f\R<ۊ݉ f_+U$5]+G1=2&?Ec{$uE1_?m\ !<WȻ]Ǝ*I29,r/`65PR'v) Rlk䑬iKls,&M0 NZ V֤=ڵݳT}k@5Vv9RSGN9mb[%Q`3 05ތUT|_>ָ=rȔ:mɱ7*%Vî)qv20e)Hnm`ĵlM&Jw-I$Xuai"edf>iC\i]V=C p8[Pf8aeQb?#6iՐiTmL硹,+k9L&0BNz̪-1>svNk56cBB3DI"8N h/r˺?֕/Rӑv{Q}ccǕhd->h<FfNf=p.].D*u$cr/C0QeW`~mKQ.d=O^CJ.jBnnl0LFnV_S9&֪EVmx$u^kc<Re_2i{F1:pgt4hvǭ"*npTpep'o>E>q^>6*D iK^fCJTݜN,`"Un3"fMr*j+^.F_g0>PoplK.qҁD2c^4A-pn@pDžրn&^t,y88qsծV L爮p%#zTmWn%LRk6B 䮮9$)uu\o9,cLFs-'}R9`zơkՙ#j޶vʇkZt+ݹv횷.޾z\O5ۗ*cL;"Cʑ-#eڸ1?gdӧʔK,B5ծ[~-ةg=1|}pŶq *tF[㧐1_ ]|C˓'o(0){z߯  FZ^w)AuQ)}JߤT=($لImK?kOүJTT)^bH%.F`Q_wezvٔUʮk^z{D&[x\U ?̰qȜra|,w&U ySzV剞œ<ͨ, e tR-~T*uO;5Fq3cWsU ޒmük|YDkQ"7#d sBIKgu/hYQ΃u Ivݵuj%B;0@@vLȫ5AF7=~kzIdM"id\<70>B t!TPF9cq G@b5q *1 R_~VԵ82RgML$SIW<&17ŧwqGI&Cv3ݢ?1 ;P=^zuZ}hr TP[<=x3sjyޱ3bs ( uNq:~BZ.~pKhar"E0H(#™ WqM) /Jz?Zix<'ÏU Cߜ"΋IRf+3idKzؗ ADzhYX^,10Rcl4q`]aV\]hP ŝ)ZAӨ[O] mSU anTo 4i]Z]%sA!->jyYԝiL^M_,w=ʎ|LYT !A-ʁ^vX9꥞ ʞmj U#&]Y$*GQA%_YE`]ɠ"[ \ )\(r"bI/~"}%UNK zGHH_1PK7y'GЋDh ޗ5\<~ &\E&S쩠J- ]aݼyE]DY4VӹVaG&". pݝ3m$Ij$[0A=X Jc1^Ȉ26OŬAdKa|Ű:;>"R)"3R%dVLfe(IZ*eBQHyKM[,[iXY6b%"2叠Dl"1"d:fc&N@D!W֤4z^_Y 6.)^Qwee ;fL* ;J[p'"%#^Щ]-rn%=݀ͥUKڐ9l7MQѽD j NTm\col|dKH^枌D D YAZH]5"gU"& T A$\Pbm-`aQOFSeF4fFE0V^U.:M8D̨VXj i i"i*2i:BiJRiZbijriz闂i阒i院i隲iiiiij j"j*2j:BjJR*å)Cvr iz** p*jFz֪vVꮮj*fjfj**벊*FJ맒^jk+6>6k*>))fk&ʪJ+kR+֫V+lꭢj*꼦.,ꪺ&++櫹B,*FĪ*zk kV찎ZlŦ,*,,ʪ+Ďj,kNfk͖>, +Ҭ&2^,"lvæmf* Z-bώ>,mm« n.-6m,؞mѦ.-Ҭ,r-V޺-*+N܆2kʪ.¬Vn>.zڬk:m̒mm*f,:2oJRoZbojrozi@!!,@      $#%$$&$0$D$G$G$G$H$I&N/\@gHiHbHPHJHHHHHHHHGHGHGHGHGEGBGAH@J>H187,.C''L$$T$$T$$T$$T$$T$$T&$TF$TG$TG$TG$TG$TG$TG$TG$TF+PD1KB7H?>G;CH6EL.FQ*GT,GU3IU8MU?VUE^TFdTGhTGjTGkTGjTGgTHYTILTHITGHTGHTGGTGGTGGTGGTGGTGGTHGTHGTHGTkGTkGTkGTkGTkGTkGTkHUkHUkHUkHUkHUkHUkHUlHUnHUpHUtHUvHUHUHUHUHUHUHUJUPUJVJ\QmZdjkkkkkkkkklllnloknklikkjgad\bZe[hbnlnro{uo[oBp4q.l/j8joMklTkkUkkUkkUkkUkkUkkUulUlUlUlTlTlTyTTTTTTTTTUV[mȹյ״״״״ֶռϷԵ֮תתתتتتڪڪ׸״״״ҴH*T!X: ĈjhcP Irɒ"C4J-_tqʘfʩ͛%(Œ ŧBm.`T2jYXZث[a5 H$~mj֢LgüE5zhS/Ƈ?^ah̹ϠCxq FŢǖiSg̛c;ߡh 5\U7~#730V`Ǐ_ť ᚅ &ȱr9S+E_̬ k-X(u V``&8  68F8 Db1څA@D&ᅖ!Si(dRJ"n/XO270=&Rq,)jXT%W^yVzc%}#\T'WI6 5QPmeiihJ᚛%:p nu'{'ўפy12hrpf)lVgj]B^wix|ߙޡve׭f %loxc zYf{ ,D&蘰+ma42 xHg'rA$.Oa[(ݻhr5ėW#1bUYriy=uU]x8l`~G\a6.,󇙬hD#.! $ EQ~ӂ6i/pGLCmRؐD{,z01+wuuw1^q W}J)X-"xWNb؀;/p*#4u"X:..kz$+JHp/nR{#UmYYcUKҔWk:FBpiэK[k۟9YlfD tQڟ}Ԟ*T~ym`5([w5⼤S:06ȨW= S TΝ'*pKcذ)`$R'WdJI(l}A@>N/?}uB ?<<$'9 ajْ3`MLw~sJѬt-[J0'`G<5鐅,,"[x;P"JHF11ڬ29W|H3lq g$Ⱦ–)>O>9R2#Θ %=Ę]]2qÒCeK:i#h`\ML&iU+%@O96:,%#/śDX;`Š-)NYb…6ͤc/gtHPY5-VBC@cR׫O BYtB %n.i@f2?(@ٵ.HanyMISέ@$`PJT a/$l8ʑB0l~dXEjJR`LD>7^WUZKύ0KЅ2/F#=|`EXk?4:yCd:yriz#5RoF .Lb -x:U A~՛,z!%DyĊm;S;M6y~gXH;TĜ4 %>26f_*J6YdiEp("D@b#bpǓ*^F)SzaRLq S:CJ1K;$` Mڰt1dغQ,?5ᩰǪ& [uZj( Y=$լ;5LE/ûqO{Pζaxu[@?[V_+;rs#[ڪn%AKx!p?JSx9+,4)6xeKCuVJ+on)-yDjeG1+ hs[!Q/GegfgOfCg>At : Ȕ+ %+H?aA ITn$[wV.Lu``qI1iYni&juu]S^~?:Un))^ŬVTraa"JJzHrDJ%"G5;=t ]UT6/aRF{>6((,H?AGu'uo@=6"}z(NHqKou@pp*GsDfdq@H#TfCfFNF4u%txyxCTMX!j6Jr d58|&tG\op!p  2<ƗQ6pvzRB~ 1*DvPБS Yh'0Cueu W=W7< fƔ`+5(Y`[pflWzax>Q 8Jc%Gj?1"Hszuz\ňÆ*S2A({"r!\$c.2. -/Ȁb k$*M\o8U5D:Sz z`eSx}icI22Q1rEP|תDt[HjgM)9h 8"LL_J)) s!ӛeTCHҦ&-%`?z=?UA]cz$oP_'%jFȊSꃧwlGz! @h4F'k|ʠk"L+nS܉+-Pt KLUsCۦR% }dM.!iOXmobWw&oгD+dS[GHQube0@5Tܳȏ 9\tDqtt幸)tOC!EX+*˞d:.:;(eIJtoH@)҉G 7E1A):ǬieFj+/TI΀ *,1gDz+ 5$I&".1@RW ȱ"_h ^DCKq;:#C4d^&O`8PT4ZK"Ď8un?LXf; e1΋668aRvNU5P$3 P7sȲÂg [ǒ0#]i3omEYzrI5֣"V,כaѾH="kDnkWTAW=fZNS  8M5=H~-ysfQI#]@eMaE_s[@"S%&$^ PYL4ԦDz4,A? Q"%|W7mz]b; $A6w ' qǬBN4gUʙk#.5aؿqa7jj6:<А|kVCfjǀ^~\8)\L-5F1:L3PW'WMi.ȁ:2MU>FO6RJSxWcX(d$Z-t5WJbG`ҕ kKZQߗZF*sR.i\--~Mb`٥^|-fuZo=]ȁ}D%Jn^W8@RwD1ڨw)XFQ*#1K >n~pxdt-#<) lϴmGGm$ o'v;[Kx jyyrƪQ͟gRDbeWD^7Mf^ǃϚ>Fn)q"->{z V0"T?Y%ߓ_d䗾X];@Qy% "$o@bΡ1+F$'NC5C+٬uflej,HOx{jB|UtڅHQYlo0x.|?6\؊T=NIͿ\'Ѯ/!0ٚ)rx%2lQco/KIwGerMl/A2R%BF=05Ob$NFn:/)c}!UA@,JYkPC\UQcF7ٱg*(A(SL5m޼YA(QZ N5zCTi˄M}bQ!0gT]źHA<>(>~%EZ +) UBMpw-XٱI2T4^ uz0ST5aT <8TYN'vlYn stX,= @ Ž`@VNbpB-c{5ޢb=&e/`6  T9oCg5ʕ<>^D^C/xr/ zl!*>Bi. J( (K(p7HAh +@(=lv$@Y+~Nr+ b@$W9 u1e2h _ڔwժpy;g205($R%eHQH<qC!BN`S i 5le(zWd8,gYzzXTSR1#FVz8iyGKa,a:QB% k"QS1ɘZ26 22X*NqSDWԿh25^(LQaU@2ʼnִ8D)0Tky@SZ~I0¡(. ɦX|4gزN9=ӌZΘܓ&=.^AMî8iIª-p#n鶗.ΨkL`wgKpgȞBQ8mm[=i$t~ī ¦ v5{F멺qFRpUTgzyshB#Q $q?mbvbcd'GD=G7oK5d6Lf5frN  ڐ|Fa6`F3eI[C0aQ /@4D^Ɍ}.tN.#S q:tȀPIx<P ̈́ **D ج.{l7 K:1{ $8$p<ŖhyK7i#kʪ7t:[Pp:.z(B $Hُ;*yMdq8|ct6!Q~h"CJ3ë6zЋK^1d#@C8D3?00INXuGq58\>\QvkE G, hpl Gy cA°ȓɄq XZmA@q a M;(]-> F < u@ xOpN)Wu|=OQH[d@K%ZQx"홉%R#9<6dUD2գHT@19ӒN¼(c:QCgpғH)JgݒY8U;FP%.?+G ђDL76) K C8]X`.xD칈cCL_\2" қH:W[2f۝KL1ҼX Ǟ0ͬRŝG6bS zY8E9ڱy_N]PЁYRx"4 43Rq $1q\>Y݉'T&6o UW3_I{?FZ.͝4VPd 5أڐU+0+LܬѬ yX+3بߌ J}Ű<ʡ' :Rd*ѤY :J+6$1ו`*Y#٫8]x$ / y`>}~`$#һk2cb$.ۑ(/Cn[P荳[x9ٝ,B⬁U8 X@N(AJN ބ\C$۵VvHZƢHOi\dY0 .p0G5섮y Ů7@r( ryRIu.K)IjJ5WÕag: m>LG\MXWь\нqI -c;Aw)+rZPu2bŢ+.9s Ĉ޶'QEJ6 mJfݢ۳~2$/ykˢҔ"蚦zqNdFSIi]n\enhMؑJ2Me}zctl Vϕl^(`e&/ƠP'9Ԫ#c#Hi ZP ~KB*fW\ )W  z(ߧ0ͧkEh 6J bXY;M?z~,"{ghȉ39͡R*黳Xt&CSJmM2r2 fpB̙ |(^N?MuAsohC=fB !/0K(^O5٪qq|97RǽuMtɈz 0\e6pD*#`k&hމ[Yڳ ѧY݁l$=tMᨈH+GS#:$ɆLYHm>0aYTL j-E"faDIán5۪ު-{0(m7Y }df&Om I7XLl;K۔rsYE2`O/"?D?6EH{y F1,?gӰHV}q.ԭY1zzg}=kykohzxxc 'fՋxfVRgkKWBEY]\Խ5(NW}q[aև,:PX & YBMNŌ2s9g$>:I`=s6p!̘ Q6$(:wTLE>< ⬈T3&͆ޠ|eÜJN<&YE|H5C`N|tզ %n]̖Jz:3aхOB)݂QMqδY#ƥdtKc+4D'׭)RM5c7ƒN0opXa FR5;gl&o~5/CyKʭrQw: ~\F%S26YU6u6 Jt1e!VU`$PWu(MO֐١iBZWi9D[WG-RUu1&b)ӡh'e ,&479i+aC5ꠊzZCe4Uxnq"*GCsJҽ$i\;S{-UDEB41l){JV(\)\R(PP$QĿx!)buqR뉷 ,cүKDZ|1{tLD/Z I.A(+=tQVƓW t8q R&kr03"nx/3{WrarlQH#fv\ + Ôf%`:V(}H(yO(+M9$CdK~3ݠp?2#H"Z]&]:"ʀjB2"⯲Fs<ċ$(3D1thҝ&gS(:jr(dfTS+KRTdqX:}OW1J&!yyf*`pbz6=UBf[PoϹ2fr5UHůtwGb')S<r愶fY3SL%+PIғm;ffU<+RRM*:k#~69a`k"J6]stԤMF[x e HॴEѓt2}Od$HXVyFDkƈyh]ߴ<3t\kPƎ=fsڶ{/ntʠ7^)'W:.uG GH)&ɛ: Λx.B *ɯ&٪aWDh|v2K A,]&Z~[tX ,+ !99a!Û<2<i&"qKK cӬ%%MBcao7ܝpG9 xX_uM\ `Dl(ٟzXh摛!B Zӵ V) MȄG8^ !DO&ܺH@ǽ9(_uә̐܏DMXF "I\Cp G @ēE%-ސkN3.R aֵDɭBoGduIyJ][]Q~MXWlTۼ 9]uEZ`ˬP ˍHmm*  xXt :^FDg!їv`Ef FVl͙! M! RT$9dtЮZ^v!lZu$s[e!" ﬏K$1 ,5Et8ڲ3 ~SXmSP qKt@l"0]I%J4>iU,֢__mƭ8҄(KNT5CP,EExmYtqԈL\g:BnD,_Xp.Y5Xo8C\%SToQ`ؑ \<T;F< -ZB?ZL\  g:CTWWp#za}MY6[ ~`"-U\bʊYa axWRŁБ(QT^PvH4FsFQ\(EWPGnjwzndF~xdMjYOX SVsYn 4ƈ¤p`| pԽaʓEӐ )L)+uh^ǀSR[8AHB_gŒ,"9KAk9^̅eVhS7EšK6>FcJ`*fԦfWIJkH Ub)F@QTrlڅ|^hpƟ@-T8vB[HQmE.mHiUvN-_z$yia@IZ0W\jGHh9M6eYD"૽ڳ؆FI.X,钾GYQD.̙J,&Z9E ]Ճ tdE<( 2"Hkb (_-r]:S$9JTitѕNDO:^P8iZU[m^R9f2wKŸ>MRw )aKŀ} 02_l NLBbvbF6p iFW,C P00!@8 ݐ}Q`!TPVopF#3ͨ(ji6hl]͂E*AE‡X mLꩣ%-oF*0vJ/Sbmxx^]`J;z-3 I `/ p 'c@*:]1 ^L,45`uM_RIF$9G8qt@hEp |Ո\*|3[BID38 䔓8ߚB?4CqFq֫:Lnj^' VȺmH.Kq!a0!_Irq7TamaK1"oF(yu(ru(2[gEeG=`zul202\"Hj|oW,{4!*ױ7N0B\REExH(t,ڑa*[\LD( t5Ea#4{,G^ fGmGy:m.C[ys:VRUq]AE5I9s?lpLGiNpzR7{5ƲP-߶KGbܑ'|(oKiXQVoN̑B71FaڙOlE6Ҥg^N^반$JttPv;O8 ;z5p7Ŗmc* y jFS"*yQ#}OE֌8]*&5RgpJ}8J!g E(% Fу-H49Âϫ~ڷNEE8-D‹zk/rUu[1**':f:3skyv*b+5IsUQJ Rյ\s*bqͫ06dkYiI;3\f(-\?OKwsot=u{rw+mkP 0(`{)낞Ltގ/af#'+*z2KZq.M0:Db[飆'uP(Bfi`2# Ꮢn&MIUҔt%)iP&+ZChGP.p9[{abvm/_< u\S^mb۵5 #NM|ѝb+8Q]r[h$ )'ӌ,p ṫl3ܗ`];S}YKX%eQ#i+*1dF8(-Vir\]NTf6BT XS276+ӟZ(B<.^fˀU44H3ьC3m"he%M(M15pR?P!ÜhLE9;EbA.-b(3,$v\#ǐ3`rz(A_M Z *r0!xEFE*j*cu$PY+c3~©q!DRZ26)H(E=S(K#;jZXH5uѣe]z.>Jid s0Yee^-_xM \P訴 /q<Y/Dӧz vhęlJ2Mqk[cKE:Ѣ*z:%x3L 2xA+M^B9-4hT6)'Y.Ҭnސv]SҎ7KtCjVtQ{vngy0apŠB>'#|*0vts+mԩZ'Z ?> ]FUh!YʹsĤ`GI,Vq͵d;MyϹӝ%Vt0I 0ǟ Rdy EV%af4K̠$JP*jQ#hv,$uY<%{Z_5$qҐB"-H#Ұx zkWnm 8뙥s/]V4C׌MحzVXydZO7]D8_ SHV*ԽR[U>_2*EЭ<0/mT4D:Sl1ڬj3p:a"cI&0 0@9ZlZD Rt kPDJ &71-g ᒱ.RcΗR $@uހ|)E.oWپ df2`M_ ~n.4VN22,XMjSNAj$ zNf*9ld C<\;) ZBe;Ta)S:S9.#4xqu| -s[=+M #Or?1D"f!$ "`qtY)B;aeI#Z' 'J)ϬOD!&!lRn ~ᶂL+%71A,Q\XRPt4JI]0,-p+N:o-!ʑ2f"KZ;&6la!t8BLM'4/:CFȪOR2{NA?u Ja0hT@mCpa|IG@EB3XJH)Le a''1Aa424Cl2w1 b MTAo*hM4:4}3Q +L B",A $q$G[%N; FT:Q5SM#!x!l6B3b.N&̢#Ppa8j^C$. >˵\I@r -kQI?ur٥(B̡ahoDB$H^ 7i"H<\r6hSETvi#"P eqPШ0Ldm( $IHTof,%QOR`ptHQd(m%B+l3f`c_mai:>t`!:jS?2E&r|leVtOr ,C/ D$udRG}Svc4(f-&M&fo3Uxv80V%G7n[[dc6\/n38*s6ag"Pr2p#7IiXr c$Ubb)6'8Gł3uu"rq+D~Efob+R|񋙖i9Nj)^Bx#%0a"4hsDYdHb_"0u_jWB4[uR:ˍtt44o) 41r^'%0˭`L'7kKH"UH3Hy:aK%yh٨&GYVIQmRX)4Rqv*x\KKp`wCa_99 Xflؕ"XKkCP-k9y3hV{O|].||$H#9|Ðx֒v#$ʉ쀅D =rHyXtI yU)>5f =Z 7۸z;W@Ofl-J4 OxO%5esIa;c1K+a=kZnYp8I5fS"Jp[" &&A!B4(6DuӬhlF b{BS-m6M&ı;D53:1:Q0_!v[yv,M̢VtL;aՀKo02 4lWMi+T"D Uo¨RRpG0f]PRr2?kvP7MN ! r)~[N{䳜h_)8 d'a0iˊ'Qb{׋/yE֏0"ydwBX5IZ>ʆ$)JerG`Mi)VP<1qT.ې<+UXb+[0ygkkz-u-.r[b%w,SuH+lW,LsT#b<[oVzi:~h2, TF,D 4Ԓԙ[X#>lPB8ћ~عu1x+ӋwKI0DE&1.I=)h-Q.[zT) sVR"/BC>}!<+Rs"Bƒ1cؓ(Eĕ{܂YIٹ`_4!xK8Z:p6Yxcrާcy+< !sD#\~+o~;^=YυXn":|zf w9b:H^IiwQ .1gF/cRKg^c -k}oRe^J*#UQ E2mKݒ|I紝(fA:Dx7]浲p +ׯbɚ-ڴl׺mp,p-KnKU]p&G8Σa`0VGU ڣD {4@sξ[LΰE`dx:ч N p>n\"PPfPr b9|849?o>Ҳa(=ƌ[⁳֗- s(* ! bCQTQ JF<VRIT.lTGW}E!EtYԏI%4 g!.Ou5;JqRF/M}$-u:iQUhUUSeԙgBn\6aF^{zbg|eBwa[dxev&^Z.XU 3bE(:Zb&M';epPZ&qJvڣnm\bUwJWXEauN7U!zz:{Y4] \eunx2k9I~R*S|+-b`MR dE<6\S٠R[]^m/Al6mG|GD!|=;L/mT$EvrJsoQnx&fJ1^yy -l\8 LzzZŪ^IL(Zu>bn݄Be3 >x u*p s= =C7YKssʟ;:сʁ73vM[STwߜFډQ;+78Eb 'l9)E'.6а U=&GsPI7EfMdImoa!'A}rOc!JDIiqLo/$jѻx)MQ&y›qo deM3yQ>?yGTsҦ7-͉'7f+M+WU9%QrP 5V1mBt,&›љPgu:Bo7.40)u:b>݀ r1qCc̅ F63N:lO&7 | 8$'S[d WFMlp2m!)RJ{@!fci6LZy#GKvQG+Js\bI$N=v%"2S#TӨ,(%}S}`RY gZ'Iq$-fUbd(G ɓVX͊"KkIkeIQ5/ ΰZ{PĄ TRU\AMKEVST0G0{^N{?dp,RwzI0BlqOTouDsz\C0r~(R1M4 y dM7^D;-,=;}KaZ%L("nPZƍLhGlaLmHJ(V _soMKꌧ-3y@D+2uf|Lܘ3E\m;1jr~ATYVd+"^[PO1k]('a7Kj |Qrb35BIӯ( f6A?w>vLF\^zwsJ(E&K$_-z:\ޣ^u][tػ9Yyzѣ5`c66KUliT;GPʱ2f7p06y"D{=&}CKihV]54pDTH\3JKnxAUƏ%G+ X<݌h$;1BZ}EkA^[%q~E)D5_s>AspWGvwX\{zoJ3\8 UlXr x/{Pf&GMm}z6U䲟3{I0/(K(tʫu}eoŒ'{NQf KdVnB[W*y (%NIX"HKDm{}R/EԈϭx{}F͡exnIF\&fVoBc6C‡K0^nftq]]f('x,2&'A${XTd-zsB5,Hrqqu'>rh ~t3wG4`M8t;wy Ht-}V[PVmt~G:&WuEs1D2b(Δ*rxw$dV/VւWcHG3?[`>KaZZȄHcUCx7Ayo$W~4*zf/EAbpWHzvHzW$zUTu,qi'Lf*K5.vZG7We݇XIIg&[wn}W4/'"(u"%T%QmXQy==ц&BcrgEYV3$ (fTsdo^6%IzCxK$xwb7!C/Tyov!a6,Yes*e'qS%D(yf K8spUs&sϘ8sA'ZHxZS<%}RRTwP|H`0#_^UH*Ei%OHO-PfK'OEQ|Cg'։exq8@I(k>|#h(#t1 -x{tƃI#芤7qh(i5[$ԤHxZJȄ;ƌO|H+uyRsnQ1%ٛXQD7R#k(du(1 t=`nsw('.6K7}{DI \iI8Ł4Jroa 3|7(Xp "z!ǒ>aC(途yCEI`JߴXqڴeZ(t?:V:륗QZ؜eEIyX D Vw Wv(b1?vFfHr&6yi,ţ49-a)aDDko V14J8˘: tKNyZDZ)/\NS:۰FMQC'{A:}WM1eODB&zd_<k~iɈ*}s:(:E2+ԭ }J[g!L +)8,0Yb8aKk.:/۪&;*ʷ̸ ˹lUZCRhx*I5+汝Z#2;G6Ukvu=j0+ẀLkh^q;5e3Z횑浙KCʂ;gxo;jvGsKQXhզHKǽ˲[ӹxRN1rQІdӊt) |d Қ%< _(x-Nʧ@קZx`-j)9{ZT0Hoyی F { h4duYq[GLV;>rkIS yMʇlFI!&"Ňy}[Dgwٞ}1[iwTp 9)zJ1_` ÓܣUA]VX-;ae뻈Y}3&T,ll׌ZݳЙ$ *$}Ӆ"ꌴ߄׃+b8Ӌ]q*Q-iR7pok\x}]"]^{\A16471 /Ҧ;2}BD_ k<|q ?mW5c1rۋbbLsuQ~#ᒘMV `S%{y 1cu E`{wlMRٟK!J[shf**Қm=l=<Ġ-T$ēz˹LĜH"d^.\'MSAG> v+y꽋s2vD@Q~Q2䏮!*`^V]ІXN%ݔܖ\u^ 86ɈȺC$8\K+|qq7B陳%~$&dPJZ'i,ɍULL?Z? 5%ZB^=uqّ2D1U ÅB5\,"CU CaF!; ɒ(?42DĤ)͙3uФϜ2(Ho&.}#LD|zԪʫGC5ȵW'cV {)Qiծe4Fcm[WT!.,8﬿vVذcZ,o_U 42d9IRgxAc WXhPp^}6Փ-4wg}{8oǏ _ysϥG^|oˆ={E3 ^L./vK_ΎY!ȠJ袈"Hp-BO,к ;|(L3ԔCBK|ET)&EZ ϻ")ڊ8!$ܢ$xtGzQD*W(H5+r(ӆqL0$s4D3Ɉ$%Lj,oܑ0c̫G0erM(Xkj eBtqL# ذP]VęI v"10GC9u[oc*Ho]1۔+?K- BTMɂ +H!Ԙb2=CAU6T*8΀#V3iSj;@=RV^U~nhYpc 31$.\y̕W7R>圌jlҾhj6[mFvkIju+ qZ^&;4ʬ]jFCn2G3gX;7+$=s& 2s] 1%bx%N5D^c#1QtvB_|{.WP@ؖ8gL8Ge 'b)94z?U휎Qaa lk:Bh5,bĒ_#=D#p[ PʀF=q~z3B" (W#QV.<$Ψʾ"oCT /ހINUwܥAe/ d`QY<4>cdǔFe cܤG.K\@cJM 3 l$\ `Rk8#:4GB[?Pz~d^EpGp%rxMSB,`jlq6X-=ւYw7?UVGTa88j2#P}351 (,+۽J{L\s6Htd! a cI&4+vw²Va[wшw{Qn$]jE tX5GIf?Έ\c?3I3S"ͮG BfIBI?KNSjU)XKmnPM֬ N G?pԃg˰eyd-k_[?b>d0LHe)Vd~1m e1V}!l%iJǘUHhIA6+6NLɭFjԍ:<(PR"(Nӱ0Ns0kt`l\c6d)UQ;9*-y Ֆ[o&%Mh]HTs7tFml}'4G$Qu6\5]v#g ;Swn*VիdrYOz=&)]X2Eszt{.)s7_iŞaJ'P6.*|U0mgD+(g5ժbՔ5a已iiT_03m9cl^`S[a`Daf5O^SGI5 ~S}6荊>NQZV˜8yѠ r+3;琻jyx3髑ڶ=2;Z $7$13"02AB< =-/cid334>i@yy-$I, > AGr4,!j5KÝ:J<Hh?JZQH|C Qz*@7\I77k <0aV:)>ʫΈ@v+>@+k)! l6ħ`1oA:JË{/9b:$Ĝ8ੑ᷻ɀI0J?+8!áI% ,Ё>:VL4ACJ'Ȭ;ʭ3c9/ZCfakp@0CL I:>贮Y`PKDD|Θ5L];/[#NK$NæV\ ?E\[D+cDCI3'GSqpجHR \,k Ø"2™ ( lGNrL.\+Lx$ɉ%>" ؓ:L-҃,4ܜ,:,rbR;XH$.:L_Nk5A C}Zd 2RLϦϸ @iɻ+6ҔCPkQKӬܪ .J;Q۳PIAXu L%*Cҡ;ՉJ$ER(J^uGdBMi-C $1*9M$C02:s-9 EğbjBWI WM|MN'L&t5zQ\أ4 TV:mj JA&6sC TQ!h ٴን.ș Ճ,|jW<Ym<њšBU#%ڃkG!VJ"r զV-ڕjc)Mw;봊hprTL6gJ#?7!+խ:%$B@%] >) B2ԋ@;X?pRA[QДReA+*- 5 P]]'*b 0]UnӉ܁|mL;U_ItҼ^^iՁ+ޚ1:pة:Д( ("_Y[-=y|5E@WJJO-XXXO%XdZ1XLTOtOOJ+ XXE+ pASEޤPҨޅ'Ѽ Y,b. I Z_ަ-c-X!=_hHI3:Cic.fGY@2_! ՕQAJG G,\sY`iZ,]RR>]SfDEЅE /E1aYYZ@ӵ=TOIHd>ZfUvM U2JUMfv^\d@r0úsFgRe_gg]:Zm69$] ݡxeQG G;B؈ZFZ-rz$S VL~]Nv[n=q XeXJ^őᔮbakD ;ӛ?$ڙ].bΠ:M ;3<-YP$Z/N3ե~cyZe{)wc}c>Qc}Uѭ1l!p}. gP Y3\dIhEF6$ +ѾX`V@.!e\ӭdmd&df~egQ lEZhn=%3|=tT h]8BvL_knZ2k{NmkVo&nn6nr+cϟ Dhvp͚(k p`+:h\NT iOʛEY6NqW-fX,aw ?iu_=}hDNkۉ6o$jk0MMDHfUfkfo0:k2OF=.HF]ނW Bq9l:llLJ dGJI inmHؾtfqqiqnmnqhoC#94'cv\c[տ.$uѭ0/v|/gvVTvTmsE7hhZB39^6-,' EڥcWl{sN 'gȝ1_mtmi5fOY3  nP#/I"Sb&8{r,GG-CZxv4f-T-27Ȅyny_}_Gњv^KxDx`EHs܈`ÖP.T%h*\u]F'{Fe틅RxamNx'f'(. g[7_y ougSCs6uFyvw_yaG&Ο\{?ԧovOSzcm j,zG.kloozpu'ɏ+}N*g zoa7'qO?{ɦع9kOsrT aFя+%/|1|P ֐PCB BT(aC3Q G>4 I,$L*4(˝XT-fhVP4 JTo\͊uЧ^ZuVfˢiYz,Xv2WV| _dMWŎ{,iݺ={Y恚?w Pg;95ϭ9W=tvSe㦪;T)w%ԁ|9̧3)=:^_RtQSПWU,yyFL^j5$G$b5Z= d'Rc.ny`ki ZgVOY6b&ʙ#dqDXtz ޠz5uXbVN"9IE^D1>Z* F"zGj}JXwzJOj9]#,"gi9ƨLh8F6IjKHzTrif6f &[f)ot9[T[9A)WK|UNGq8cSQDԁqs2+ ʪ`\Blp|'!e8U*Rӕvb5MFHru_O5٣S M[4T[myBwlo4$tUlS8JNcZY> utVj6zrNr~|G׌̶z+'KlkK#p{bY^g=WﱓX=џw殾k_?k\8 <7 h 刷!tz ;okoT+!PeLpdfDS }P;[![]fhß7 P^%5.li̍ py{d3W^Υ%I L.:͝7/_a8R X́ hQxjLERԙBΨh@G&%rݪ􆳛ͪ D:WsI~9/.OCA EY2ɉQ%.Xm>SV7cދ~kiȿ71ϙH5…g)kd0CB sMQ-ǃ)a)™0:f5 FN2_iî.9!eÇЇDȆ(bTke3QԠ;din^\i2ľo2-37Âq6T%H<U?*uGNT!E ҏI=JԠTq%%7Y{f2ۓ(#iVAR&NO,T4\ejCrZLZ^{P:KWi]l)cغsl+bg<'gfXDѠ`YDlj{֫Q;iۯ., -…](3T̮b!ú>Qvx&BNQX1iqc+V^,ֱ3c(6I/}S޴$VGմbsKm*ߙr5-IOvjOhݰ "p%/dɩ(*b_[uIuq^ /C"ˍF.*s#d_"A'dV|&xZvXy+=VS}6e'Rgmf6gcol:enyMi7nB$J sHU-Sb+](mw$wp$JhBgZM\KЛ@}Ǹɀ\ԤJb/RpVb/>OW]ak U6mҭ1NH\ke3R̚+;V#J#Uۯ6.L5;dW^W--2_VJ'!7ZD\Œf72YlԚ+rOiI&bA7\M^6J!oY ݜQ 7Q5z8*-8_.a;ֵ q\26 Q_ HA<9E"=Iwdd1;W=!F$^VBEJ4H@5uaaZqw4EJ^m$)UM"衡 "Y!rY)=` neldMbCQrGSȇESXtݰ%hu`b= Zm#*"fdZMƏe,Қ(ĩJ 9S"m7^dX6md&B4B0u&qfi:ig^)Bb8R(B)v))~>)ivr..iJz'iR)z*jZ)&j2⩣)*餪槤i.꧆)i)j꤮i*Vjꭆijj2)fin))v* *rBJkkVk"뚊inNrVbj.+k+^jj*++*kfi&>ln*bl.ljj"*jlV*lv죪쭾,*ڪfnlάΦ+⪵:kli˂]+N,N)r+kV~)Bmآ+–V+Zmnlrm.)n"n*2n:Bng@;